ID: 1083551037

View in Genome Browser
Species Human (GRCh38)
Location 11:63590423-63590445
Sequence GCTCAGAGCTGGCCCCCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 317}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083551034_1083551037 -4 Left 1083551034 11:63590404-63590426 CCTGGGAAGGGCCACGGAGGCTC 0: 1
1: 0
2: 1
3: 34
4: 277
Right 1083551037 11:63590423-63590445 GCTCAGAGCTGGCCCCCAGCCGG 0: 1
1: 0
2: 3
3: 49
4: 317
1083551026_1083551037 23 Left 1083551026 11:63590377-63590399 CCACAAAGAGGAAACAGAGGGAT 0: 1
1: 0
2: 1
3: 34
4: 329
Right 1083551037 11:63590423-63590445 GCTCAGAGCTGGCCCCCAGCCGG 0: 1
1: 0
2: 3
3: 49
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083551037 Original CRISPR GCTCAGAGCTGGCCCCCAGC CGG Intronic
900090133 1:916627-916649 GCTGAGAGCCGGCCCTGAGCCGG + Intergenic
900166539 1:1246293-1246315 GCGGAGACCTGGCCCCCAGCTGG - Intronic
900264869 1:1752314-1752336 ACTCAGTGCTGGCCTCAAGCGGG + Exonic
900471554 1:2857515-2857537 GCTCAGTGCTGGGCCCCTGGTGG + Intergenic
900528275 1:3139881-3139903 GTTCAGAGCTGTCCCCTCGCCGG + Intronic
900594050 1:3472429-3472451 GCCCACAGCTGGCCCCCCCCCGG + Intronic
900787165 1:4656036-4656058 GCTCACAGCTGGCGGGCAGCTGG + Intronic
900987890 1:6083631-6083653 GCTCAGAGCTGAGCCCCCGGTGG + Intronic
901029925 1:6301104-6301126 GTCCAGTGCTGGCCACCAGCTGG + Intronic
901361254 1:8703061-8703083 GCTCAGCTCTCGCCGCCAGCGGG - Intronic
901403513 1:9031215-9031237 GCTCAGAGGAGGCCCACAGTAGG + Intergenic
901626650 1:10628765-10628787 CCGCAGGGCTGTCCCCCAGCAGG - Intronic
902384899 1:16070995-16071017 GCCCAGAGCTTGCACCCAGCTGG - Intronic
902617994 1:17634456-17634478 CCCCATGGCTGGCCCCCAGCGGG + Intronic
902793451 1:18784730-18784752 GCTCCGATCTGCCCCCAAGCTGG + Intergenic
903685422 1:25128164-25128186 GCCCAGATCTGGCCCTTAGCAGG + Intergenic
904211813 1:28890921-28890943 GCTCAGAGCTTTGCTCCAGCAGG - Intronic
904343984 1:29856271-29856293 GCTCAGAGCTGGGCACAGGCTGG - Intergenic
904348606 1:29890455-29890477 GCTCAGAGCTGGGACCCACAGGG + Intergenic
905340194 1:37272802-37272824 TCTCAGAGCTGGTGGCCAGCAGG + Intergenic
905345126 1:37306094-37306116 GCTCAGGGATGGGCCCCAGGGGG + Intergenic
905883733 1:41480675-41480697 AGTCAGACCTGGCCCCCAGGAGG - Intronic
905915596 1:41682281-41682303 GCTCAGGGCTGGCCTCCTCCTGG + Intronic
905925777 1:41748688-41748710 GCTCAGAGAGGTCACCCAGCTGG + Intronic
907761771 1:57368215-57368237 GCTCAGTGCTGGCCTGCAGGGGG + Intronic
911050923 1:93670487-93670509 GCTCAGAGGATGCCCACAGCTGG + Intronic
912497641 1:110101792-110101814 GCTCTGGGCTGGACCCCACCTGG - Intergenic
915460216 1:156066054-156066076 GCTCAGATCTGGGACACAGCTGG + Exonic
917593285 1:176499596-176499618 GCCCAGATCTGGCTTCCAGCTGG + Intronic
919743138 1:200992450-200992472 CCTCAGAGCTGGCCCCTCCCTGG - Intronic
919802430 1:201361756-201361778 GACCAGAGCTGGGCCCCAGCAGG - Intronic
920074410 1:203325990-203326012 GCTGAGAACCTGCCCCCAGCTGG - Intergenic
922440617 1:225652925-225652947 GCGCGGAGCTGGTCCCCAGGCGG + Exonic
922763233 1:228145097-228145119 TCTCAGAGCAGGCTCCCAGAGGG + Intronic
923125411 1:231030085-231030107 GCACAGAGCTGGAACCCACCAGG - Intronic
924546548 1:245033139-245033161 GCACAGAGCTGGCACACGGCGGG + Intronic
924642993 1:245851210-245851232 GCTCACAGGTGCCCCTCAGCTGG + Intronic
1063167875 10:3480166-3480188 GCGCAGAGCTGAGCCCCAACAGG - Intergenic
