ID: 1083544545

View in Genome Browser
Species Human (GRCh38)
Location 11:63538650-63538672
Sequence CAGGACATGGAGAAGTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 549
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 500}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083544535_1083544545 5 Left 1083544535 11:63538622-63538644 CCAGTCATGAGGCTGCTATGCCC 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1083544545 11:63538650-63538672 CAGGACATGGAGAAGTGGGAAGG 0: 1
1: 0
2: 2
3: 46
4: 500
1083544534_1083544545 8 Left 1083544534 11:63538619-63538641 CCTCCAGTCATGAGGCTGCTATG 0: 1
1: 0
2: 4
3: 9
4: 126
Right 1083544545 11:63538650-63538672 CAGGACATGGAGAAGTGGGAAGG 0: 1
1: 0
2: 2
3: 46
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083544545 Original CRISPR CAGGACATGGAGAAGTGGGA AGG Intronic
901013443 1:6213741-6213763 CAGGACATGGAGGAGAGGGCAGG + Intronic
901228368 1:7628169-7628191 CAGCACATGGAGAAGGAGAAGGG - Intronic
901750033 1:11400402-11400424 CTGGACAGGGAGAGGTGGGACGG + Intergenic
902659654 1:17892243-17892265 CAGGACGCTGAGAAGTGGGTGGG - Intergenic
903031423 1:20466758-20466780 CAGGACTTAGAGAGGTGGAAGGG - Intergenic
903193703 1:21669936-21669958 CAGGCTACGGAGAAGTGGAAGGG + Intergenic
903314717 1:22493640-22493662 CAGGGCATGGGTAAGTGGAAGGG - Intronic
903506262 1:23837875-23837897 AATGACATGGAAAGGTGGGAAGG + Intronic
904320796 1:29696853-29696875 CGGGACAAGGAGAGGTGGAAGGG - Intergenic
904334737 1:29789615-29789637 AAGGACAAGGAGAAGGGAGAGGG + Intergenic
904927830 1:34062516-34062538 AAGGACATGGAGGACAGGGAAGG + Intronic
904939111 1:34152453-34152475 GAGGATTTGGAGAAGGGGGATGG - Intronic
905275724 1:36816752-36816774 AGGGGCCTGGAGAAGTGGGAAGG - Intronic
905412720 1:37782812-37782834 CAAGTTTTGGAGAAGTGGGATGG - Intergenic
905429120 1:37908847-37908869 AGAGACATGGAGAAGTGGGTGGG - Intronic
905505198 1:38473768-38473790 GAGGATAGGGAGAAATGGGAAGG + Intergenic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906694393 1:47814431-47814453 CTGGACAAGGAGAGGTGAGAAGG + Intronic
907623054 1:56001566-56001588 AAGGAAATGGAGAAGTTTGAGGG + Intergenic
909308951 1:74121287-74121309 CATGACATGGAAAAGTTGGATGG - Intronic
909432767 1:75608764-75608786 AAGGACATGAAGCAGTGGAAGGG - Intronic
909576318 1:77180692-77180714 CAGGACAACTAGAAGTGGGTGGG + Intronic
910455691 1:87395186-87395208 CAGGAAAAGCAGCAGTGGGAGGG + Intergenic
910570331 1:88694278-88694300 CAGGGGATGGAGGAGAGGGAAGG - Intronic
912169529 1:107081682-107081704 CTGGAAATGGAGATTTGGGAAGG - Intergenic
912397075 1:109353825-109353847 GAGAACTTTGAGAAGTGGGAGGG + Intronic
912503993 1:110143172-110143194 GTGGGCATGGAGATGTGGGAAGG + Intergenic
913309332 1:117472183-117472205 GAGGACATAGAGAAGGCGGAAGG - Intronic
914334018 1:146698937-146698959 CATTACATGCAGATGTGGGAGGG - Intergenic
914682303 1:149947175-149947197 CAGAACAAGGAGATCTGGGATGG - Intronic
915006962 1:152647193-152647215 CAGTACATGGAACAGTGAGAAGG - Intergenic
915168470 1:153962029-153962051 CAGGGAATGGGGAAGGGGGAGGG + Intronic
915341988 1:155181692-155181714 CAGGACATGGGAAACTGGAATGG - Intronic
915938477 1:160103066-160103088 CTGGGAATGGAGAAGTGGGATGG - Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
917653919 1:177106989-177107011 CAGGCCATGCAGCAGTGGGGTGG + Intronic
918363032 1:183778593-183778615 TAGCCCATGGAGAACTGGGAGGG + Intronic
918528053 1:185486578-185486600 CAGAGCCTGGAGAAGTGGAATGG + Intergenic
918671655 1:187224466-187224488 GAGGAGAGGGAAAAGTGGGAAGG - Intergenic
919481662 1:198097592-198097614 CACAACATTGAGAAGTGGAAGGG + Intergenic
919534218 1:198766701-198766723 CAGGAGATGGTGACATGGGAAGG + Intergenic
919747268 1:201016747-201016769 CAGGAGAGGGACAAATGGGAGGG - Intronic
919780830 1:201219817-201219839 CAGGACATGGAATGGAGGGATGG + Intronic
920036846 1:203071654-203071676 CAGGAGAGGGAAAGGTGGGAAGG - Intronic
920086213 1:203419308-203419330 CAAGGCAGGGAGAAGGGGGAGGG + Intergenic
920357960 1:205389578-205389600 CTGGACTTGGAGAAGTCAGAAGG + Intronic
920601463 1:207329088-207329110 AAGAACATGGACCAGTGGGAGGG + Intronic
922534726 1:226371335-226371357 CTGGACATGCAGAAATGGAAAGG - Intronic
922781600 1:228257026-228257048 GAGGGCATGGAGAAGTGGAGAGG - Intronic
923364011 1:233241511-233241533 AAGGACATGGAAATTTGGGAGGG + Intronic
924643989 1:245860172-245860194 CAGGTCATGTGGGAGTGGGAGGG - Intronic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
1063200294 10:3780985-3781007 CAGAACATTTAGAACTGGGAAGG - Intronic
1063205355 10:3826077-3826099 CACGTCATGGAGGAGTGGGAGGG - Intergenic
1063703097 10:8404574-8404596 CAGGGTATGGAGAAGTTGGTTGG + Intergenic
1064177478 10:13087466-13087488 GTGGACATGGAGAAGGGAGAGGG - Intronic
1065381588 10:25096401-25096423 GAGGACAGGGAAGAGTGGGAAGG - Intergenic
1066965299 10:42258403-42258425 GAGGATATGGAGAAATAGGAAGG - Intergenic
1067191246 10:44070019-44070041 TAGGACCGGGGGAAGTGGGATGG + Intergenic
