ID: 1083547444

View in Genome Browser
Species Human (GRCh38)
Location 11:63559422-63559444
Sequence GGACCCTGGATTCCTGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083547444_1083547450 -6 Left 1083547444 11:63559422-63559444 CCTGTCCCAGGAATCCAGGGTCC 0: 1
1: 0
2: 2
3: 16
4: 229
Right 1083547450 11:63559439-63559461 GGGTCCCCAGGTCCTGGCCGTGG 0: 1
1: 0
2: 6
3: 61
4: 454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083547444 Original CRISPR GGACCCTGGATTCCTGGGAC AGG (reversed) Intronic
900168667 1:1255551-1255573 GGACCGTGGACTCCTGAGAACGG - Intronic
900174354 1:1285258-1285280 AGGCTCTGGAGTCCTGGGACAGG - Intronic
900615944 1:3565683-3565705 GGCCCCTGAACCCCTGGGACAGG - Intronic
902556666 1:17250819-17250841 AGGCCCAGGCTTCCTGGGACAGG - Intronic
902689793 1:18103458-18103480 GGATACTGGATTCTGGGGACAGG - Intergenic
903555010 1:24187102-24187124 GGACCCGGAGCTCCTGGGACAGG - Intronic
903807104 1:26013318-26013340 GGGGGCTGTATTCCTGGGACAGG - Intergenic
903909145 1:26709487-26709509 GGAACCTGGGGTCCTGGGTCGGG - Intronic
904006712 1:27366749-27366771 GGACTTTAGATTCCTGGAACGGG - Exonic
904054704 1:27662483-27662505 GGGGGCTGGATTTCTGGGACTGG + Intergenic
904076895 1:27850107-27850129 GGGCCCTGGCTCCCTGGGCCTGG + Exonic
904541888 1:31239171-31239193 GGACGGTGGCTTGCTGGGACTGG - Intronic
904874477 1:33643738-33643760 GATCCCTGGATTCCTGGAATGGG - Intronic
904974123 1:34442836-34442858 GGAGTCTGGAGGCCTGGGACAGG + Intergenic
907393419 1:54173746-54173768 GGGCACTGGGTTCCTGGGATAGG + Intronic
913378634 1:118184924-118184946 GGACCCAGGGTCCCAGGGACAGG - Intronic
915316232 1:155030529-155030551 GGTCCATGGCTACCTGGGACAGG + Exonic
920337726 1:205256522-205256544 AGAGACTGGATTTCTGGGACAGG + Intronic
1062882417 10:988930-988952 GAACCCAGGATTCCTGAGAGGGG - Intronic
1066185199 10:33003547-33003569 GGACCCTGAGTTTCTGGGAGAGG + Intronic
1067209333 10:44245889-44245911 AGACCAGGGCTTCCTGGGACTGG + Intergenic
1067433666 10:46263020-46263042 GGGCCCTGGAATCCTGGCTCAGG - Intergenic
1067829853 10:49605307-49605329 GGACCCCTGCTGCCTGGGACTGG - Intergenic
1070086938 10:73246997-73247019 GGACCCTGCATACCTGGAAGCGG + Exonic
1073459605 10:103659111-103659133 GGACACTGGAGTCCTAGGATTGG - Intronic
1075124064 10:119685803-119685825 AGGCCCTGGAGTCCTGAGACAGG + Intergenic
1076193522 10:128499209-128499231 GAACCCAGCATTCCTGGGGCAGG + Intergenic
1077035394 11:491934-491956 GGACACAGGATTCCTGGGGAGGG + Intergenic
1077284292 11:1758930-1758952 GCACCCTCGAGTCCTGGGAAAGG + Intronic
1082789206 11:57335690-57335712 GGCCCCTGCCTTCCTGGGACCGG + Intronic
1083035911 11:59637285-59637307 GGCCCCTGGCTGCCTGGGAACGG + Exonic
1083184610 11:61009843-61009865 GGACCCTGGCTGCCAGCGACTGG - Exonic
1083547444 11:63559422-63559444 GGACCCTGGATTCCTGGGACAGG - Intronic
1085702811 11:78760224-78760246 GGATGCTGGATTAGTGGGACAGG - Intronic
1088831073 11:113537363-113537385 GGACCCTGGAGTCCTAGGCAGGG + Intergenic
1089744602 11:120607907-120607929 AGACCCTGGATTCCAGGGGGTGG + Intronic
