ID: 1083538718

View in Genome Browser
Species Human (GRCh38)
Location 11:63495692-63495714
Sequence ATGGCTAAGGGCCTGGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083538718_1083538724 0 Left 1083538718 11:63495692-63495714 CCCACATCCAGGCCCTTAGCCAT No data
Right 1083538724 11:63495715-63495737 GCATCTCACCTGCCATTAGTAGG No data
1083538718_1083538725 6 Left 1083538718 11:63495692-63495714 CCCACATCCAGGCCCTTAGCCAT No data
Right 1083538725 11:63495721-63495743 CACCTGCCATTAGTAGGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083538718 Original CRISPR ATGGCTAAGGGCCTGGATGT GGG (reversed) Intergenic
No off target data available for this crispr