1067529781 10:47061772-47061794 GAGGAGTTGGAGAATTGGGATGG + Intergenic
1067561642 10:47308713-47308735 CAGGAAATGAAGCAGTGGAAAGG + Intronic
1067717236 10:48699057-48699079 GAGGAAATGGAGACGTGGCAGGG - Intronic
1068318591 10:55380681-55380703 CAGGACTTGGAGAAGGGACAAGG + Intronic
1068435049 10:56979761-56979783 TAGGACTTGGATAGGTGGGAAGG + Intergenic
1068786645 10:60982909-60982931 GTGGGCATGGAGCAGTGGGAGGG + Intronic
1069348452 10:67497561-67497583 GAGGACGTGGAGAAATAGGAAGG - Intronic
1069684963 10:70312082-70312104 CAGGACCTGGGGAAGTGTCAAGG + Intronic
1070374669 10:75818051-75818073 CAAGATCTGGAGAAGTGAGAGGG + Intronic
1070866646 10:79711328-79711350 CAGGACCTGGAGCAGGAGGAAGG + Exonic
1070880435 10:79849449-79849471 CAGGACCTGGAGCAGGAGGAAGG + Exonic
1070953771 10:80451503-80451525 CAGGGAATGGAGAACTGGGAGGG - Intergenic
1071666053 10:87559659-87559681 CAGGACATCTTGATGTGGGAGGG - Intergenic
1071832604 10:89386863-89386885 CAGTACCTGGAGTGGTGGGAAGG - Intronic
1071859122 10:89654792-89654814 CAGGAGAGAGAGAATTGGGAGGG + Intergenic
1073063434 10:100745358-100745380 CAGGGGAGGGAGAAATGGGAGGG - Intronic
1073627775 10:105117476-105117498 CAGGTCCTTGAGAAGAGGGATGG - Intronic
1074185832 10:111098780-111098802 CAGTCCAGGGAGAACTGGGATGG + Intergenic
1074784666 10:116828422-116828444 AAGGAGATGGAGAGGTAGGAAGG - Intergenic
1075219493 10:120572329-120572351 CAGGGCATGGAGAAGGGGAAGGG - Intronic
1075838808 10:125479549-125479571 TAGGACTTGTAGATGTGGGAGGG + Intergenic
1076437917 10:130459306-130459328 CAGGAGAAGGTGAAGAGGGAGGG + Intergenic
1076437924 10:130459336-130459358 CAGGAGAAGGTGAAGAGGGAGGG + Intergenic
1077392575 11:2306919-2306941 GAGGAGATGGAGGAGGGGGAAGG + Intronic
1078266137 11:9757560-9757582 CAGGACATGAGGCATTGGGATGG - Intergenic
1079303028 11:19296343-19296365 CAGGAATTGGAGAACTGAGATGG - Intergenic
1079979133 11:27130846-27130868 CAGGCCATGGAGTAGTGGCTTGG - Intergenic
1080320946 11:31008417-31008439 CAAGAGATGGAAAAGAGGGATGG + Intronic
1080355866 11:31444907-31444929 TAGGAGATGGAGAAGAGGGTTGG + Intronic
1081555526 11:44157447-44157469 AAGGAGAGGGAAAAGTGGGAAGG - Intronic
1081605799 11:44526491-44526513 CAGGGCCTGGAGAAGGGGGTGGG - Intergenic
1081671359 11:44944430-44944452 CAGCAGATGGGGAGGTGGGAGGG - Intronic
1082960285 11:58913115-58913137 CAGGAGATGGGGCAGAGGGAGGG + Intronic
1083392540 11:62365130-62365152 CAGGAGTGGGAGAAATGGGAAGG + Intronic
1083411886 11:62499603-62499625 CAGGAGATGGAGGAGTGGCTAGG - Intronic
1083544545 11:63538650-63538672 CAGGACATGGAGAAGTGGGAAGG + Intronic
1083732525 11:64660543-64660565 CAGGAGTTGGGGAAGAGGGAAGG + Intronic
1083964654 11:66035975-66035997 AAGGGCATGGAGAAGAGGAAGGG - Intergenic
1084215371 11:67644573-67644595 CAGGGCCAGGGGAAGTGGGATGG + Intronic
1084930799 11:72554072-72554094 CAGGACATAGATAGATGGGAGGG - Intergenic
1084949621 11:72657474-72657496 AGGGAGATGGAGGAGTGGGAGGG - Intronic
1085247756 11:75117873-75117895 CATGGGATGGGGAAGTGGGAGGG - Intronic
1085372247 11:76020055-76020077 AAGGAGAGGGAAAAGTGGGAAGG - Intronic
1087104498 11:94396488-94396510 CAGCACATGGATATTTGGGAAGG - Exonic
1089024203 11:115251442-115251464 CAGAAAATTGGGAAGTGGGAGGG + Intronic
1089292727 11:117448065-117448087 CAAGACATGAAGAAGATGGAGGG + Intronic
1089843909 11:121443037-121443059 GAGGACATGAAGACGTGGGATGG + Intergenic
1090149075 11:124362883-124362905 GAGGACGTGGAGAAATAGGAAGG + Intergenic
1090376709 11:126294702-126294724 CATGATAGGGAGAAGTGAGAGGG - Intronic
1090591475 11:128274862-128274884 CAGAGAATGGAGAAGCGGGAAGG - Intergenic
1090709481 11:129372951-129372973 CGGGGAAGGGAGAAGTGGGAGGG + Intergenic
1090927142 11:131259154-131259176 CAGGGCATGGAAATGAGGGATGG + Intergenic
1090958158 11:131532237-131532259 CAGGAGCTGGAGGAGTGGGGTGG - Intronic
1091198213 11:133749910-133749932 GAGGAGAGGGAGAAGAGGGAGGG - Intergenic
1091584591 12:1808905-1808927 CATGAAAGGGAGAAGGGGGAGGG + Intronic
1092132118 12:6119947-6119969 GAGCTCATGGAGGAGTGGGAAGG + Intronic
1092144477 12:6205032-6205054 CAGGGCATGGACAAGTTGGGTGG + Intronic
1093647841 12:21609196-21609218 ATGAACCTGGAGAAGTGGGAAGG + Intergenic
1095320749 12:40822890-40822912 AGGGACAGGGAGAAGTGGGTAGG - Intronic
1096644052 12:53018862-53018884 CAGCCCGTGGAGCAGTGGGAAGG - Exonic
1096665212 12:53159906-53159928 GAGGAAATGAAGAAGCGGGAAGG - Exonic
1096675795 12:53225120-53225142 AGGGACCTGGGGAAGTGGGAAGG - Intronic
1098558993 12:71851401-71851423 AAGGAAATGGAGATTTGGGAGGG - Intronic
1099764101 12:86960548-86960570 AAGGAGAGGGAGAAGTGGGAAGG - Intergenic
1100510082 12:95262046-95262068 AAGGAGTTGGAGAAGTGGGATGG - Intronic
1100855243 12:98752093-98752115 CAGGACAACTAGAAATGGGAAGG - Intronic
1101530140 12:105566409-105566431 CAGCAGCTTGAGAAGTGGGAAGG - Intergenic
1102223095 12:111208034-111208056 AAGGAGAAGGGGAAGTGGGAGGG + Intronic
1102392757 12:112562900-112562922 AGGGATAGGGAGAAGTGGGAAGG - Intergenic