1090748886 11:129728943-129728965 GGAGCCAGGACTCCTGGGTCCGG - Intergenic
1091990769 12:4954006-4954028 GGACCCTGGATTCTGGGGTGAGG + Intergenic
1092894447 12:12999490-12999512 GAAATCTTGATTCCTGGGACCGG - Intronic
1096001140 12:48131560-48131582 CCACCCTGGTTTCCTGGGGCAGG + Intronic
1096514057 12:52146720-52146742 GGACCCTGGATTCCCCGGCAGGG - Intergenic
1096672970 12:53211130-53211152 GGGCCCTGCATTTCTGGGGCAGG - Exonic
1097172226 12:57122598-57122620 GGATCCTACATTCCTGGGTCTGG + Intronic
1097224532 12:57469572-57469594 GGACCTTGCATTGCTGGCACTGG + Exonic
1097819299 12:64111835-64111857 TGATCCTGTATTTCTGGGACAGG - Exonic
1099402003 12:82211634-82211656 TGACCCTGGAGTCCTGTGAAGGG - Intergenic
1101843884 12:108346360-108346382 CCACCCTGGATGCCTGGGAGGGG + Intergenic
1102570738 12:113825592-113825614 GGTCCCTGCCTTCCTGGGCCAGG + Intronic
1103534586 12:121626236-121626258 GGAGCTTGGACTCCTGGGTCGGG - Intergenic
1104980450 12:132571019-132571041 GGACCCTGGCTCCCGGGGAGGGG + Intronic
1106409085 13:29498678-29498700 AGCTCCTGGATTCCTGGGAAAGG - Intronic
1107565063 13:41593859-41593881 GGAACTTGGATTCTTGGGCCGGG + Intronic
1112580450 13:100673508-100673530 TGACCCTGCATCCCTGGGCCTGG + Intronic
1118216066 14:63809577-63809599 GGAGCCTGGAGTGCTGGGCCTGG - Intergenic
1118559150 14:67059352-67059374 GGAGCCTGGTCTCCTGGAACTGG - Intronic
1119859942 14:77929002-77929024 GGTCCCTGCCATCCTGGGACTGG + Intronic
1121847083 14:97181121-97181143 GGAACCTGGCTCCCTGAGACAGG + Intergenic
1122599109 14:102912493-102912515 GGGCGCTGGAATCCTGGGACTGG + Intergenic
1123187287 14:106531754-106531776 GGTCAAAGGATTCCTGGGACTGG + Intergenic
1124136142 15:27037956-27037978 GGACCCTGCATGCTGGGGACGGG - Intronic
1125979957 15:43991415-43991437 GAGCCCTGAATGCCTGGGACAGG + Intronic
1129187430 15:73918287-73918309 GGACCCTGGAGGCCTTGAACAGG + Intergenic
1129366483 15:75058754-75058776 GGCCTCTGGATTCCTGGAAGAGG + Intronic
1130296910 15:82653738-82653760 GGAGCCTGGATCCCTGAGTCTGG - Intergenic
1130994170 15:88895013-88895035 GGCCCCGGGAGTCCTGGGAGGGG - Intronic
1131332352 15:91513616-91513638 TGAGCCTTGATTCTTGGGACTGG - Intergenic
1131423547 15:92326887-92326909 GGCCCCTGCCTTCCTGGAACAGG + Intergenic
1131509565 15:93042274-93042296 AGACCCTGGACTCTTGGGAGAGG - Intronic
1132726055 16:1338826-1338848 GGACCCTCGACTCCAGGGGCAGG - Intronic
1132867247 16:2099606-2099628 GGACCCGGGAGTACTGGGAATGG - Intronic
1133055534 16:3143851-3143873 GGACCCAGGGTTCCAGGGATGGG + Intergenic
1133145769 16:3785427-3785449 GCACCTTGGAACCCTGGGACAGG + Intronic
1133255092 16:4511798-4511820 GAACCCTGTATTGCTGGGGCCGG - Exonic
1133772982 16:8878429-8878451 GGACCCTGGAGTCCTAGGGTGGG - Intergenic
1134524527 16:14933509-14933531 GGACCCGGGAGTACTGGGAATGG + Intronic
1134712116 16:16331996-16332018 GGACCCGGGAGTACTGGGAATGG + Intergenic
1134719973 16:16375289-16375311 GGACCCGGGAGTACTGGGAATGG + Intergenic
1134947453 16:18336596-18336618 GGACCCGGGAGTACTGGGAATGG - Intronic
