ID: 1083547979

View in Genome Browser
Species Human (GRCh38)
Location 11:63563143-63563165
Sequence GTGGGAAGGAACCACGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083547979 Original CRISPR GTGGGAAGGAACCACGGTGC TGG (reversed) Intronic
900416899 1:2539519-2539541 CTGGGAAGGAAACACGCTCCTGG - Intergenic
902399580 1:16150683-16150705 GTGGGAAGGTACGAGGGTGTGGG - Intronic
903358402 1:22762161-22762183 ATGGGAAGGGGCCAGGGTGCAGG + Intronic
903359304 1:22766863-22766885 GTGAGAAGGAACCCCAGTGTGGG + Intronic
903500754 1:23799052-23799074 GTGGGAAGGAAGCTCTGAGCAGG - Intronic
904565259 1:31424892-31424914 GGGGGAAGGTCCCAGGGTGCAGG - Intronic
905928235 1:41767270-41767292 CTAGGAAGGAAGCACTGTGCTGG + Intronic
907395597 1:54187552-54187574 GTGGGAAGGAAACTCAGTGCTGG - Intronic
912586825 1:110774544-110774566 GTGGGAAGGACTCTCAGTGCTGG - Intergenic
915047460 1:153030430-153030452 ATGGGAAGGAACAAAGGAGCTGG - Intergenic
915165741 1:153946769-153946791 GTGGGAAGCTACCTGGGTGCAGG - Intergenic
918734362 1:188039249-188039271 TTGTGAAGGAAACATGGTGCTGG + Intergenic
919664759 1:200281481-200281503 GTGGGAGGGAACCAGGGGGGAGG - Intergenic
922705325 1:227787555-227787577 GTGGGAAGGAATCAGAGCGCAGG + Intergenic
1064205587 10:13321122-13321144 GGGGCAAGGGACCACAGTGCTGG - Intronic
1064326573 10:14356866-14356888 GTGGGGAGCAACCACGGTGCTGG + Intronic
1065920875 10:30391846-30391868 AAGGTAAGAAACCACGGTGCTGG - Intergenic
1066630425 10:37454376-37454398 GTGGGGAGCATCCACGGTGCTGG - Intergenic
1076067885 10:127463624-127463646 TGTGGCAGGAACCACGGTGCTGG - Intergenic
1076541598 10:131218763-131218785 TGGGGATGGAACCACGGTGCTGG + Intronic
1076714885 10:132358709-132358731 GTGGGGAGGAGCCAAGGTGGTGG + Intronic
1076714944 10:132358935-132358957 GTGGGGAGGAGCCAAGGTGGTGG + Intronic
1076714959 10:132358987-132359009 GTGGGAAGGAGCCGAGGTGGTGG + Intronic
1076714996 10:132359129-132359151 GTGGGAAGGAGCCGAGGTGGTGG + Intronic
1077130294 11:968636-968658 CTGGGTAGGAGACACGGTGCTGG + Intronic
1077454312 11:2669171-2669193 GTGAGAAGGAAGCAAGGTCCTGG - Intronic
1081663504 11:44902949-44902971 GTGTGAAGGAAGCCTGGTGCTGG - Intronic
1083547979 11:63563143-63563165 GTGGGAAGGAACCACGGTGCTGG - Intronic
1083727145 11:64634532-64634554 CTGGGAAGGAACCAAGGTCAAGG + Intronic
1089110256 11:116050135-116050157 GTGGGAAAGAAACACAGGGCTGG + Intergenic
1090070779 11:123543135-123543157 GTGGGAAGACACCAGGGAGCAGG + Intronic
1091337918 11:134786292-134786314 GTGGGAAAGAACCAGGGTAGGGG - Intergenic
1092265631 12:6978299-6978321 GAAGGAAGGAACCAGGGTCCAGG + Intronic