1103037124 12:117665541-117665563 CGGGCCATGGGGAAGTGGGGAGG + Intronic
1103244781 12:119447308-119447330 CAGTACAAGGGGAAGTGGGAGGG - Intronic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1104092761 12:125529522-125529544 CAGGACACACAGAGGTGGGAAGG - Intronic
1104341689 12:127955881-127955903 CAGGCGATGGTGAAATGGGAAGG - Intergenic
1104894975 12:132159579-132159601 CAGGGCATGGAGATGTGGGCGGG + Intergenic
1105726246 13:23164997-23165019 CAGGAGAAGGTGCAGTGGGAGGG - Intergenic
1106197847 13:27509417-27509439 CTGGAGATAGAGAAGTGGGAAGG - Intergenic
1106228274 13:27801469-27801491 CAGAGCATGGAGAAGTATGATGG + Intergenic
1106533600 13:30618054-30618076 CAGGTAAGGGAGAAGAGGGAGGG + Exonic
1107310703 13:39074034-39074056 CAGCACATTGAGAAGGGGGGTGG - Intergenic
1107333973 13:39333728-39333750 GAGGATATGGAGAAATAGGAAGG + Intergenic
1108128968 13:47276557-47276579 CAAGGCATGGAGAAGGAGGAAGG + Intergenic
1109237489 13:59842815-59842837 CAGGACAAGGAATGGTGGGACGG + Intronic
1109556405 13:63981690-63981712 CAGGAAATGAAAAAGAGGGAAGG - Intergenic
1109592841 13:64509368-64509390 GAGGATGTGGAGAAATGGGAAGG - Intergenic
1111303399 13:86373883-86373905 GAGGATATGGAAAAGTGGGAAGG - Intergenic
1111639573 13:90950034-90950056 CAGCAAATGGCGAAGAGGGAAGG + Intergenic
1112506457 13:99979209-99979231 CAGGACAGGGAAGAATGGGACGG + Intergenic
1113014929 13:105818041-105818063 AAGGCCAGGGAGAAGTGGGCAGG + Intergenic
1113508814 13:110835183-110835205 CACCATAGGGAGAAGTGGGATGG - Intergenic
1114609728 14:24031213-24031235 GAGGATGTGGAGAAGTAGGAAGG + Intergenic
1114676063 14:24441064-24441086 CAGGTCATGGAGAAGTTCAAGGG - Exonic
1115501654 14:34055087-34055109 GAGGGCATGGAGAAGTGGAAGGG + Intronic
1116169197 14:41377198-41377220 AAGGACATGTAGAAGTGGCAGGG - Intergenic
1116609486 14:47049277-47049299 CAGGACATGGAGATGGAGGTGGG + Intronic
1116672412 14:47860509-47860531 CAGGACAAGGAGTAGTGGTCAGG + Intergenic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117940971 14:60964291-60964313 CAGACCTTGGAGAAGAGGGAGGG - Intronic
1118907135 14:70031359-70031381 CAGGAGATGGAGGAGTGGAGAGG - Intronic
1118923536 14:70171269-70171291 AAGGACATGGAACATTGGGATGG + Intronic
1119574085 14:75702708-75702730 CAGCCCAGGGAGAGGTGGGAGGG - Intronic
1120708888 14:87772959-87772981 CAGGACCTGGTGGAGTTGGAGGG + Intergenic
1120781573 14:88490458-88490480 CAGGGCAGGAAGAGGTGGGAGGG - Intronic
1121676197 14:95754912-95754934 CAGGGCATGGTGGGGTGGGATGG + Intergenic
1122200244 14:100118206-100118228 CAGGCTATGAGGAAGTGGGAGGG + Intronic
1122719003 14:103711889-103711911 CAGGACATGGGGAAACTGGAAGG + Exonic
1122815707 14:104311493-104311515 CGAGACATGGTGAAGCGGGAAGG - Intergenic
1123131264 14:105987452-105987474 TAGGAGATGGAGAAAAGGGATGG - Intergenic
1123871471 15:24578974-24578996 CAGGGCATGCAGAAGGGGCATGG + Intergenic
1124526430 15:30457943-30457965 TAAGAGATAGAGAAGTGGGAAGG - Intergenic
1124772224 15:32549741-32549763 TAAGAGATAGAGAAGTGGGAAGG + Intergenic
1125044546 15:35230892-35230914 GAGGAGATGGAAAAGTGGGGAGG - Intronic
1125242508 15:37592133-37592155 CAGCACTTGGCGAAGTGGAAGGG + Intergenic
1125892894 15:43279307-43279329 CAGGACATGGACCAGAGAGAGGG + Intronic
1126853181 15:52811247-52811269 TAGGATTTGGGGAAGTGGGAGGG + Intergenic
1127875982 15:63111663-63111685 GCTGACATGGGGAAGTGGGAGGG + Intergenic
1128688025 15:69701358-69701380 CAGAGCTTGGAGAACTGGGATGG + Intergenic
1129283626 15:74506030-74506052 CAGGGCAGGGAGCAGTGGGACGG - Intergenic
1129704193 15:77785240-77785262 CAAGAGAGGGAGATGTGGGAGGG - Intronic
1129797255 15:78387227-78387249 CAGACCTAGGAGAAGTGGGAAGG + Intergenic
1130481199 15:84360682-84360704 CAGGAACGGGAGAAGGGGGATGG - Intergenic
1130766855 15:86879503-86879525 GAGGGCAAGGAGGAGTGGGAGGG - Intronic
1131111977 15:89770163-89770185 CTGGATATGGAGAGGTGGGGAGG + Intronic
1131940485 15:97559601-97559623 CAGAAGATGTAGAAGTGGTATGG - Intergenic
1132009817 15:98266274-98266296 AAGGAAATGCAGACGTGGGAGGG - Intergenic
1133107826 16:3525136-3525158 CAGGCCATGGAGAAATGGTACGG + Intronic
1133152759 16:3849278-3849300 CTGGACTTGGAGAAGGGGGAAGG - Intronic
1134063679 16:11213454-11213476 CAGCCCCTGGAGGAGTGGGAGGG - Intergenic
1135638280 16:24097752-24097774 CAGGACAACTAAAAGTGGGACGG + Intronic
1135739102 16:24958007-24958029 AAGGACAGGCAGAGGTGGGAGGG + Intronic
1135776196 16:25258716-25258738 ATGGAATTGGAGAAGTGGGAGGG + Intergenic
1135934800 16:26770611-26770633 GAGGAAAAGGAGAAGAGGGAAGG + Intergenic
1136702006 16:32152813-32152835 CAGGGCATGGGGAAGGGAGACGG + Intergenic
1136765660 16:32774647-32774669 CAGGGCATGGGGAAGGGAGACGG - Intergenic
1136777230 16:32878522-32878544 CAGAACCTGGAGAGGTGGGCAGG + Intergenic
1136802439 16:33095731-33095753 CAGGGCATGGGGAAGGGAGACGG + Intergenic
1137027216 16:35489035-35489057 CAGGCCATGCAGATCTGGGAGGG + Intergenic
1137337707 16:47566659-47566681 CAGCCCCTGGAGCAGTGGGAAGG + Intronic
1137898393 16:52238278-52238300 GAGGCCATGGAGCAGTGGGATGG + Intergenic