1134954713 16:18376698-18376720 GGACCCGGGAGTACTGGGAATGG - Intergenic
1136691782 16:32038201-32038223 GGTCAAAGGATTCCTGGGACTGG - Intergenic
1136792370 16:32981764-32981786 GGTCAAAGGATTCCTGGGACTGG - Intergenic
1136877447 16:33872144-33872166 GGTCAAAGGATTCCTGGGACTGG + Intergenic
1137359155 16:47797383-47797405 GGACCCTGGGATGGTGGGACGGG + Intergenic
1137559190 16:49492304-49492326 GGACCCTAGATCCCCGGGAGAGG + Intronic
1137979122 16:53055034-53055056 AGTCCCAGGATTCCGGGGACTGG + Exonic
1139547464 16:67656438-67656460 GGCCCCTGGCTCCCTGGGCCAGG - Exonic
1139751411 16:69111134-69111156 GGACCCTGGATTTCTAGGCCAGG + Intronic
1140416459 16:74777116-74777138 GGGCCAGGGATTCCTGAGACAGG + Intergenic
1140535951 16:75709905-75709927 TGACCCTGGAGTCCTGTGAAGGG - Intronic
1141400254 16:83741048-83741070 TGGCTCTGGTTTCCTGGGACAGG + Intronic
1141461022 16:84179021-84179043 GGACGCTGGAGGCCTGGGAGTGG + Exonic
1141644371 16:85359355-85359377 GGACTCTGGTTTCCTGGGGCAGG - Exonic
1142027138 16:87820469-87820491 GGACCCTGAGTCCCTGGGATGGG - Intergenic
1142155144 16:88529603-88529625 GGACCCTGGAGTCAGGGGACAGG + Intronic
1142179658 16:88662242-88662264 GGTCCATGGATTCCACGGACTGG + Intronic
1142318114 16:89362001-89362023 GGACCCTGAATTTATGGGAGGGG + Intronic
1203094576 16_KI270728v1_random:1243228-1243250 GGTCAAAGGATTCCTGGGACTGG - Intergenic
1143175299 17:4951614-4951636 GGCCCCTGGATTCTTAGGATGGG + Intronic
1143886963 17:10072135-10072157 GGATCCTGGTTTAATGGGACAGG - Intronic
1144033160 17:11340473-11340495 GGACCAGGCATTCCTGGGCCTGG - Intronic
1144170565 17:12656087-12656109 GAACACTGGGTTCCTGAGACCGG + Intergenic
1147755228 17:42762956-42762978 GATCCCTGGATTGCTGGGAATGG + Exonic
1147917707 17:43898536-43898558 GGCCCTTGAATGCCTGGGACAGG + Intronic
1148115173 17:45171255-45171277 GGACCCAGGGTTCCAGGGGCAGG - Intergenic
1149099472 17:52886229-52886251 GGAGCCTGAATTCCTAAGACAGG - Intronic
1149103165 17:52929763-52929785 GAACCCTGAATATCTGGGACAGG - Intergenic
1150655091 17:67033950-67033972 GGACCTTAGACTCCAGGGACTGG + Intergenic
1151554824 17:74841503-74841525 GGGCTCTGGAATCCTGGGGCAGG - Intergenic
1152415153 17:80155119-80155141 GGTCCCTGGCTTCCTGCAACAGG - Intergenic
1152624915 17:81383743-81383765 GCAGCCTGGGGTCCTGGGACGGG + Intergenic
1153693052 18:7613020-7613042 GGACGCTGGTTTCCTGAGCCAGG - Intronic
1154284279 18:13036796-13036818 GGACCGGGGTTTCCTGGGATGGG + Intronic
1154482898 18:14854776-14854798 GGAACTTGGAGTCTTGGGACAGG - Intergenic
1156799796 18:41096163-41096185 GGAACCTGGAGTCCGGGGTCTGG + Intergenic
1156817699 18:41330552-41330574 GGACCCTAGACTCCTGTGACTGG - Intergenic
1160719703 19:591766-591788 GGACCCTGGACCCCCGGAACTGG + Intronic
1160842577 19:1152791-1152813 AGACCCTGGAGTCCTGGAGCAGG + Intronic
1161140894 19:2647196-2647218 GGAGCCTGGAATCCTGGCATGGG + Intronic
1161781169 19:6293007-6293029 TGACCCTGGAGTCCTGTGAAGGG - Intergenic
1162936474 19:13984011-13984033 TGACCCTGGCTTCCCGGGAGTGG + Intronic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
