ID: 1083541941

View in Genome Browser
Species Human (GRCh38)
Location 11:63517624-63517646
Sequence ACATATAAATTTTAGTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083541941_1083541947 10 Left 1083541941 11:63517624-63517646 CCTCCCAACTAAAATTTATATGT No data
Right 1083541947 11:63517657-63517679 GCACCCAAGGAAATGGTGTTTGG No data
1083541941_1083541949 13 Left 1083541941 11:63517624-63517646 CCTCCCAACTAAAATTTATATGT No data
Right 1083541949 11:63517660-63517682 CCCAAGGAAATGGTGTTTGGAGG No data
1083541941_1083541953 18 Left 1083541941 11:63517624-63517646 CCTCCCAACTAAAATTTATATGT No data
Right 1083541953 11:63517665-63517687 GGAAATGGTGTTTGGAGGTGGGG No data
1083541941_1083541955 28 Left 1083541941 11:63517624-63517646 CCTCCCAACTAAAATTTATATGT No data
Right 1083541955 11:63517675-63517697 TTTGGAGGTGGGGACTTTGGAGG No data
1083541941_1083541945 3 Left 1083541941 11:63517624-63517646 CCTCCCAACTAAAATTTATATGT No data
Right 1083541945 11:63517650-63517672 AATCCTAGCACCCAAGGAAATGG No data
1083541941_1083541944 -3 Left 1083541941 11:63517624-63517646 CCTCCCAACTAAAATTTATATGT No data
Right 1083541944 11:63517644-63517666 TGTTGAAATCCTAGCACCCAAGG No data
1083541941_1083541956 29 Left 1083541941 11:63517624-63517646 CCTCCCAACTAAAATTTATATGT No data
Right 1083541956 11:63517676-63517698 TTGGAGGTGGGGACTTTGGAGGG 0: 5
1: 34
2: 297
3: 1046
4: 2293
1083541941_1083541951 16 Left 1083541941 11:63517624-63517646 CCTCCCAACTAAAATTTATATGT No data
Right 1083541951 11:63517663-63517685 AAGGAAATGGTGTTTGGAGGTGG No data
1083541941_1083541954 25 Left 1083541941 11:63517624-63517646 CCTCCCAACTAAAATTTATATGT No data
Right 1083541954 11:63517672-63517694 GTGTTTGGAGGTGGGGACTTTGG No data
1083541941_1083541952 17 Left 1083541941 11:63517624-63517646 CCTCCCAACTAAAATTTATATGT No data
Right 1083541952 11:63517664-63517686 AGGAAATGGTGTTTGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083541941 Original CRISPR ACATATAAATTTTAGTTGGG AGG (reversed) Intergenic
No off target data available for this crispr