1138424366 16:56920928-56920950 GAGCACATGGACACGTGGGAGGG + Intergenic
1138609510 16:58111480-58111502 CAGGAGGTGGAGAAGTGGAGGGG - Intergenic
1139098763 16:63738959-63738981 CAGGACATGGAAAATTGTCAGGG + Intergenic
1139307738 16:66001817-66001839 CAGGACTTGGATCAGTGAGACGG - Intergenic
1139364308 16:66424383-66424405 CATGGCATGGAGATGTTGGAAGG - Intergenic
1139999601 16:71012312-71012334 CATTACATGCAGATGTGGGAGGG + Intronic
1140286592 16:73608237-73608259 AAGCACATGGGGAAATGGGAAGG - Intergenic
1140937607 16:79689155-79689177 CAATAAATGGAAAAGTGGGATGG + Intergenic
1141510248 16:84507208-84507230 CTGGACATGGAAAATTGGGCAGG - Intronic
1203068048 16_KI270728v1_random:1036895-1036917 CAGGGCATGGGGAAGGGAGACGG - Intergenic
1142516007 17:429550-429572 AAGGACGTAGAGAAGAGGGAAGG + Intergenic
1143871312 17:9959018-9959040 CAGGAGAAGGGGAGGTGGGAGGG + Intronic
1143887530 17:10076192-10076214 AGGGAGAGGGAGAAGTGGGAGGG + Intronic
1144415453 17:15042279-15042301 CAGGACATGGAGCAGGGAGAAGG - Intergenic
1144570686 17:16396555-16396577 CAGGACCTTGAGAAGGGAGAAGG + Intergenic
1144645924 17:16973323-16973345 GAGGACATGGAGAGGTGGAGAGG + Intergenic
1145209305 17:21001398-21001420 CAGGCCATGGAGAAGCTGGTGGG - Exonic
1145965390 17:28913084-28913106 CAGGACAAGGGGTAGTGGGAAGG + Exonic
1147263621 17:39222809-39222831 CAGGATATGGGGAGGTGGGGAGG - Intronic
1147536927 17:41327501-41327523 CAGGACAATGGAAAGTGGGAGGG - Intergenic
1147754680 17:42760830-42760852 CCAGACGTGGAGAAGAGGGAGGG - Intronic
1148460389 17:47836350-47836372 CAGGTCCAGGAGAAGTGGCAGGG - Exonic
1148987011 17:51631756-51631778 AAGGTCATGGAGAATTGGAAGGG - Intronic
1149009009 17:51835633-51835655 CAAGAAATGGAGCAATGGGAGGG + Intronic
1149804341 17:59600932-59600954 CTGGAGATGGAGAAGTGGTAAGG - Intronic
1150851547 17:68708192-68708214 CAGGCGTTGCAGAAGTGGGAGGG - Intergenic
1151001132 17:70377735-70377757 CAAGACAAACAGAAGTGGGATGG + Intergenic
1151413656 17:73947619-73947641 GAGGACAGGGAGGAGTGGGGAGG + Intergenic
1152275692 17:79355470-79355492 CAGGACCTGGAGAGGCTGGAGGG - Intronic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1156445672 18:37235172-37235194 AAGGACAGGGAGAATTTGGATGG + Intergenic
1157622899 18:49026439-49026461 CAGGGGATGGAGAAATGGCAGGG - Intergenic
1157686890 18:49650137-49650159 CAGGACTAGGGGAAGAGGGAAGG + Intergenic
1157916359 18:51667544-51667566 CAGGACACGGGGAAGGGAGAAGG + Intergenic
1158591428 18:58782131-58782153 CTAGAAATGGAGAAGAGGGATGG - Intergenic
1159127329 18:64238777-64238799 CAGGAAATGGAGAAGGGGGTTGG - Intergenic
1160590703 18:79943499-79943521 CGGGACTGGGAGAAGTGGCATGG - Intronic
1161106028 19:2444552-2444574 CAGGACAGGGTGAAGCGAGAGGG + Intronic
1161257401 19:3316939-3316961 CAGGAGATGGAGATGAGGAAGGG - Intergenic
1164397207 19:27876710-27876732 CAGGACCTGGTGAAGGGGAAGGG + Intergenic
1164654357 19:29910054-29910076 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164654382 19:29910134-29910156 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164654428 19:29910274-29910296 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164663946 19:30010044-30010066 CAGTACATGGAGCAGAGAGAGGG - Intronic
1164718701 19:30415250-30415272 CAGGAGGAGGAGAAGGGGGAGGG - Intronic
1164727418 19:30475686-30475708 AAGGACATGGAGAAGGGGCTGGG - Intronic
1165096177 19:33411088-33411110 CACGACAAGGAGATGTGGGCAGG - Intronic
1165433630 19:35785383-35785405 CAGGAGAGGGAGAGGTAGGAGGG - Intronic
1165942283 19:39420938-39420960 CAGGAGATGGAGCTGTGGGAGGG - Exonic
1166069945 19:40381173-40381195 CGGGGCATGGAGAAGGGGGCAGG + Intronic
1166135382 19:40773968-40773990 CAGGAAGTGGAGAAGTGGAGAGG - Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166329581 19:42070216-42070238 CAGGAGAGAGAGAAGAGGGAGGG + Intronic
1166729830 19:45052777-45052799 CAGGGCATCCTGAAGTGGGAGGG - Exonic
925181465 2:1819747-1819769 GAGGACAAGGAGCAGTGGAAGGG + Intronic
925406109 2:3606330-3606352 CAGGACGTGGACAGCTGGGAAGG - Intronic
926792036 2:16583743-16583765 GAGGACATGGAGACATGGGAAGG + Intronic
927041416 2:19234413-19234435 CAGTGCTTGGAGAAGGGGGAAGG + Intergenic
927218195 2:20681931-20681953 CAGGGCATGGAAGGGTGGGAAGG + Intergenic
927400890 2:22708390-22708412 CAGGAGAAGGAGAAGTGAGTGGG + Intergenic
927707153 2:25303494-25303516 CAGGACCTGGAGAGGTGGCCTGG - Intronic
929084911 2:38158576-38158598 CAGGATGTGGAGAGGTGGGGAGG - Intergenic
929901941 2:46012519-46012541 GGGGACAGGGGGAAGTGGGAGGG - Intronic
930768413 2:55108397-55108419 CAGGAGAGGGAGAAGGGTGAAGG + Intronic
931403203 2:61950802-61950824 CAGGTCAGGAAGGAGTGGGAGGG + Intronic
932591117 2:73068346-73068368 CAGGACACAGAGATGTGGGCTGG + Intronic
933199716 2:79435082-79435104 CAGGACATGAAGGTGTGGGGAGG + Intronic
933387907 2:81634652-81634674 AAGGAGAAGGAAAAGTGGGAAGG + Intergenic
933796965 2:85927440-85927462 CAGGACAAGGCTATGTGGGATGG + Intergenic
934166182 2:89296382-89296404 CAGGGCAAGGAGAACTGGGTGGG - Intergenic