1097290880 12:57913942-57913964 ATGTGAAGGAGCCAGGGTGCTGG - Intergenic
1098202800 12:68074737-68074759 GTGGGAAGGAGCCAAGGGGCAGG + Intergenic
1101791330 12:107930337-107930359 CTGGGAAGGAACCTCAGTGAAGG + Intergenic
1101821853 12:108190553-108190575 GAGGTAAGGAACCACAGGGCAGG + Intronic
1102014103 12:109636578-109636600 GAGTGAAGGCACCAGGGTGCTGG + Intergenic
1102827412 12:115961127-115961149 CTGAGAAGGAATCACAGTGCAGG + Exonic
1106590109 13:31091557-31091579 GAGGGAAGGAATTAGGGTGCTGG + Intergenic
1106868822 13:33996732-33996754 ATGGGAAGGAAACCCAGTGCAGG + Intergenic
1111046478 13:82820467-82820489 GTTGCAGGGAACCACTGTGCTGG - Intergenic
1113258051 13:108528881-108528903 GTGGGAAGGAAACAAGGTAAAGG + Intergenic
1113291543 13:108911965-108911987 CTAGGAGGGAACCAGGGTGCTGG + Intronic
1119889743 14:78173916-78173938 GGGGGAAGGAGCCATGGTGGAGG - Intergenic
1121780885 14:96621878-96621900 GAGGGGAGGAATCAAGGTGCTGG - Intergenic
1122230340 14:100303795-100303817 GTGGGGAGGAACCACTGTCCTGG + Intronic
1128737744 15:70062833-70062855 GTGGGAATGAATCAAGATGCTGG - Intronic
1130118139 15:81023496-81023518 GTGAGGAGGATCAACGGTGCAGG + Intronic
1130664058 15:85854343-85854365 GTGGGAAGGAACCAGCCTGGAGG + Intergenic
1131119320 15:89813248-89813270 GTCGGAAGGAGCCAAGGTGTTGG - Intronic
1132072482 15:98790593-98790615 GTGGGAAGAGACCATGGAGCAGG - Intronic
1138459739 16:57141154-57141176 CTGGGCAGGAACCAGGGTCCTGG + Intronic
1139215876 16:65123506-65123528 TGGGGAAGGAACCCCAGTGCGGG + Intronic
1139551419 16:67675131-67675153 GTGGCAAGGAGCCCAGGTGCAGG + Exonic
1139851062 16:69951807-69951829 GCGGGAGGGAACAGCGGTGCGGG - Intronic
1139880042 16:70174719-70174741 GCGGGAGGGAACAGCGGTGCGGG - Intronic
1140372469 16:74420798-74420820 GCGGGAGGGAACAGCGGTGCGGG + Intronic
1141842665 16:86584102-86584124 GTGGAAAGGAGCCACAGTGCTGG + Intergenic
1142112666 16:88340628-88340650 GGAGGAAGGAACAACAGTGCAGG + Intergenic
1143349537 17:6277325-6277347 GTGGGAAGGTCCCACTGTCCAGG - Intergenic
1145970988 17:28956424-28956446 GTGGGCAGCATCCAGGGTGCTGG + Exonic
1147960822 17:44166690-44166712 ATGTGAAGGGACCAGGGTGCAGG - Intergenic
1148576805 17:48718212-48718234 GTGGGTAGGAACCAGGATGTTGG + Intergenic
1148800285 17:50220939-50220961 GTGGGAGGGGACCACGGCGCAGG - Intergenic
1150252467 17:63714728-63714750 GTGGGCAGGAACGAGGGAGCAGG - Intronic
1150696132 17:67407104-67407126 GTGGGAATGTAAAACGGTGCAGG - Intronic
1152210681 17:79001542-79001564 GTGGGAAGGGACAGAGGTGCCGG - Intronic
1152266077 17:79295710-79295732 GTGGGATGGACACAGGGTGCTGG - Intronic