1163433746 19:17283044-17283066 AGACCCTGGATGTCAGGGACTGG - Intronic
1166306324 19:41938676-41938698 GGGGCCTGGACTCCTGGGTCTGG - Intergenic
1166306521 19:41939231-41939253 GGTGCCTGGACTCCTGGGTCTGG - Intergenic
1166360525 19:42251235-42251257 GGGGCCTGGATGCCTGGGTCTGG - Intronic
1166361562 19:42254782-42254804 GGACCCCCGATTCCTGGCTCCGG - Intronic
1166855833 19:45782286-45782308 GGACCCGGGCTTCCTGGGGCTGG - Intronic
1167298156 19:48663872-48663894 GGTGCCTGGATTCCCGGGGCAGG - Intronic
1167307296 19:48716541-48716563 GGACCCTGGATCCTTGGGAAAGG + Intronic
1167338379 19:48900500-48900522 GGACCCTGGACTCTTGGGTCTGG + Intronic
1167425834 19:49429175-49429197 GGGGCCTGGACTCCTGGGTCCGG + Intergenic
1167425849 19:49429211-49429233 GGGGCCTGGACTCCTGGGTCCGG + Intergenic
1167426917 19:49434236-49434258 GGGGCCTGGACTCCTGGGTCTGG - Intronic
1167539035 19:50073718-50073740 GGAGCCTGAAGTCCGGGGACAGG + Intergenic
1168252148 19:55147255-55147277 GGGGCCTGGACTCCTGGGTCTGG + Intronic
925024032 2:593936-593958 GGACTCTGGATTTGTGGTACTGG + Intergenic
929965309 2:46530191-46530213 GGACCAGGGAATCCTGGGGCTGG - Intronic
931233070 2:60390618-60390640 GAACCCTGGCAACCTGGGACGGG + Intergenic
932423691 2:71615778-71615800 GGGCCCTGGCTTCTGGGGACAGG + Intronic
936067107 2:109340605-109340627 GGACCCTGGGTGCCGGGGCCAGG - Intronic
936114894 2:109693904-109693926 GGACCCTGAATATCTGAGACAGG - Intergenic
938667452 2:133553367-133553389 TGAACCTGAATTCCTGGGGCAGG + Intronic
943731214 2:191305488-191305510 GGATCTGGGATCCCTGGGACAGG - Intronic
946640568 2:221779512-221779534 GGACCCTAGGTTCCTGGGTCAGG + Intergenic
948430259 2:237914075-237914097 GGTCCCTGGATCCCAGGGAGGGG - Intergenic
949021401 2:241743128-241743150 GGACCCTGGCGCCCTGGGTCAGG - Intronic
1169557450 20:6766537-6766559 GGCTCCTGGAATCCTGGGAAGGG + Intergenic
1170955115 20:20972772-20972794 GGACCCCAGATTCCAGGGCCAGG + Intergenic
1171452747 20:25247748-25247770 GGCCCTCGGGTTCCTGGGACCGG - Intergenic
1171958059 20:31475050-31475072 GGGCTCTGGATTCCTGGGTCTGG - Intronic
1173413539 20:42836677-42836699 GGCCACTGAATTCCTGGCACTGG + Intronic
1174411496 20:50339576-50339598 GGAGGCTGGATTGCTGGGAGGGG - Intergenic
1175198152 20:57260345-57260367 GGACCCTGGATTCCAGATGCAGG - Intronic
1175222794 20:57426939-57426961 GGACACTGGTGTCCTGGGATGGG - Intergenic
1175230051 20:57468070-57468092 GGAAGCCGGATTCCTGGGATAGG + Intergenic
1175709237 20:61206084-61206106 GTGCCCTGGCTTCCTGGGGCTGG - Intergenic
1176797704 21:13381790-13381812 GGAACTTGGAGTCTTGGGACAGG + Intergenic
1179304081 21:40139183-40139205 GGACCCTGAAAACCTGAGACAGG + Intronic
1179478031 21:41660218-41660240 GCAGCCCTGATTCCTGGGACAGG + Intergenic
1179558311 21:42194702-42194724 GGACACTGCATACCTGGGGCTGG + Intergenic
1180702502 22:17789301-17789323 GGACCCTGGAATCATGTGGCTGG - Exonic
1180947712 22:19705771-19705793 GGACCCTGCCTGCCTGGCACCGG + Intergenic