934201093 2:89886074-89886096 CAGGGCAAGGAGAACTGGGTGGG + Intergenic
934314736 2:91906842-91906864 GAGGATATGGAGAAATAGGAAGG + Intergenic
935786028 2:106549679-106549701 CAGGGCAAGGAGAGGTGGGAGGG + Intergenic
936832835 2:116669860-116669882 AAGGAGAAGGAGAAGAGGGAAGG - Intergenic
937936146 2:127247144-127247166 CAGGACTGTGAGAAGTGGGGAGG - Intergenic
939977636 2:148737460-148737482 CTGGAGATGGAGGAGTGGGATGG + Intronic
940165529 2:150766299-150766321 TAGCACATGGAACAGTGGGAAGG - Intergenic
940315115 2:152320246-152320268 AAGGAGAAGGAAAAGTGGGAAGG - Intergenic
940413281 2:153390946-153390968 CAGGGTAAGGAGAATTGGGAGGG + Intergenic
940959304 2:159765366-159765388 CAGGACATTAAGAAGAGGGTAGG - Intronic
941157707 2:161999532-161999554 CCTGGCAAGGAGAAGTGGGAAGG + Intronic
941916978 2:170819342-170819364 CAAGAGATGGGGAACTGGGAGGG + Intronic
941942330 2:171053783-171053805 CAGGACCTGGAAAAGAAGGAGGG - Exonic
942616375 2:177795512-177795534 TAGGGCATGGAGAAGGGGGTGGG + Intronic
943344144 2:186717558-186717580 AAGGAGACAGAGAAGTGGGAGGG - Intronic
943406979 2:187501296-187501318 CAGGACATGGGGCGGGGGGAGGG - Intronic
943824431 2:192371121-192371143 CAAGAGATAGTGAAGTGGGAGGG - Intergenic
944412368 2:199457468-199457490 TAGGACCTGGGGAAGAGGGAAGG - Exonic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
946660440 2:221993535-221993557 GAGGACATGGTGTAGTGTGATGG + Intergenic
946762720 2:223010962-223010984 CAGGAAAAGTGGAAGTGGGAGGG + Intergenic
947873568 2:233453353-233453375 CAGGACAAAGAGATGAGGGAAGG - Intronic
948052861 2:234991736-234991758 CAGGAGTTGGGGAAGTGGAAAGG + Intronic
948939204 2:241187764-241187786 GAGGAGAGGGAGAAGTGGGGGGG + Intergenic
1169112706 20:3044119-3044141 ATGGACCTGGACAAGTGGGAGGG + Intronic
1169252107 20:4068780-4068802 CAGGACATGCACATGTGGCAAGG + Intergenic
1170953410 20:20956575-20956597 CAGGGAATGCAGACGTGGGAGGG + Intergenic
1172017920 20:31889928-31889950 CAGGACAGGAAGAAGAGGGGAGG + Intronic
1172484649 20:35291053-35291075 CAGGAGAAAGAGAATTGGGAGGG - Intronic
1173107552 20:40152024-40152046 CAGGACATGGAGCAGGGGCTGGG - Intergenic
1173178595 20:40784274-40784296 CAGGCTATGGTGAAGAGGGAGGG - Intergenic
1173255335 20:41390567-41390589 CCGGACCTGGAGAAGGGGAAAGG - Intergenic
1173458486 20:43222894-43222916 CAGGACATTTAGAAGTGCTAGGG - Intergenic
1174303543 20:49599549-49599571 CAGGTCCTGGAGCACTGGGAGGG + Intergenic
1174831796 20:53820331-53820353 AAGGAGAGGGAAAAGTGGGAAGG - Intergenic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175700625 20:61134350-61134372 CAGCACAAGGAGATGTGGAATGG + Intergenic
1175904553 20:62372938-62372960 CAGGAGAGGGAGGGGTGGGAGGG - Intergenic
1175998074 20:62820211-62820233 CATGGCAGGGAGAAGGGGGATGG + Intronic
1176020162 20:62958676-62958698 CTGGACTTGGAGGAGAGGGAGGG - Intronic
1176717388 21:10364586-10364608 CAGGTCCTGGAGAAGGGGCAAGG - Intergenic
1177012470 21:15745050-15745072 CAGGAAAAGAAGGAGTGGGAAGG - Intronic
1177321509 21:19527144-19527166 CAGGACTTGGGGAAAAGGGAGGG - Intergenic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1179043187 21:37823034-37823056 AAGGACATGTTGAAGAGGGAGGG + Intronic
1179793502 21:43768950-43768972 GAGGACATTCAGATGTGGGAAGG + Intergenic
1180298612 22:11017506-11017528 CAGGTCCTGGAGAAGGGGCAAGG - Intergenic
1181829298 22:25546536-25546558 CAGGACATCTAGAAGGGAGAAGG - Intergenic
1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG + Intergenic
1182572587 22:31249825-31249847 CTGGACAGGGGGAAGGGGGAAGG + Intronic
1182965388 22:34516703-34516725 CAGAACTTGGAGAACTTGGATGG - Intergenic
1183104496 22:35606536-35606558 CAGGGCATGGGGAAATGGAAGGG - Intergenic
1183350275 22:37331038-37331060 CAGGCCAGGGAGGAGGGGGAAGG - Intergenic
1184449686 22:44575634-44575656 GATGACAAGGAGAAGGGGGATGG + Intergenic
1185273316 22:49938433-49938455 CCAGACATGGAGAAGGCGGATGG + Intergenic
1185333710 22:50262416-50262438 CAGGACAGGCAGGGGTGGGATGG - Intergenic
949127947 3:469091-469113 GAGGAAAAGGAGAAGGGGGACGG - Intergenic
950569591 3:13791897-13791919 CAGGGCACGGAGAAGGGTGAAGG - Intergenic
951880469 3:27476676-27476698 TAGGAGAGAGAGAAGTGGGAAGG - Intronic
952864448 3:37843705-37843727 GAGGACGTGGAGAAATAGGAAGG + Intergenic
953554726 3:43935065-43935087 GAGGATATGGAGAAATAGGAAGG - Intergenic
954389515 3:50261267-50261289 CAGGACATGCAGAGCTGGGCAGG + Intergenic
954634363 3:52063581-52063603 CAGGACGAGGAGAAGAGGGAGGG - Intergenic
954864516 3:53717546-53717568 CCTACCATGGAGAAGTGGGATGG + Intronic
954992749 3:54855191-54855213 CAGGAAATGGAGAGAGGGGAGGG + Intronic
955109222 3:55931114-55931136 GAGGACATGGAGAAATAGGGAGG + Intronic
956570728 3:70691377-70691399 GAGGATGTGGAGAAGTAGGAAGG - Intergenic
956686956 3:71838638-71838660 CAGGGCAACTAGAAGTGGGAGGG - Intergenic
957808965 3:85192510-85192532 CAAGAAGTGGAGAAGTAGGAAGG + Intronic
957843238 3:85698579-85698601 CAGGAGAAGGAGAGGTGGGGTGG + Intronic
