ID: 1083539888

View in Genome Browser
Species Human (GRCh38)
Location 11:63505322-63505344
Sequence CTCCATGTACAGATGAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083539881_1083539888 23 Left 1083539881 11:63505276-63505298 CCCCAGATACAGGCCTCGCTGTG No data
Right 1083539888 11:63505322-63505344 CTCCATGTACAGATGAACAAAGG No data
1083539880_1083539888 24 Left 1083539880 11:63505275-63505297 CCCCCAGATACAGGCCTCGCTGT No data
Right 1083539888 11:63505322-63505344 CTCCATGTACAGATGAACAAAGG No data
1083539884_1083539888 21 Left 1083539884 11:63505278-63505300 CCAGATACAGGCCTCGCTGTGGG No data
Right 1083539888 11:63505322-63505344 CTCCATGTACAGATGAACAAAGG No data
1083539886_1083539888 10 Left 1083539886 11:63505289-63505311 CCTCGCTGTGGGACATGCTGCTA No data
Right 1083539888 11:63505322-63505344 CTCCATGTACAGATGAACAAAGG No data
1083539878_1083539888 28 Left 1083539878 11:63505271-63505293 CCCACCCCCAGATACAGGCCTCG No data
Right 1083539888 11:63505322-63505344 CTCCATGTACAGATGAACAAAGG No data
1083539879_1083539888 27 Left 1083539879 11:63505272-63505294 CCACCCCCAGATACAGGCCTCGC No data
Right 1083539888 11:63505322-63505344 CTCCATGTACAGATGAACAAAGG No data
1083539882_1083539888 22 Left 1083539882 11:63505277-63505299 CCCAGATACAGGCCTCGCTGTGG No data
Right 1083539888 11:63505322-63505344 CTCCATGTACAGATGAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083539888 Original CRISPR CTCCATGTACAGATGAACAA AGG Intergenic
No off target data available for this crispr