1065887708 10:30093479-30093501 ACTCACAGCTGGCCCCCTGCAGG + Intronic
1066180716 10:32958306-32958328 GCCCAGAGCCGCCCCCCGGCAGG + Intronic
1069124428 10:64612127-64612149 GCTCAGAGTTAGACCACAGCAGG + Intergenic
1070955679 10:80461815-80461837 GCTCAGTGCAAGCCCTCAGCAGG - Intronic
1071463630 10:85920787-85920809 GCTCAGGGTGGGCTCCCAGCAGG + Intronic
1073338186 10:102726401-102726423 GCACAGAGCTGGCCACCAGCAGG + Intronic
1076336336 10:129709284-129709306 GGGGAGAGGTGGCCCCCAGCTGG - Intronic
1076528280 10:131126500-131126522 GCTGAGAGCTGGCTCAGAGCCGG - Intronic
1076594970 10:131619665-131619687 GCTCAGAGGTGGCTCCCACCTGG - Intergenic
1076595211 10:131620803-131620825 GCTCAGAGGTGGCTCCCACCTGG + Intergenic
1076599368 10:131647020-131647042 GCTGAGAGCCGGCCCCTAGCAGG + Intergenic
1077009433 11:373642-373664 CCTCAGGGCTGGCCCTCAGGAGG - Intronic
1077036515 11:498075-498097 GCTCAGTGCTGGCCCAGAACAGG - Exonic
1077130385 11:969143-969165 CCTCAGAGCCAGCCTCCAGCAGG - Intronic
1077305345 11:1866478-1866500 GCTCCGATCTGGTCCCCACCTGG + Exonic
1077341868 11:2029820-2029842 GCTCAGAGCTGGGTGCCAGATGG + Intergenic
1077606482 11:3616125-3616147 GCTCTGACCAGGGCCCCAGCAGG - Intergenic
1078922687 11:15845249-15845271 GCTCAGAGCCTGGACCCAGCAGG - Intergenic
1080826226 11:35851547-35851569 GGTCCAAGCTGGCCCCCAGGTGG - Intergenic
1081537779 11:44007807-44007829 GCTCAGGGCTGGCACACAGTAGG + Intergenic
1081600435 11:44488862-44488884 GCTCAGAGCTGGCACTGAGTAGG - Intergenic
1081709678 11:45208787-45208809 CCTAATTGCTGGCCCCCAGCTGG - Intronic
1081870610 11:46381209-46381231 GCTCAGCCCTGGCGCCCTGCTGG - Intronic
1082089978 11:48081265-48081287 GCTGAGAACTGGCCCACATCCGG - Intronic
1083551037 11:63590423-63590445 GCTCAGAGCTGGCCCCCAGCCGG + Intronic
1083772600 11:64876912-64876934 GCACAGAGCTGACCTTCAGCAGG - Intronic
1083966240 11:66045568-66045590 GATGGGATCTGGCCCCCAGCAGG + Intronic
1084322594 11:68381878-68381900 GCCCACAGCTGGCCTCCAGGAGG - Intronic
1084696260 11:70757386-70757408 CCGCAGGGCTGGCCCCTAGCTGG + Intronic
1085031264 11:73272258-73272280 GCACAGAGCTGGCAAGCAGCAGG - Intronic
1085459201 11:76683040-76683062 GCACACACCTGGCCCACAGCAGG + Intergenic
1085643643 11:78208907-78208929 GTTCAGCCCTGGCACCCAGCAGG + Exonic
1089293098 11:117450223-117450245 GCTCAGAGGAAGCTCCCAGCAGG - Intronic
1089432368 11:118435377-118435399 GCACAGAGCTCGCCGCCGGCGGG + Intergenic
1089698917 11:120232445-120232467 ACACAGAGCTGGGCCCCAGCGGG - Intergenic
1090201543 11:124861381-124861403 GCAAAGAGCAGGCACCCAGCTGG - Intergenic
1091259713 11:134224730-134224752 GCTCGGCGCTGGACCCCACCCGG + Exonic
1202824854 11_KI270721v1_random:85009-85031 GCTCAGAGCTGGGTGCCAGATGG + Intergenic
1092906294 12:13102970-13102992 GATCAGAGCTGCCTTCCAGCAGG + Intronic
1092945832 12:13453118-13453140 GCTCAATGCTGCCACCCAGCAGG - Intergenic
1092988458 12:13870503-13870525 GCTCAGAGCAGGCTCAGAGCAGG + Intronic
1096156785 12:49345533-49345555 GCTCAGCGCTGGCACTCAGTGGG + Intergenic
1096229324 12:49888602-49888624 GCTGAGACTTGGCCGCCAGCTGG + Intronic
1096398809 12:51288232-51288254 GCACAGGGATGGCCCCCAGGTGG - Intronic
1096603396 12:52746702-52746724 GCTCAGAGATGCCCTGCAGCAGG - Intergenic
1096813080 12:54183904-54183926 GCTCATGGATGGACCCCAGCAGG + Exonic
1096916605 12:55039952-55039974 GGTGACAGCTGGGCCCCAGCAGG + Intergenic