957906161 3:86558810-86558832 CAGGTCTTGGGGAAATGGGAAGG + Intergenic
957927185 3:86829209-86829231 CAGGACCTGGGGAAGTAGAAAGG - Intergenic
960228200 3:115192334-115192356 CAGGACAACTTGAAGTGGGAAGG - Intergenic
960912189 3:122660823-122660845 CAGCCCGTGGAGCAGTGGGAAGG - Intergenic
961925207 3:130472157-130472179 CAGGGAATGGGGAAGTTGGAGGG + Intronic
961935780 3:130582072-130582094 CTGAGTATGGAGAAGTGGGAAGG + Intronic
962443222 3:135442379-135442401 CATGATATGGAGTAGTGGTAAGG + Intergenic
966473606 3:180319813-180319835 CTGGGCAAGGAGGAGTGGGAAGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967409041 3:189148888-189148910 CAGGAACGGGAGAAATGGGATGG - Intronic
968541141 4:1169027-1169049 CAGGACATGGAGAGAAGGGTGGG - Intronic
968912972 4:3485202-3485224 CAGGGCATGGGGAGGAGGGAGGG - Intronic
969121324 4:4913492-4913514 CAGGCCCTGGGGAAGGGGGAGGG + Intergenic
969606358 4:8204131-8204153 CAGGGCATGGAGAACCGGGACGG - Intronic
970059380 4:12013792-12013814 CATGACTTGGAGAAGTATGAAGG - Intergenic
970064859 4:12081680-12081702 CAAGACATGGAGAAGGGGGATGG + Intergenic
970318324 4:14851111-14851133 TAGGACATGGAGGACTGGGTGGG - Intergenic
970410159 4:15798223-15798245 CAAGACATCCAGAAGTGGGGTGG + Intronic
971094666 4:23387296-23387318 CAGGAAATGGAGAAGGGTGCAGG - Intergenic
971105215 4:23517342-23517364 AAGGAGAAGGAGGAGTGGGAAGG - Intergenic
971139085 4:23904124-23904146 AAGGGCATGGTGACGTGGGAGGG + Intergenic
973061113 4:45726086-45726108 TGGGAGTTGGAGAAGTGGGATGG + Intergenic
973288023 4:48441140-48441162 CAGGAGAAGGAGAAGTGCGTGGG - Intergenic
973643414 4:52925979-52926001 CAGTAAATGGAGAAGAGTGAGGG - Intronic
974901268 4:68001390-68001412 TAGGTTATGGAGCAGTGGGAGGG + Intergenic
974901896 4:68009736-68009758 CAGGACATGGAGTGGGGAGAAGG - Intergenic
975224479 4:71855871-71855893 CAGGACAACTTGAAGTGGGAAGG + Intergenic
975257474 4:72254962-72254984 GAGGACAGGAAGATGTGGGAAGG + Intergenic
975289147 4:72656643-72656665 GAGGATATGGAGAAATAGGAAGG + Intergenic
975290378 4:72671205-72671227 CAGGACACTGAGACTTGGGATGG + Intergenic
975426251 4:74231345-74231367 CAGGACATGGAGAAGTTCCAAGG + Intronic
975900749 4:79149311-79149333 CAGGACATTGAAGAGTGGGAGGG - Intergenic
978275379 4:106942938-106942960 CAAGACCTGGAGAAGTAGGCAGG - Intronic
978303393 4:107294970-107294992 AGAGACATGGAGAAGGGGGATGG + Intergenic
978479451 4:109172459-109172481 CAGGACATGGATTTGTAGGAAGG - Intronic
979396108 4:120191564-120191586 TAGGACAAGGGGAAGAGGGAAGG - Intergenic
980930063 4:139176726-139176748 CGGGACTTGGAGAAAGGGGAAGG - Intronic
981720635 4:147797929-147797951 CAGGACAAAGAGGAGAGGGATGG - Intronic
982573046 4:157074961-157074983 CAGGACCTGGTGCAGTGGGGTGG + Intergenic
983337173 4:166411756-166411778 CAAGCTATGAAGAAGTGGGAAGG - Intergenic
984489134 4:180410159-180410181 AAGGAAATGGGGAAGTGAGAGGG - Intergenic
984501525 4:180565148-180565170 CAGGGTATGAGGAAGTGGGAGGG - Intergenic
985202738 4:187501434-187501456 GAGGGGATGGAGAAGAGGGACGG - Intergenic
986782718 5:11081816-11081838 CAGGGGCTGGAGAAGGGGGATGG + Intronic
986866727 5:11998034-11998056 CAGGACATGAAGAAATGAGTGGG - Intergenic
988265799 5:28949282-28949304 ACAGACAGGGAGAAGTGGGAGGG + Intergenic
989138145 5:38175638-38175660 CAGGAAATCAAGAACTGGGAAGG - Intergenic
989204645 5:38798533-38798555 CAGGACACCTCGAAGTGGGAAGG + Intergenic
989419160 5:41215703-41215725 CAGGACATGGAGAGTTAAGATGG + Intronic
989479056 5:41907077-41907099 CAGGAGATGGTGAAGGCGGAGGG + Intronic
990503647 5:56423154-56423176 AAGGGCATGGAGAAGTGAGCTGG - Intergenic
992381143 5:76239087-76239109 CAGGACATACAGAAGTGGGGGGG - Intronic
992651261 5:78863119-78863141 GAGGATGTGGAGAAATGGGAAGG + Intronic
992773659 5:80071472-80071494 GAGGACAGGTAGAAATGGGAAGG - Intronic
993163054 5:84314279-84314301 CAGATCATGGAGAAGAGGGTAGG + Intronic
994862539 5:105216629-105216651 AAGTACATAGACAAGTGGGAAGG - Intergenic
996013730 5:118508074-118508096 CAGGACATGCTGAAGTAGGCAGG + Intergenic
996337809 5:122403878-122403900 CAGGATAAGGAGAAGAGGGGAGG - Intronic
996393241 5:122986480-122986502 CAGAAAAAAGAGAAGTGGGAGGG + Intronic
996760831 5:126984347-126984369 CAGGACAGGGGGATGTGGAAGGG + Intronic
996837585 5:127810937-127810959 ATGGACATGGAGCAGAGGGAAGG - Intergenic
996951820 5:129135921-129135943 CAAGACATGGAGAAGTAGAAAGG - Intergenic
998189495 5:140011006-140011028 CAGGACAAACAGTAGTGGGAGGG - Intronic
998217921 5:140251443-140251465 CAGGACATGGGAAATTGGGGTGG - Intronic
998598765 5:143562633-143562655 AAGCACGTGGAGAAGTAGGAGGG - Intergenic
998660690 5:144233860-144233882 AAGGAGAGGGAGAAGAGGGAGGG + Intronic
999147853 5:149407606-149407628 CTGCACATGGAGCAATGGGAAGG + Intergenic
999295699 5:150458334-150458356 CAGGACAGGAAGAAGAGGGTGGG + Intergenic
999384630 5:151145472-151145494 AAAGACATGAAGAAGTAGGATGG - Intronic
999571760 5:152926645-152926667 CAAGACCAGGAGAGGTGGGAAGG - Intergenic
999766980 5:154748591-154748613 CAGGACAAGTGGAAGTGGAAAGG + Intronic
