ID: 1083543772

View in Genome Browser
Species Human (GRCh38)
Location 11:63534132-63534154
Sequence TTGCAGCAAGAGAGAGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083543770_1083543772 -7 Left 1083543770 11:63534116-63534138 CCACTGCACTGGGATTTTGCAGC No data
Right 1083543772 11:63534132-63534154 TTGCAGCAAGAGAGAGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083543772 Original CRISPR TTGCAGCAAGAGAGAGAGAT GGG Intergenic
No off target data available for this crispr