1098045715 12:66398327-66398349 GAGCTGAGCTGGCCCCCAGAGGG + Intronic
1098051253 12:66455690-66455712 CCTGAGAGCTGGCCTCTAGCTGG - Intronic
1101724177 12:107375673-107375695 GCCCAGGTCTGGCCTCCAGCAGG - Intronic
1101726948 12:107395709-107395731 GACCAGAGCTGGCCCCCACTGGG - Intronic
1102028645 12:109727534-109727556 GCTCAGGGCTGGCACACAGCAGG - Intronic
1102556416 12:113729629-113729651 GCTCAGAGCTCACCTGCAGCTGG + Intergenic
1102727087 12:115075182-115075204 GCTCAGAGAAGCCCCTCAGCTGG - Intergenic
1103066546 12:117903260-117903282 AATCAGGGCTGGCCCACAGCTGG + Intronic
1103623271 12:122201375-122201397 CCCCAGGGCTGGCCCTCAGCAGG - Intronic
1104031132 12:125066184-125066206 GCTAGGTGCTGGCCTCCAGCAGG - Intronic
1104600266 12:130148589-130148611 GAGCAGAGCTGGGCCTCAGCGGG - Intergenic
1105759939 13:23504283-23504305 GATCAGAGCTTGGCCCCAGGCGG - Intergenic
1106300788 13:28462854-28462876 GCACAGAGCAGGCCCCTATCTGG + Intronic
1106586044 13:31056823-31056845 GCTCCCAGATGGCCACCAGCTGG - Intergenic
1106762503 13:32880897-32880919 GCCCAGAGCTGGTCCCCATGGGG - Intergenic
1112417727 13:99217580-99217602 GGTAACAGCTGGCCCCAAGCCGG - Intronic
1114049717 14:18913186-18913208 GCCCAGAGCTGGCACATAGCAGG - Intergenic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1114645187 14:24252174-24252196 GCTCAGAGATGTCCCCCTGGAGG + Intronic
1118772612 14:68952247-68952269 GCCCAGGGCTGGCCTCCAGCAGG - Intronic
1119439458 14:74618499-74618521 ACTCAGAGCGGACCCCTAGCTGG - Intergenic
1119768141 14:77203684-77203706 GCTCGGGGCTGGCCCAGAGCAGG + Intronic
1121327291 14:93028651-93028673 GCCCAGAGCAGGCCCCCTGCAGG + Intronic
1121858884 14:97298084-97298106 GCTCAGGGCTGACTCCCACCAGG - Intergenic
1122534918 14:102455378-102455400 GGACAGAGCTGGGCCCCAGGCGG + Intronic
1122773787 14:104108404-104108426 GCTCACAGCACGCCCCCAACCGG + Intronic
1122956818 14:105075059-105075081 GCCCAGACCTGGCACCCAGCAGG - Intergenic
1124155093 15:27218638-27218660 TCTCAGAGCTCGGCCTCAGCAGG - Intronic
1125598042 15:40899946-40899968 GCTCAGTGTAGGCCCACAGCTGG - Exonic
1128979366 15:72175341-72175363 GATCAGACCCGGGCCCCAGCTGG - Intronic
1130100987 15:80893988-80894010 GCTCTGGGATGGGCCCCAGCTGG + Intronic
1130979978 15:88805598-88805620 GCTCAATGCTGGCCCACAGCGGG + Intronic
1132573204 16:652987-653009 ACTCAGAGCAGGCACCCAGCAGG - Intronic
1132832009 16:1933035-1933057 CCTCAGTTCTGGCCCCCAGCAGG + Intergenic
1132853132 16:2033666-2033688 GCTCTGTGCTGGCCGCCGGCAGG + Intronic
1132865246 16:2090011-2090033 GCTCACACCTTGTCCCCAGCCGG + Exonic
1133168318 16:3964612-3964634 GTTCTGAGCTGGACCCCGGCAGG + Exonic
1133328613 16:4957758-4957780 GGACAGGGCTGACCCCCAGCAGG + Intronic
1134243522 16:12523192-12523214 GCACAGAGCTGGCCCAAGGCAGG - Intronic
1135052004 16:19200981-19201003 AGTCGGAGCTGCCCCCCAGCTGG - Intronic
1137391745 16:48087063-48087085 GCTCAGAGCTGCCTCTCGGCAGG - Intronic
1138457344 16:57129011-57129033 GCTTAGAGCTTGCCCCCTCCAGG - Intronic
1139514321 16:67444433-67444455 GCTCAGGGTCGCCCCCCAGCGGG + Intronic
1140056698 16:71531659-71531681 ACACAGAACTGGCCCCAAGCAGG + Intronic
1140065936 16:71611191-71611213 GCCCAGAGCTGGCCAGCAGGGGG - Intergenic
1140136499 16:72210515-72210537 GATCTGAGGTGTCCCCCAGCAGG - Intergenic
1140245641 16:73245675-73245697 GTCCAGAGCTGGCCCCTACCTGG + Intergenic