1000768135 5:165317582-165317604 CAGGACATGCAAATGAGGGAGGG - Intergenic
1001189547 5:169615697-169615719 CAGGAGAGGGAGAAGAGTGAAGG - Intergenic
1001760952 5:174207682-174207704 CAAGAAATGGAGGATTGGGAGGG - Intronic
1003192491 6:3886835-3886857 CACGACATGAGGAAGGGGGAAGG + Intergenic
1003812993 6:9805229-9805251 AGGGAGATGGAGAAGGGGGAGGG - Intronic
1004173547 6:13318290-13318312 CATGACTGGGAGACGTGGGATGG + Intronic
1004226532 6:13789811-13789833 AAAGAGATGGAGAAGAGGGAGGG + Exonic
1004364391 6:14999627-14999649 TAGGAGATGGGGAAGCGGGAAGG - Intergenic
1004728836 6:18337914-18337936 TAGGAAATGGAGATGTAGGAAGG + Intergenic
1005598546 6:27403329-27403351 TAGGACATGTAGAAGTGCCAAGG - Exonic
1005766920 6:29020902-29020924 CAGGCCAGGTAGATGTGGGATGG - Intergenic
1005965524 6:30723838-30723860 AAAGAAATGGAGACGTGGGAAGG - Exonic
1006111280 6:31747187-31747209 CCGTACATGGAGATGGGGGAAGG - Intronic
1006360423 6:33584251-33584273 AAGGACAGGGAGATGTGGGTGGG + Intergenic
1007189327 6:39999902-39999924 AAAGAAATGGAGATGTGGGAAGG - Intergenic
1007283503 6:40730293-40730315 CAGGACCTGGAGGAGGGGGATGG + Intergenic
1007433647 6:41792177-41792199 AAGGGCATGGAGAGCTGGGACGG + Exonic
1007513388 6:42391765-42391787 CAGAACATGGAGCAGTGGGCTGG + Intronic
1008243641 6:49144229-49144251 CAGGAGATGGATAGGTGTGAAGG - Intergenic
1008759613 6:54837916-54837938 TAGGACAAGGAGAGGTGGGAGGG + Intergenic
1008883262 6:56403797-56403819 AAGGAAATGAAGCAGTGGGAGGG + Intergenic
1008956835 6:57224738-57224760 AAGGAAATGGAAAAGTGGGGAGG - Intergenic
1008970864 6:57366433-57366455 AAGGACATGGAGATGTGGTTGGG + Intronic
1009159826 6:60268235-60268257 AAGGACATGGAGATGTGGTTGGG + Intergenic
1009212892 6:60884219-60884241 GAGGATATGGAGAAATAGGAAGG - Intergenic
1013294566 6:108747299-108747321 CAGGACCTGGGGCAGGGGGATGG - Intergenic
1013853472 6:114543079-114543101 CAGGGGCTGGAGAAGGGGGATGG - Intergenic
1014789883 6:125660165-125660187 CAATACATGAAGAAGTAGGAGGG - Intergenic
1015111454 6:129596449-129596471 CAGAACAAGGGGAATTGGGAAGG - Intronic
1015112337 6:129607478-129607500 AAGCACAAGGAGAAGTGGTAGGG - Intronic
1015646953 6:135402600-135402622 GAAGAGGTGGAGAAGTGGGAAGG - Intronic
1016014368 6:139168571-139168593 CAGGACAGGTAGAAGCAGGAGGG - Intronic
1016104496 6:140145629-140145651 CAGGACATGGACACGTGGGTGGG + Intergenic
1016730808 6:147425567-147425589 GAGGATGTGGAGAAGTAGGAAGG - Intergenic
1017249387 6:152263047-152263069 CAGGACATGGAGAGATAGTACGG + Intronic
1017658275 6:156650240-156650262 CAGGACACGGAGAAGCTGGAGGG - Intergenic
1018255314 6:161912570-161912592 CAGCACGTGGAGAGGTGGTATGG + Intronic
1018585086 6:165349208-165349230 GAAGACAGGAAGAAGTGGGAAGG + Intronic
1018617533 6:165702280-165702302 AAGGAAATGGAGAAGAGGCAGGG - Intronic
1018955799 6:168409861-168409883 CAGGCAGTGGAGCAGTGGGAGGG + Intergenic
1021017940 7:15558927-15558949 CAGGACAAGAAGAAATGGGTGGG + Intronic
1021432425 7:20575770-20575792 CAGGAAATAGAAAAGTGAGAAGG - Intergenic
1021946085 7:25728695-25728717 CAGGACAAGGAAAAGTGCGACGG + Intergenic
1022511073 7:30935281-30935303 GAGGTCCTGGAGAACTGGGAAGG - Intergenic
1022901235 7:34812436-34812458 TAGGAGATGCTGAAGTGGGATGG + Intronic
1023299342 7:38752445-38752467 TAGGTGATGGAGAAGTGGAAAGG + Intronic
1023908914 7:44540431-44540453 AAGGACATGGAGCAGGGGCAGGG + Intronic
1024663903 7:51526857-51526879 GAGGATATGGAGAAAGGGGAAGG + Intergenic
1025858028 7:65301201-65301223 CAAGATAAGGAGAAGAGGGAAGG - Intergenic
1027137052 7:75631915-75631937 CAGGAAATGGGGAAGTGGGAGGG + Intronic
1027385481 7:77655568-77655590 TGGTACATGGAGAAGTAGGAAGG - Intergenic
1027707384 7:81551078-81551100 CAGGACAACTCGAAGTGGGAGGG - Intergenic
1028600306 7:92593524-92593546 CAGGGGCTGGAGGAGTGGGAAGG - Intergenic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1029958764 7:104667964-104667986 CAGCCCGTGGAGCAGTGGGAAGG - Intronic
1030272512 7:107685613-107685635 CAGGAAAGGGAGTAGAGGGAAGG - Intronic
1030640803 7:112004047-112004069 CAGATCCTGGAGAAGTGTGATGG - Exonic
1031175347 7:118341742-118341764 AAGGATGTGGAGAATTGGGAAGG + Intergenic
1031280833 7:119797544-119797566 CAGGAGAGGGAAGAGTGGGAAGG - Intergenic
1031810403 7:126360887-126360909 CAGGACACCTAGAAGTGGGTGGG + Intergenic
1032071257 7:128808651-128808673 CAGGAGACGGAGGACTGGGAAGG + Intronic
1032413643 7:131719453-131719475 CAGGGGATGGAGAGATGGGAAGG + Intergenic
1032911774 7:136440513-136440535 CAGGAGACAGAGAAGAGGGAGGG - Intergenic
1033046487 7:137967098-137967120 CAGGGCAAAGAGGAGTGGGAAGG - Intronic
1033990909 7:147285713-147285735 TGGGACATGGAGAAGAGGCAAGG + Intronic
1034056650 7:148042356-148042378 CAGGGCATGGTGGAGGGGGAAGG + Intronic
1035352959 7:158259301-158259323 CAGGACACGGAGAAGAGCCAGGG + Intronic
1036474441 8:9080508-9080530 CAGGAACTGGAGAAGTGTCAGGG - Intronic
1036572272 8:9990890-9990912 CAGGACTTGGAGAAGACGAATGG + Intergenic
1037338586 8:17816467-17816489 GAGGATATGGAGAAATAGGAAGG + Intergenic
