ID: 1083538953

View in Genome Browser
Species Human (GRCh38)
Location 11:63498302-63498324
Sequence CACCACAGGGTGAAGTGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083538953_1083538961 20 Left 1083538953 11:63498302-63498324 CCAGAGCACTTCACCCTGTGGTG No data
Right 1083538961 11:63498345-63498367 CAAGTTCTGACCACTGGCTAGGG No data
1083538953_1083538959 14 Left 1083538953 11:63498302-63498324 CCAGAGCACTTCACCCTGTGGTG No data
Right 1083538959 11:63498339-63498361 GAAACTCAAGTTCTGACCACTGG 0: 8
1: 52
2: 130
3: 270
4: 476
1083538953_1083538962 24 Left 1083538953 11:63498302-63498324 CCAGAGCACTTCACCCTGTGGTG No data
Right 1083538962 11:63498349-63498371 TTCTGACCACTGGCTAGGGCTGG No data
1083538953_1083538960 19 Left 1083538953 11:63498302-63498324 CCAGAGCACTTCACCCTGTGGTG No data
Right 1083538960 11:63498344-63498366 TCAAGTTCTGACCACTGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083538953 Original CRISPR CACCACAGGGTGAAGTGCTC TGG (reversed) Intergenic
No off target data available for this crispr