1141299638 16:82802059-82802081 GCTCAGAGCTGTGCCCCACTGGG + Intronic
1141664915 16:85461079-85461101 GCTCAGGGCTTGCCCGAAGCAGG - Intergenic
1141700519 16:85640069-85640091 GCTCAGAACTGTCCTCCAGACGG - Intronic
1141903263 16:87006542-87006564 GCACAGAGCTGCCCAGCAGCTGG - Intergenic
1142110285 16:88327505-88327527 GCACAGGCCTGGCCCCTAGCTGG - Intergenic
1142203071 16:88770311-88770333 GGTCACACCTGCCCCCCAGCCGG + Intronic
1142254285 16:89006534-89006556 GCTCAGAGCTGCCCCAGGGCTGG + Intergenic
1142304599 16:89278390-89278412 GCTCAGAGCAGGGCCCCATTTGG + Intronic
1143020760 17:3916232-3916254 GCTCAGTTCTGAGCCCCAGCCGG - Exonic
1143492196 17:7290995-7291017 GGTCAGAGCTGGCCCCAGGAGGG + Intronic
1143499480 17:7330426-7330448 GCTGAGAGCAGCCCCCCAGTGGG + Intergenic
1143632729 17:8148087-8148109 GTTCAGGGCTGCCCCCCTGCTGG - Exonic
1143633163 17:8150247-8150269 GCTCTGAGCTGGCACTCAGGAGG + Exonic
1143854640 17:9839593-9839615 CCTCAGATCTGGCCCCCTCCAGG + Intronic
1143988299 17:10934543-10934565 TCTCAGTGCTGGCCTCCAGAAGG - Intergenic
1144797133 17:17899693-17899715 GCAAAGCGCTGGCCCACAGCCGG - Intronic
1145204725 17:20977076-20977098 GAGCAGAGCTGGCAGCCAGCAGG - Intergenic
1147157759 17:38552782-38552804 GCTCAGGGCCGGGCACCAGCCGG + Exonic
1147166173 17:38594601-38594623 GCCCAGACTTGGCCCACAGCAGG - Intronic
1147602795 17:41756260-41756282 GCTCCGAGCTGGATCTCAGCTGG + Intronic
1147833803 17:43315633-43315655 GAGCAGAGCTGGACCGCAGCGGG + Intergenic
1150323213 17:64233970-64233992 GTACAGAGCTGGCCCCCGCCAGG + Intronic
1151084533 17:71365241-71365263 GCTCAGAGTTGGCACCCACATGG + Intergenic
1151710111 17:75799612-75799634 GCACAGAGCTGACCCACAGCAGG - Intronic
1151881679 17:76899283-76899305 GCTCAGAGCTGGAGACGAGCCGG - Intronic
1152227799 17:79100750-79100772 GCTCAAAGCAGGCCCCTTGCCGG + Intronic
1152351660 17:79786936-79786958 ACTGTGGGCTGGCCCCCAGCTGG - Exonic
1152713733 17:81888202-81888224 GCTTTGACCAGGCCCCCAGCTGG + Intronic
1152734245 17:81989362-81989384 GCTGGGAGCTGGTCCCCAGCAGG + Intronic
1152741949 17:82022355-82022377 GCCCAGTGCTGGCGCCCACCGGG + Intronic
1152798963 17:82322307-82322329 CCTCAGAGCGGGAGCCCAGCAGG - Exonic
1154165539 18:12011749-12011771 GCTCAGAACTGGCCCCCATGGGG + Intronic
1154518279 18:15197668-15197690 GCTCAGGGGTCGCTCCCAGCCGG - Intergenic
1157556531 18:48616339-48616361 CCGGAGAGCTGGCCCCAAGCAGG - Intronic
1157623060 18:49027118-49027140 GCTCAGCCCTGGCCCCCAGTGGG + Intergenic
1160701250 19:508481-508503 GCTCAGAACTGGCCCCAGCCAGG - Intronic
1161246261 19:3254011-3254033 GCTCAGTTTTGGCCCCCAACAGG - Intronic
1161593562 19:5139961-5139983 GGTCAGTGCTGGCCACCAGCTGG + Intronic
1161642332 19:5432137-5432159 GCTCAGAGCTGTCCCTTTGCAGG + Intergenic
1162958719 19:14113895-14113917 TCTCTGAGCTGGCCCCCTGCCGG + Intronic
1163666448 19:18606130-18606152 GCTGGGTGCGGGCCCCCAGCGGG - Intronic
1166329199 19:42069099-42069121 GCGCAGAGCAGGCCCCTAGTGGG + Intronic
1166738459 19:45099914-45099936 ACGCGAAGCTGGCCCCCAGCTGG + Intronic
1166808743 19:45502559-45502581 GCTAAGACCTGGCACACAGCAGG - Intergenic
1166925017 19:46261210-46261232 GCTCAGAGCTGGGGCTCAGCTGG + Intergenic
1168129900 19:54311547-54311569 ACTCACAGCTGACCCCCAGTGGG - Exonic
1168571842 19:57477064-57477086 GCTCAGAGATGGTTCACAGCTGG - Intronic
925031079 2:650183-650205 GGACAGAGCTGGTCCCCATCAGG - Intergenic