1037858319 8:22387493-22387515 CAGGACGTGGAGGAGTGAAAGGG + Intronic
1037911390 8:22745713-22745735 CAGGAGATGGAGAACAGGAACGG - Intronic
1038596431 8:28890497-28890519 CAGGAAGAGGAGAAGGGGGAGGG - Exonic
1038757222 8:30352783-30352805 AAAGAAATGGAGACGTGGGAAGG - Intergenic
1038780422 8:30564901-30564923 GGGGACATGGAGGAGAGGGAGGG + Intronic
1041273208 8:56129956-56129978 CAGGAGATGGAGAAGAAGGAAGG + Intergenic
1041567274 8:59293115-59293137 CAGGCCAAGAAGAAGGGGGAAGG + Intergenic
1041603969 8:59758181-59758203 TAGGACAAGGAGCTGTGGGACGG + Intergenic
1043603311 8:81967977-81967999 GAAGACAAGGAAAAGTGGGAAGG + Intergenic
1043824654 8:84911670-84911692 CATGAAATGGGGGAGTGGGAAGG - Intronic
1043936433 8:86147954-86147976 AAGCAATTGGAGAAGTGGGAAGG - Intronic
1044043123 8:87395357-87395379 CAAGTTATGGAGAAGAGGGAAGG + Intronic
1044925796 8:97207828-97207850 TATGACATGGGGAAGTGGCAAGG + Intergenic
1044932020 8:97260133-97260155 CAGGAGAAGGAGGAGGGGGAGGG + Intergenic
1045694670 8:104795034-104795056 CAGTACATGAAAAAGTGGGAGGG - Intronic
1045742336 8:105375959-105375981 TAGGGCATAGAGAAGTGGGGTGG - Intronic
1046890516 8:119416588-119416610 CAGGAGATGGAGAAGCAGGAAGG - Exonic
1048482570 8:134813314-134813336 CAGGACATGGATAACCGAGATGG + Intergenic
1049291632 8:141806374-141806396 CAGGACATGGAAAGGAAGGAGGG - Intergenic
1049855577 8:144859691-144859713 CTGGACTTGGCGGAGTGGGATGG + Intergenic
1050163159 9:2738767-2738789 AATGACATGGGGTAGTGGGAAGG + Intronic
1050480141 9:6080276-6080298 CAGGAACTGGAGGAGTGGGATGG - Intergenic
1050811327 9:9751570-9751592 GAGGTCATGTTGAAGTGGGATGG + Intronic
1051707671 9:19897926-19897948 CAGCAAAAGGAAAAGTGGGATGG - Intergenic
1051895290 9:21980381-21980403 AAGGAAATGAAGAACTGGGATGG + Intronic
1052997163 9:34557249-34557271 CAGAACATGCAGCAGGGGGAAGG - Intronic
1053163325 9:35828672-35828694 CATGACCTGGGGAAGTGGGTAGG + Exonic
1055131940 9:72785709-72785731 CTGGGCAGGGTGAAGTGGGAAGG + Intronic
1057037103 9:91818924-91818946 CATGACCTGCAGAAGAGGGAGGG - Intronic
1057563330 9:96146222-96146244 CAGCCCGTGGAGCAGTGGGAAGG - Intergenic
1057584534 9:96317374-96317396 CTGGAGGTGGAGAAGTGGTATGG - Intergenic
1059617815 9:115969779-115969801 CAGGCCATTGAAAAGTGGCATGG - Intergenic
1059756718 9:117300734-117300756 CAGAAGGTGGAGAAGTGGCAGGG + Intronic
1060103271 9:120857960-120857982 CAGTACCTGGTGGAGTGGGAAGG - Exonic
1060228151 9:121808730-121808752 GAGGACATGGAGGGGTGGGCTGG - Intergenic
1060332613 9:122686800-122686822 CAGGACCTGGAAAAGAAGGAAGG + Intergenic
1060566339 9:124595748-124595770 CATGAAATGGAGACATGGGAAGG - Intronic
1061294708 9:129670875-129670897 CAGGAAATAGAGAAAGGGGAAGG - Intronic
1061386676 9:130294732-130294754 TTGGACATGGAGGAGTGGGGTGG + Intronic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1061609076 9:131734227-131734249 CATGCCCTGGAGAAGTGGAATGG - Intronic
1062226384 9:135454711-135454733 CAGAAAATGGAAAAGTGGCAAGG - Intergenic
1062591181 9:137275510-137275532 CAGGATAGGGGGAAGTGGCAGGG + Intergenic
1062658452 9:137615837-137615859 CAGGCCTTGGAGACGTGGGCAGG - Exonic
1186333132 X:8557687-8557709 GAGGATATGGAGAAATAGGAAGG + Intronic
1186370362 X:8940485-8940507 CTGGAGATCGAGATGTGGGAGGG - Intergenic
1187338543 X:18401668-18401690 CAGGACAGGGACAAATGAGAAGG - Intergenic
1187733724 X:22282742-22282764 CAAGACACGGAAAAGTGAGAGGG - Intergenic
1188006580 X:25020229-25020251 GAGGACACGGCGAAGAGGGAAGG - Intergenic
1189914487 X:45843346-45843368 AAGAACATGGGGCAGTGGGAGGG + Intergenic
1190381763 X:49845958-49845980 CAGCCTATGGAGATGTGGGATGG - Intergenic
1191904696 X:66076113-66076135 CAGCCCGTGGAGCAGTGGGAAGG + Intergenic
1192118755 X:68435050-68435072 CAGGACATGGACATCTGTGAAGG + Intergenic
1192184656 X:68938872-68938894 CAGGAAACTGAGAAGAGGGAGGG - Intergenic
1193476646 X:81974284-81974306 GAGGACATGGAGAAATAGGAAGG + Intergenic
1194049724 X:89053916-89053938 GAAGACAGGAAGAAGTGGGATGG - Intergenic
1195065668 X:101236128-101236150 TAGGAAAGGGAGAAGTGGGTGGG - Intronic
1195285887 X:103383303-103383325 CAGAACTGGGAGAAGTGGGTGGG - Intergenic
1195724278 X:107898091-107898113 CAGTACATGAAGAACTGGGAGGG - Intronic
1195923961 X:110007060-110007082 CAGGAAATAGATAAGTTGGAGGG + Intronic
1195992915 X:110700702-110700724 CAGGAGATGGAGAACTGTCATGG - Exonic
1196080068 X:111621253-111621275 CAGCCCGTGGAGCAGTGGGAAGG + Intergenic
1196597609 X:117563559-117563581 AAGGACTAGGAGAAGTTGGAAGG - Intergenic
1196645802 X:118116649-118116671 CAGGACAGGGTGAAGTGGTCGGG - Intronic
1198039716 X:132838148-132838170 CAGGATCTGGTGAAGTGGGTGGG - Intronic
1198187463 X:134267248-134267270 AAGGACAAGGGGAAGTGGCAGGG + Intergenic
1199374186 X:147088077-147088099 AAGGAGATGGAAGAGTGGGAAGG - Intergenic
1199537340 X:148917637-148917659 CAGTAGTTGGAGAAGTTGGATGG + Intronic
1200084470 X:153596831-153596853 CAGCACATTGAAAAGTGGGCTGG + Intronic
1200177292 X:154125957-154125979 GAGGACACGGAAAAGTGGGGAGG + Intergenic