1152631031 17:81410775-81410797 GTGGGATGGGACCACAGAGCTGG + Intronic
1153261259 18:3226508-3226530 GTGTGAGGGAACCGGGGTGCTGG - Intergenic
1154251415 18:12748075-12748097 GCTGGAAGAAACCACAGTGCTGG - Intergenic
1157282220 18:46353685-46353707 GTGGGAAGGAGCCAGAGTCCTGG - Intronic
1159553098 18:69917388-69917410 GAGGGAAGGAAAGATGGTGCTGG - Intronic
1160065322 18:75568531-75568553 GTGGCAGGGAAGCATGGTGCTGG + Intergenic
1164614044 19:29655409-29655431 GTGGGGAGGAACAAAGGTGGGGG + Intergenic
1165958376 19:39515771-39515793 GTGGGAAGGGGCCCCGGGGCGGG - Exonic
1166113857 19:40640777-40640799 GGGGGAAGCAACCAAGGTGGTGG - Intergenic
1166766485 19:45254332-45254354 GTGGGATGGCACCACGCTGAAGG - Intronic
928430891 2:31217597-31217619 GTGGGGAGGAACCAAGGTCCTGG - Intronic
932659667 2:73641393-73641415 TTGGCAAGGAACCACAGGGCAGG + Exonic
932666230 2:73701070-73701092 TTGGCAAGGAACCACAGGGCAGG + Intergenic
932786213 2:74606131-74606153 GTGGGAAGGAAGCAGGAGGCAGG + Intronic
934989853 2:98913531-98913553 CTGGGAAGGACCCACGGGGCTGG + Intronic
935090416 2:99890555-99890577 GTGGGCAGGAGCCCCGGAGCAGG + Intronic
943115031 2:183658253-183658275 GTGGGAAGGACCCAGGGGGAAGG + Intergenic
944413764 2:199464233-199464255 GAGGGAAGGCACCACGGGGTGGG - Intronic
947140066 2:227012385-227012407 GTGGGAAGGAAGCCTGGGGCTGG - Intronic
948198387 2:236112085-236112107 GTGGCAAGGACCCAGGGTGGGGG - Intronic
948442709 2:238006100-238006122 CTGTGTAGGAAGCACGGTGCTGG + Intronic
948746136 2:240095615-240095637 GGGTGCAGGAACCCCGGTGCAGG + Intergenic
1172195998 20:33091989-33092011 GTGGGAAGGCTCCATGGTGGGGG + Intronic
1173832413 20:46099717-46099739 GTGGTACGGAACCACGGGGGCGG - Intergenic
1174930105 20:54804413-54804435 GAGGGAAGAAACCAGGGTGATGG + Intergenic
1175418834 20:58818551-58818573 CGGGGAAGGAACAACGGTGAGGG + Intergenic
1175524600 20:59624825-59624847 GTGAAAGGGAACCAGGGTGCAGG - Intronic
1177383229 21:20372571-20372593 GTGGGATGGAACTAAGGTGCAGG - Intergenic
1178842694 21:36150625-36150647 ATGGGAAGGAAGCAGGGGGCAGG - Intergenic
1180090373 21:45531089-45531111 CGGGGAAGGATCCACGGGGCAGG + Intronic
1180090392 21:45531133-45531155 GGGGGAAGGATCCACGGGGCAGG + Intronic
1180090414 21:45531177-45531199 GGGGGAAGGATCCACGGGGCAGG + Intronic
1180090436 21:45531221-45531243 GGGGGAAGGATCCACGGGGCAGG + Intronic
1180090472 21:45531309-45531331 GGGGGAAGGATCCACGGGGCAGG + Intronic
1180723451 22:17926746-17926768 GTGGGGAGGCAGCACAGTGCAGG + Intronic
1183510961 22:38234705-38234727 GTGTGAAGTAAGCAGGGTGCAGG - Intronic
1184748644 22:46471826-46471848 GCTGGAAGCCACCACGGTGCAGG - Intronic