925574322 2:5345056-5345078 TCTCAGAGCTGTCCCAAAGCAGG + Intergenic
925731820 2:6924515-6924537 GCTCTGAGCTGTCCCAGAGCAGG + Intronic
925919313 2:8628278-8628300 GCTCCGAGCTCCCTCCCAGCAGG + Intergenic
926092060 2:10057750-10057772 CCCCGGAGCTGTCCCCCAGCAGG + Exonic
926227776 2:10980701-10980723 GCCCAGAGCAGGCCCCTGGCTGG - Intergenic
926707365 2:15846222-15846244 GCTCAGAGCTGGCCTCCAGGAGG + Intergenic
927863883 2:26576675-26576697 ACTCAGAGCATGCCCCCAGGGGG - Intronic
928331344 2:30360201-30360223 GCTCTCAGCTGGCCCATAGCAGG - Intergenic
930007000 2:46905950-46905972 GCACAGAGCTGACCCTCAGGAGG - Intronic
932300565 2:70664018-70664040 ACTCTGAGCTGGACCCCAGCCGG - Intronic
932501596 2:72187478-72187500 GCTCAGAGATGACCCACAGTGGG + Intronic
933744505 2:85561062-85561084 GCTCAGAGCTTCCGCCCACCCGG + Intronic
934566166 2:95342767-95342789 GCTCAGGGATGGCCACCAGACGG - Intronic
934781705 2:96973375-96973397 GCACAGACCTGGCCCACAGTAGG + Intronic
935102992 2:100014618-100014640 GCTCAAAGCTGGTCTCCTGCAGG - Intronic
935720766 2:105976998-105977020 CCCCACAGCAGGCCCCCAGCAGG - Intergenic
936245345 2:110821425-110821447 GCCCAGAGCTGCCTCCCACCTGG + Intronic
936351319 2:111714771-111714793 GCTCTCACCTGGCTCCCAGCCGG - Intergenic
936410219 2:112251719-112251741 GCTGAGATCTGAGCCCCAGCAGG + Intronic
937076879 2:119113548-119113570 GCTCAGAGCTGGGCTGCTGCTGG - Intergenic
937243601 2:120478022-120478044 GCCAAGAGCTGGAGCCCAGCAGG - Intergenic
937330588 2:121025883-121025905 GCTCAGGGCAGGCCCCAAGCAGG + Intergenic
937377771 2:121349363-121349385 ACTCAGAGATGGGCCCCAACTGG + Intronic
938583690 2:132669778-132669800 GCGCAGGGCTGGCCCCGAGGTGG + Intronic
940134920 2:150425190-150425212 GCTCAGCGCTGCCCCCCTGCGGG - Intergenic
942069471 2:172303393-172303415 GCTCAGAGCTGCCAGCCACCTGG + Intergenic
942752513 2:179303969-179303991 GCTCAGATGTGGGCCACAGCTGG - Intergenic
944011954 2:194983730-194983752 TCTGAGAGCTGGCCCCCTGAGGG + Intergenic
944586722 2:201179303-201179325 GCTCAGAGGAGGCCCACAGTGGG - Intergenic
944979779 2:205103673-205103695 GCTCAGAGCTGTTCCCTAACAGG - Intronic
946373606 2:219295146-219295168 GCTCAGGCCTGGGCCCCTGCCGG - Intronic
946775003 2:223128180-223128202 CCTATGAGCTGGCCCACAGCAGG + Intronic
948332174 2:237178292-237178314 GCTCAGTTCTGCCTCCCAGCTGG + Intergenic
948477809 2:238231686-238231708 GCTCAGAGCTCGCCGCCAAGGGG + Intergenic
948900857 2:240956250-240956272 GCTCATGGGAGGCCCCCAGCTGG - Intronic
1169948691 20:11017656-11017678 TGTCAGAGATGGGCCCCAGCTGG - Intergenic
1171226222 20:23444142-23444164 CCCCAGGGCTGGGCCCCAGCTGG - Intronic
1171355577 20:24543250-24543272 GCACTGTGCTGGCCCCCACCCGG - Exonic
1172764549 20:37344626-37344648 GCTCAGGGCGGGCCCCCAGCTGG - Intergenic
1173423864 20:42926355-42926377 GCTCTGAGCTTCTCCCCAGCAGG + Intronic
1174037700 20:47678441-47678463 GCTCAGAGAAGGTCCCCAACTGG + Intronic
1175264625 20:57695234-57695256 GCTCTGGGCTGGAGCCCAGCGGG + Intronic
1175358466 20:58388940-58388962 ACACGAAGCTGGCCCCCAGCGGG + Intergenic
1175856981 20:62126384-62126406 GCAGGGAGCTGGCCGCCAGCGGG - Exonic
1176111399 20:63412464-63412486 CCTCACAGCTGGAGCCCAGCGGG + Intronic
1176172293 20:63701461-63701483 GGTCAGAGCTGACTCCCACCAGG + Intronic
1176195321 20:63834202-63834224 TCCCAGAGCTGCCTCCCAGCCGG - Intergenic
1179265173 21:39796637-39796659 GCCCAGAGCTGGGGCCCAGCAGG + Intronic