1180947732 22:19705842-19705864 GGACCCTGTCTGCCTGGCACTGG + Intergenic
1181574092 22:23783039-23783061 GCACCCTGGAGTCCTGGAGCTGG - Intronic
1181629877 22:24145159-24145181 GGACCCTGTTTTCCTGGGCCAGG + Intronic
1181775345 22:25155055-25155077 GGACCTTGGATACTTGGGATAGG + Intronic
1181875601 22:25938130-25938152 AGAACCTGGATTTCTGGGTCTGG - Intronic
1181886231 22:26024416-26024438 GGACGCTGGTCTCCTGGGATAGG - Intronic
1181967020 22:26663910-26663932 GGTCAGTGGTTTCCTGGGACTGG - Intergenic
1183082893 22:35468120-35468142 GGACACTGGTTTCCTGAGCCTGG - Intergenic
1183285808 22:36962906-36962928 GCACACTGGATTCCTGGGTTGGG + Intergenic
1184243485 22:43223553-43223575 GAACACTGGCTTCCTGGGAGGGG + Intronic
1184796507 22:46736430-46736452 GGCCCCTGCATCCCTAGGACGGG + Intronic
952550491 3:34471597-34471619 AGACCCTGTTTTCCTGGGATAGG + Intergenic
953698428 3:45178066-45178088 AGACCCTGGAATCCTGCGTCTGG - Intergenic
954423063 3:50428785-50428807 GGACACTGGTTTCCTCTGACAGG - Intronic
954498603 3:50988645-50988667 GGCCCCTGTCTCCCTGGGACAGG + Intronic
955046914 3:55369511-55369533 AGATCCTGGAGTCCTGGGCCTGG + Intergenic
956691010 3:71877594-71877616 GGACCCAGGCTTGCTGGGAAGGG + Intergenic
961794752 3:129401552-129401574 GGACCCAGCCTTCCTGGGCCAGG - Exonic
963054888 3:141178098-141178120 TGGCCCTGAATGCCTGGGACTGG - Intergenic
963839418 3:150090524-150090546 GGAAACTGGATCCCTGGGAGGGG + Intergenic
964649283 3:158992723-158992745 GGAGCCTGGATTCATGGGACAGG + Intronic
965535845 3:169822899-169822921 GAACCTTGAAGTCCTGGGACTGG + Exonic
966811095 3:183845679-183845701 GGAGCCTGGAACCCTGGGAAGGG + Intronic
970215077 4:13750490-13750512 GGACCCAGGTTTCTTGGGAGAGG + Intergenic
973646235 4:52953921-52953943 AGACCATGGACTCCTGGGCCAGG + Intronic
974089339 4:57295098-57295120 GGCCCCTGGGTTTCTGGAACAGG - Intergenic
978379976 4:108116695-108116717 GGAGCCTGGATTCTGGGGCCTGG + Intronic
978785012 4:112599820-112599842 GGACCCTTGATTCATGGCAAAGG + Intronic
981751626 4:148097886-148097908 AGACCCTGAATTCCTGCAACCGG + Intronic
981896820 4:149811620-149811642 GGACCCTGGATACCTGGGAGTGG - Intergenic
985673933 5:1220644-1220666 GGACACTGCAGGCCTGGGACCGG + Intronic
985706579 5:1405087-1405109 GGTTCCTGGATTCATGGGGCGGG - Intronic
985908808 5:2863436-2863458 GGAGCCTGGTGTCCTGGCACTGG + Intergenic
986000522 5:3627498-3627520 GGACCCTGCCTTCCTGCGGCGGG + Intergenic
987296225 5:16554305-16554327 TGACCTTGGATTCCTATGACTGG + Intronic
990092160 5:52065262-52065284 GCACCCTTGATTACTGGGGCAGG - Intronic
990547727 5:56839833-56839855 GCACCCTGAATTGTTGGGACAGG + Intronic
993056595 5:82988402-82988424 GGTCCCTGGATTCCCAGGGCAGG - Intergenic
996319935 5:122204220-122204242 GGAACCTGAATCCTTGGGACTGG - Intergenic
1000116676 5:158160341-158160363 TGACCCTGGATTCCCAGGTCCGG + Intergenic
1002031224 5:176432153-176432175 GAACCCTGAATACCTGAGACAGG + Intergenic
1002442885 5:179273457-179273479 GGACTCTGGGCTCCTGGGAGTGG - Intronic
1010104118 6:72147981-72148003 TGACCCTGGAGTCCTGTGATGGG + Intronic