1185212275 22:49577050-49577072 GTGAGCAGGAACCAGGGTCCTGG - Intronic
953783754 3:45895018-45895040 GTGGGAAGGATCCACTGTGGGGG + Intronic
954797417 3:53168655-53168677 ATGGGAAGGAGCCACTGTGTGGG + Intronic
954878252 3:53817419-53817441 CTGGGAAGGAACCACTGCCCTGG + Exonic
955413160 3:58668880-58668902 CTGGGTTGGAATCACGGTGCTGG + Intergenic
961213666 3:125143737-125143759 GTGGGAAGGACCCCCAGGGCTGG + Intronic
961785608 3:129344885-129344907 GTGGGAAGGGACCACGGGTAGGG - Intergenic
962478474 3:135778264-135778286 CTGGGAAGGAACCAGAGTGATGG + Intergenic
963068202 3:141280644-141280666 GTGAGCAGGAACCCCGGTGAAGG + Intronic
964650726 3:159008555-159008577 GTGGGATGGTACCAGCGTGCAGG + Intronic
966827080 3:183973947-183973969 GTAGGAAGGAAACATGGGGCTGG - Intronic
968602934 4:1519061-1519083 ATGGAGAGGAACCAGGGTGCCGG - Intergenic
968811201 4:2800417-2800439 CTGGGAAGCAGCCACGGGGCAGG - Intronic
971223078 4:24726744-24726766 GTAGGAAGGGACCATGGTACAGG - Intergenic
973603154 4:52561578-52561600 GTGGGCTGGGACCACAGTGCAGG - Intergenic
984164308 4:176288960-176288982 GAGGGAATGAACCAAGCTGCTGG - Intergenic
985621387 5:957934-957956 ATGGGAAGGACCCACGGCTCTGG + Intergenic
985856421 5:2430787-2430809 GTGGGAATGAGTCAAGGTGCAGG - Intergenic
988375566 5:30430865-30430887 GTTGAAAGGAACCAGGGTGAAGG - Intergenic
988698261 5:33646032-33646054 GTTCCAAGGAACCACTGTGCAGG + Intronic
990616105 5:57510046-57510068 CGGGGAGGGAACCAGGGTGCTGG + Intergenic
991509983 5:67365702-67365724 GTGTGAAAGAAGCAAGGTGCTGG + Intergenic
994460325 5:100063099-100063121 GTGGGAAGTAGGCACGGGGCTGG + Intergenic
994484469 5:100376516-100376538 GTGGGAAGTAGGCACGGGGCTGG + Intergenic
1001251280 5:170148881-170148903 GTGAGAAGGGACCAGGGTACAGG + Intergenic
1002534248 5:179867532-179867554 GTGGGGAGGAGCCAAGGTCCAGG + Intronic
1002818657 6:701877-701899 GTCGGAGGGAGACACGGTGCTGG + Intergenic
1004811122 6:19264466-19264488 CTGGGAAGGAACTCCTGTGCAGG + Intergenic
1006793481 6:36718130-36718152 GTGGGAAGGAGGCAGGCTGCCGG - Intronic
1007597431 6:43060071-43060093 GTCGCAAGGAACCGCGGCGCTGG - Exonic
1011239373 6:85255054-85255076 GAGGGCAGGAACCAGAGTGCAGG - Intergenic
1012921397 6:105224156-105224178 GGGGGAAGGCACCAAGGTACTGG - Intergenic
1013584801 6:111568839-111568861 GTGGGAAGGATTCACAGAGCAGG - Intronic
1015736181 6:136402473-136402495 ATGGGAAGGACCCTCTGTGCAGG - Intronic
1018940266 6:168304852-168304874 GAGGCAAGGAGCCAGGGTGCCGG + Intronic
1019011926 6:168849686-168849708 GTGGGAATGACCAACGGAGCAGG - Intergenic
1019045167 6:169139888-169139910 GGGGGAAGGAACCACTATGGAGG + Intergenic