1179712537 21:43271690-43271712 GCCCAGGTCGGGCCCCCAGCTGG + Intergenic
1179823595 21:43951591-43951613 GCACAGAGCAGGACGCCAGCTGG + Intronic
1180162436 21:46004224-46004246 GCTCAGGGCTGAGCCCCAGAGGG - Exonic
1180162455 21:46004308-46004330 GCTCAGGGCTGAGCCCCAGAGGG - Exonic
1181804032 22:25364499-25364521 GCCCACAGCTGGCCTCCAGGAGG + Intronic
1182031789 22:27164879-27164901 GAGCAGAGCTAGGCCCCAGCTGG - Intergenic
1182276715 22:29194382-29194404 GATCAGAGCTGGCATCCAGAAGG + Intergenic
1182362165 22:29753032-29753054 GCTCAGTGCTGTCCCCAGGCTGG - Intronic
1182398022 22:30050733-30050755 GCTCTGATCTGCCCCCCTGCAGG - Intergenic
1182622166 22:31624147-31624169 GCTGAGAGGTGCCCCGCAGCTGG - Intronic
1182868799 22:33627949-33627971 GCTCCATGCTGGCCCCCACCAGG + Intronic
1183329169 22:37210256-37210278 CCTCAGAGCTTACCCCCAGCGGG - Intronic
1183737341 22:39651175-39651197 GTTCGAACCTGGCCCCCAGCTGG - Intronic
1183738863 22:39659127-39659149 GCTGAGGTATGGCCCCCAGCAGG - Intronic
1184339305 22:43877278-43877300 GCTCACAGGAGGCCCCCAGTGGG + Intergenic
1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG + Intronic
1184676006 22:46043985-46044007 GCACAGATCTGGCTGCCAGCTGG - Intergenic
1184716125 22:46282763-46282785 GCTCAGAGCTGGCCCCTGCTAGG - Intronic
1184839358 22:47043523-47043545 GCTGACTGCTGGCCACCAGCTGG - Intronic
1185059018 22:48596246-48596268 GCTCAGTCCTGGGCCCCAGAAGG - Intronic
1185307593 22:50129285-50129307 GCTGTGACCTGGCACCCAGCTGG + Intronic
950006475 3:9694799-9694821 GCTCTGAGTTGGCCATCAGCAGG + Intronic
950056114 3:10026195-10026217 ACTGAAAGCTGGCTCCCAGCCGG + Intergenic
950576664 3:13836322-13836344 GCTCAGCCCTGGCCTCCAGATGG + Intronic
950651681 3:14411101-14411123 GCAGAGAGCTGGTCCCCAGATGG - Intronic
950703457 3:14766105-14766127 GATCAGTCCTGGCCCCGAGCTGG - Intronic
954647599 3:52141018-52141040 GCTCACAGCTGCCACCCAGGTGG - Intronic
956689802 3:71865010-71865032 GCTCTGGGCTGGGCCCCAGGTGG + Intergenic
957459484 3:80497850-80497872 GCTCAGGTCTGGATCCCAGCTGG + Intergenic
959525122 3:107368063-107368085 GCTCATAGCTTGCACCAAGCTGG + Intergenic
960147285 3:114216873-114216895 TCACAGAGCTGGGCTCCAGCAGG - Intergenic
960333907 3:116392995-116393017 GCTCAGAGGAGACCCCCAGTGGG - Intronic
961661137 3:128469405-128469427 GCTCAGATCTAGCCCCAAGTAGG + Intergenic
962825969 3:139101308-139101330 GATCAGAGCTGGGCCCCTGACGG - Intronic
963800376 3:149670081-149670103 GCTCAGCTCTAGCACCCAGCTGG + Intronic
965310099 3:167116458-167116480 GGGCAGAGCTGCCCGCCAGCCGG - Intergenic
965378067 3:167951535-167951557 GCTGAGTGTTGGCCCACAGCTGG - Intergenic
965757464 3:172040435-172040457 GCTCGGAGGTGGCCAGCAGCGGG - Intronic
966003553 3:174980109-174980131 GATCAGAGGTGGCCTCCAGAAGG - Intronic
967828958 3:193902484-193902506 GCTTGGAGCCGGCTCCCAGCAGG - Intergenic
968759231 4:2433516-2433538 GATCAGAGCCAGCCCCCCGCAGG + Intronic
969214104 4:5709077-5709099 GCCCAGGGCTGACCCACAGCAGG - Intronic
969292616 4:6250371-6250393 GCTCAGAGCTCTCCACCTGCTGG - Intergenic
969321769 4:6417020-6417042 CCCCAGTGCTGGACCCCAGCAGG - Intronic
969585418 4:8088549-8088571 GCACTGGGCTGGCCCTCAGCTGG - Intronic
969671369 4:8592140-8592162 ACTCATTGCTGGCACCCAGCAGG - Intronic
977033958 4:91925239-91925261 GCTCAGAGCGGACCCACAGTGGG - Intergenic