1014045130 6:116876778-116876800 GGACTCTGCACGCCTGGGACAGG - Intergenic
1016940208 6:149477206-149477228 GGCTCCTGAACTCCTGGGACAGG - Intronic
1019029789 6:169000329-169000351 GGAGCCTGAATTCCTAGGAAAGG - Intergenic
1019045560 6:169142706-169142728 GGACCCTTTGTTGCTGGGACAGG - Intergenic
1019695921 7:2446130-2446152 GGACCCTGGAGACCTGGGGCTGG - Intergenic
1020014830 7:4824901-4824923 GGTCACTTGTTTCCTGGGACAGG - Intronic
1021094303 7:16517905-16517927 TGACCCAGGCTTCCTGGAACTGG + Intronic
1026514826 7:71059753-71059775 GGACCCTGGACTCCTCAGGCAGG - Intergenic
1028073957 7:86487499-86487521 GGACCCTGTATTATTGGAACTGG - Intergenic
1029595817 7:101537209-101537231 CCACCCTCTATTCCTGGGACAGG + Intronic
1031026548 7:116685978-116686000 GGACCCTGGTGGCCTGGGCCAGG - Intronic
1031536696 7:122942637-122942659 TTCCCCTGGAATCCTGGGACAGG + Intergenic
1032210194 7:129906720-129906742 GTAACATGGCTTCCTGGGACAGG + Intronic
1034331730 7:150288767-150288789 GGACCAGAGATTCCTGGGAAGGG - Intronic
1034666308 7:152821103-152821125 GGACCAGAGATTCCTGGGAAGGG + Intronic
1034757873 7:153640173-153640195 GGACTCTAGATGCCTTGGACTGG + Intergenic
1035090325 7:156305166-156305188 GGACCTTGGATTCCAGGGAAAGG - Intergenic
1036209838 8:6833194-6833216 GGTCCCTAGTTTCCTGGCACTGG - Intronic
1036772968 8:11591741-11591763 GGTCCCTGGACTCCAGTGACTGG - Intergenic
1042354463 8:67811211-67811233 AGAACCTAAATTCCTGGGACGGG + Intergenic
1043547858 8:81335401-81335423 GGTCCCTTCATTCCTGGGAGGGG + Intergenic
1044008202 8:86962906-86962928 TGACCCTGGAGTCCTGTGAAGGG + Intronic
1044412692 8:91901963-91901985 GCTCCCTTGTTTCCTGGGACAGG + Intergenic
1046924065 8:119767852-119767874 GGTCCCTGGCTTCTTGGGGCTGG - Intronic
1047220029 8:122911497-122911519 AGACCCTGGTTTCATGGGAAGGG + Intronic
1048737470 8:137517805-137517827 GGACCAGGGATTCCTGAGCCAGG + Intergenic
1049710314 8:144060364-144060386 GGACCCTGGAGCCCTCGGGCGGG + Intronic
1050406559 9:5314620-5314642 GTACCCTGCTTTCCTGGAACTGG + Intergenic
1051265642 9:15306697-15306719 TGACCCTGAAGTCCTGGCACTGG - Intronic
1057393327 9:94657448-94657470 GGCGACTGGATTCCTGGGAGAGG + Intergenic
1060210824 9:121709185-121709207 GGGCCCAGGATTCCTGGCACAGG + Intronic
1060265433 9:122109143-122109165 GGCCACTGGCTTCCTGGGCCTGG + Intergenic
1060721588 9:125983241-125983263 GCAGCCTGGCTTCCTGGGATGGG - Intergenic
1061159794 9:128886975-128886997 AGACCCTGGAATCCTGGGCCAGG + Intronic
1061493157 9:130957238-130957260 GGACCCTTGTCACCTGGGACTGG + Intergenic
1187073403 X:15910995-15911017 TGACCATGGTTCCCTGGGACCGG + Intergenic
1193196472 X:78638541-78638563 GATCCCTGGATTCCTTGGATTGG + Intergenic
1193468124 X:81871210-81871232 TGACCCTGGAGTCCTGTGAAGGG + Intergenic
1195615631 X:106909749-106909771 GTCCCTTGGGTTCCTGGGACGGG + Intronic
1195985168 X:110621734-110621756 GGAGGCTGGAATCCTGGGGCAGG - Intergenic
1196409539 X:115401186-115401208 AGACACTGGATTCCTTTGACTGG + Intergenic
1199571804 X:149273922-149273944 GAACCCTGGAGTCCAGGTACAGG + Intergenic