1019127657 6:169851736-169851758 GAGGGAAGGCCCCACGGTGGCGG - Intergenic
1019274744 7:170058-170080 GTGGGCAGGAGCCACCGGGCTGG - Intergenic
1019486662 7:1292612-1292634 TTGAGAAGGAACCACGTTGGGGG + Intergenic
1019533460 7:1515288-1515310 GTGGGAAGGAACTGAGGAGCAGG + Intergenic
1019578311 7:1748226-1748248 GTGTGGTGGATCCACGGTGCGGG + Intergenic
1019621251 7:1993270-1993292 GTGGGCAGGACCCACAGTGCAGG + Intronic
1020895459 7:13933540-13933562 GAGGAAAGGAAGCAGGGTGCAGG + Intronic
1022215240 7:28253240-28253262 CCTGGAAGGGACCACGGTGCAGG - Intergenic
1024082863 7:45869709-45869731 GTGGGATAGAAACATGGTGCAGG - Intergenic
1024817863 7:53292664-53292686 GTGGGAAGGGTGCAGGGTGCAGG - Intergenic
1029149667 7:98470855-98470877 GAGGGACGGAAGCACGGGGCGGG - Intergenic
1029509871 7:100987403-100987425 GTGGGCCTGAACCAGGGTGCAGG + Intronic
1033581370 7:142740184-142740206 GTGGGAAGGAACTACGCTGTAGG + Intergenic
1034029425 7:147743814-147743836 GTGGGGAGAAGCCACGGAGCTGG - Intronic
1034038801 7:147854623-147854645 GTGGCTAGGAACCACTGTGCTGG - Intronic
1035712145 8:1726205-1726227 GTGGGAATGCAAAACGGTGCAGG + Intergenic
1037361896 8:18083418-18083440 GTGGGAAAGAGCCACGGGACAGG + Intronic
1041892878 8:62890988-62891010 GTGGGAGGGTACCATGATGCTGG + Intronic
1047492606 8:125387065-125387087 GTGGGGAGGAACCAGGATGGAGG + Intergenic
1049165700 8:141124395-141124417 CTGGGCAGGATCCAAGGTGCTGG - Intronic
1049393996 8:142389710-142389732 GAGGGAGGGATCCAAGGTGCAGG + Intronic
1049608668 8:143541767-143541789 GTGGGAAGGAACTGCGGTATGGG - Intergenic
1057000251 9:91502620-91502642 GTGGAAAAGAGCCAGGGTGCAGG + Intergenic
1060032963 9:120231601-120231623 ATTGGAAGGAACAACGGTGCTGG + Intergenic
1060375001 9:123109623-123109645 GTGCGAAGGAGCCACAGTGCGGG + Intronic
1060856399 9:126917083-126917105 GGGGCCAGGAACCATGGTGCTGG + Intronic
1062324163 9:136004473-136004495 TTGGGGAGGAACCATGGTGGGGG - Intergenic
1187163806 X:16786773-16786795 GTGGGAAGGGACGACGGTTGGGG + Intronic
1187203478 X:17158751-17158773 GGGGAAAGAAACCACTGTGCAGG + Intergenic
1194195173 X:90883358-90883380 GTGGGAAGGCTGCACTGTGCTGG + Intergenic
1195704688 X:107730358-107730380 GTGGGAAGGAACACTAGTGCAGG - Intronic
1196393530 X:115234156-115234178 GTGGGAAGGAACCAGGGGGCGGG + Intergenic
1197724935 X:129769898-129769920 GAAGGAAAGAACCAAGGTGCAGG + Intergenic
1198390647 X:136170398-136170420 GGTGGAAGGAGCCAAGGTGCAGG + Intronic
1198800209 X:140440052-140440074 ATGGGAAGCAAGCACGCTGCGGG + Intergenic
1200828262 Y:7665462-7665484 CTGGGAAGCAACTATGGTGCTGG - Intergenic