978249318 4:106610975-106610997 GCTCAGAGGAGACCCACAGCAGG - Intergenic
979938679 4:126731246-126731268 GCTCATAGCTGGCATCCAACAGG + Intergenic
984906168 4:184627977-184627999 GCTCAGCTCTGGCCTCCGGCTGG + Exonic
985863897 5:2496324-2496346 GCTCAGAGGTGGCCTCCTGCAGG - Intergenic
985937787 5:3110045-3110067 GCTGCGTGCTGGCCCCAAGCTGG - Intergenic
986014876 5:3748947-3748969 CCTCTGAGCTGTCCCCCTGCAGG + Intergenic
989107271 5:37875334-37875356 GCTGAGAGCTGCACCCCACCGGG - Intergenic
990610860 5:57455649-57455671 GCTGAGAGCTTGCTCCCTGCTGG - Intergenic
997013324 5:129904364-129904386 GCTCCGAGCTGGCCCGGAGGAGG - Intergenic
997428759 5:133823172-133823194 GCCCAGAGCTGGTCACCACCAGG + Intergenic
997594259 5:135095691-135095713 GCTCAGAGCTGGCACACAACAGG + Intronic
997639435 5:135439008-135439030 GCTCAGAGCTTCCTCCCAGGTGG + Intergenic
998139100 5:139689970-139689992 GCCCAGACCTGGCCCCCAGGAGG - Intergenic
998845446 5:146304573-146304595 ACTCAGAGCGGACCCCCAGCAGG - Intronic
999143259 5:149376812-149376834 GCTCTGAGCTGTTCCTCAGCTGG + Exonic
999309969 5:150545582-150545604 GCTCAGGGCTGGCACACAGTAGG - Intronic
999648656 5:153744086-153744108 ACTCAGAGCAGGCCCAGAGCCGG + Intronic
1002071676 5:176682214-176682236 GGTCAGAGCTGGGCTACAGCAGG - Intergenic
1002297087 5:178237776-178237798 GCTCAGGGCTGGTTCCCAGCTGG - Exonic
1003068804 6:2928028-2928050 TCTCTGAGCTGGCCCCCCGCCGG + Intergenic
1006332712 6:33403883-33403905 GCTCAGAGATGCCCAGCAGCAGG + Exonic
1006742450 6:36319284-36319306 GCTCACAGCTGGCCTCCAGTGGG - Intronic
1010954161 6:82071318-82071340 GCACAGAGCAGGCACCGAGCAGG + Intergenic
1011825756 6:91303433-91303455 CCGCAGAGCTGGCGCCCACCCGG + Intergenic
1013621054 6:111889539-111889561 GGTCAGAGATGGACCTCAGCAGG + Intergenic
1016210871 6:141531826-141531848 GCTGAGAGCTGGACACTAGCTGG + Intergenic
1017862232 6:158409539-158409561 GAACCCAGCTGGCCCCCAGCTGG + Intronic
1018712747 6:166508412-166508434 CCTCTGAGCTGGTCACCAGCCGG - Intronic
1018736244 6:166689055-166689077 GCTCAGGGCTGGCCTTCGGCAGG - Intronic
1019478451 7:1255237-1255259 CCTCAGAGCAGGCCCCAGGCCGG - Intergenic
1019597072 7:1863133-1863155 GCTCAGATCTGGACGCCACCTGG - Intronic
1019597350 7:1864300-1864322 GCTCAGCACTGGCTCCCTGCAGG + Intronic
1019618947 7:1980191-1980213 GCTCAGGCGTGTCCCCCAGCGGG - Intronic
1020116197 7:5477901-5477923 GCTGAGGGCTGGGCCCCTGCCGG - Intronic
1020274598 7:6616407-6616429 GCTCTGAGAAGGCCGCCAGCAGG - Intronic
1020397044 7:7728272-7728294 GTTCACAGCTGGCGGCCAGCAGG + Intronic
1022103723 7:27184137-27184159 GCCTGGAGCTGGCCCCGAGCGGG + Intronic
1022475836 7:30708986-30709008 GATCAGAGCTGGCACACAGCTGG - Intronic
1023727231 7:43156286-43156308 GGACAGAGCAGGCCCCCAGTAGG + Intronic
1023826988 7:44016309-44016331 GCCCAGAGCAAGCCCCCAGAAGG + Intergenic
1024055114 7:45655288-45655310 CCTCTGAGCTGGACCCCAACAGG - Intronic
1028884396 7:95914788-95914810 GGGCACAGCTGGCACCCAGCCGG - Intronic
1028937335 7:96480618-96480640 GCTCAGAGCTTTGCCCCTGCTGG + Intergenic
1029115122 7:98232742-98232764 TCTCAGAGCTGGTACACAGCAGG + Intronic
1029738140 7:102476056-102476078 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029755273 7:102569710-102569732 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029773221 7:102668790-102668812 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1032130810 7:129225581-129225603 TCTCAGAGATGCCCCCCAGCCGG + Intronic
1032222750 7:130006945-130006967 GCTCAGAGATGGGGCACAGCCGG + Intergenic
1032279960 7:130492225-130492247 GTGCAGAGCTGGCCAGCAGCGGG - Exonic
1032650174 7:133869325-133869347 GCCCAGAGCTGCCCCCAGGCTGG - Intronic
1033317856 7:140313275-140313297 GCTCAGAGCAGGGCCCAGGCAGG + Intronic
1034132227 7:148730191-148730213 CCTCAGAGCCGGCATCCAGCAGG + Exonic
1036785501 8:11683272-11683294 GCGCAGAGCTGCCCCACAGGTGG + Intronic
1036794648 8:11746719-11746741 GCCCATAGCTTGCTCCCAGCTGG - Intronic
1038200859 8:25411344-25411366 CCTGAGAACTGGCCTCCAGCCGG + Exonic
1039182264 8:34880167-34880189 GCTCAGAGGAGGCCCGCAGTGGG + Intergenic
1039481125 8:37874293-37874315 GCTCAGAGCTACTGCCCAGCAGG - Intronic
1040455587 8:47594321-47594343 GCTGAGATCGTGCCCCCAGCTGG + Intronic
1044306459 8:90645912-90645934 GCCCAGCGCGGGCCCTCAGCCGG + Exonic
1049046876 8:140159354-140159376 GCACAGAGCAGGCCCTCAGGAGG + Intronic
1049161548 8:141101437-141101459 CCTCAGAGCTGCCCCCCACAAGG - Intergenic
1049255723 8:141612577-141612599 GCTGAGAGCTGGCCAGGAGCAGG - Intergenic
1049681874 8:143922566-143922588 GCTCAGCGATGGCCTCCCGCAGG + Exonic
1049689007 8:143950655-143950677 CCTCATAGATGGCCCGCAGCTGG + Exonic
1049691918 8:143965266-143965288 GCCAAGAGCTGACCACCAGCTGG + Intronic
1049814546 8:144592226-144592248 GCTCAATGCTGTCCCCCAGGAGG - Intronic
1049814561 8:144592275-144592297 GCTCAGTGCTGTCCCCCAGGAGG - Intronic
1049814576 8:144592324-144592346 GCTCAGTGCTGTCCCCCAGGAGG - Intronic
1049814591 8:144592373-144592395 GCTCAGTGCTGTCCCCCAGGAGG - Intronic
1049814607 8:144592422-144592444 GCTCAGTGCTGTCCCCCAGGAGG - Intronic
1049814622 8:144592471-144592493 GCTCAGTGCTGTCCCCCAGGAGG - Intronic
1049814636 8:144592519-144592541 GCTCAGTGCTGTCCCCCAGGAGG - Intronic
1049814650 8:144592567-144592589 GCTCAGTGCTGTCCCCCAGGAGG - Intronic
1049814665 8:144592616-144592638 GCTCAGTGCTGTCCCCCAGGAGG - Intronic
1049814680 8:144592665-144592687 GCTCAATGCTGTCCCCCAGGAGG - Intronic
1050204410 9:3181729-3181751 GCTCAGGGCTGCCGCCCCGCTGG - Intergenic
1050278710 9:4027906-4027928 GCTCTGAGCTGGCCTTCAGCTGG - Intronic
1053284220 9:36840003-36840025 GCTCAGAGCTGTCCTCAAGATGG - Exonic
1053425716 9:38008721-38008743 GGTCACAGCTCTCCCCCAGCTGG - Intronic
1055320403 9:75078373-75078395 CCTCCCAGCTGGCCCCCAGGTGG - Intronic
1057548249 9:96034002-96034024 GCTCAGAGCTGGCAGCCACCCGG - Intergenic
1057906547 9:98987824-98987846 ACCCAGGGCTGGCACCCAGCAGG - Intronic
1059328612 9:113520327-113520349 GGCCAGAGCTGGCACACAGCTGG - Intronic
1059389338 9:113988968-113988990 GCTCAGAGCAGTACCCCATCAGG + Intronic
1059945152 9:119402064-119402086 GCACAGAGCTGGCACACAGGAGG + Intergenic
1060023108 9:120149224-120149246 GCTCTGAGCGGGCACCCAGATGG - Intergenic
1060152507 9:121298023-121298045 GGCCAGAGCTGGCCCACTGCAGG + Intronic
1060810359 9:126608601-126608623 GCTCAGAGCTGGACCCTGGCGGG - Intergenic
1061332007 9:129900625-129900647 GCTCCGGGCTGGCCCTCAGATGG - Intronic
1061837924 9:133341561-133341583 GCCCAGTGCTGGCCCCCTACAGG - Exonic
1187267345 X:17747282-17747304 ACTCAGAGCTGCCCCCCATCGGG + Intronic
1187317104 X:18206579-18206601 ACTCAGAGCTGCCCCCAATCGGG - Intronic
1189332500 X:40152456-40152478 CCTCTGAGCTGGCAGCCAGCGGG + Intronic
1199078293 X:143548796-143548818 TCTGAGATCTGGCCCCCAGATGG + Intergenic