ID: 1083551228

View in Genome Browser
Species Human (GRCh38)
Location 11:63591551-63591573
Sequence CGGATGTCATTGTTGAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083551228_1083551232 16 Left 1083551228 11:63591551-63591573 CCAGTCTTCAACAATGACATCCG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1083551232 11:63591590-63591612 GGAGAGGCCGATTAGATTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 72
1083551228_1083551229 -5 Left 1083551228 11:63591551-63591573 CCAGTCTTCAACAATGACATCCG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1083551229 11:63591569-63591591 ATCCGTGTGACAGCAACAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 71
1083551228_1083551231 0 Left 1083551228 11:63591551-63591573 CCAGTCTTCAACAATGACATCCG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1083551231 11:63591574-63591596 TGTGACAGCAACAGCAGGAGAGG 0: 1
1: 0
2: 4
3: 39
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083551228 Original CRISPR CGGATGTCATTGTTGAAGAC TGG (reversed) Intronic
905454604 1:38079525-38079547 CCAATGTCATTGTGGAAGAGAGG + Intergenic
906188966 1:43883387-43883409 GGGATGCTATTGTAGAAGACAGG + Intronic
906581247 1:46936710-46936732 AGGATGTCATAGTGGAAGGCTGG + Exonic
906602478 1:47142167-47142189 AGGATGTCATTGTGGAAGGCTGG - Exonic
913485465 1:119329157-119329179 CGGAGCTCATTGTTGAAATCTGG + Intergenic
1063512464 10:6659339-6659361 GGGATGTTTTTGTTGAAAACTGG + Intergenic
1077538810 11:3136866-3136888 CGGATGTTACTGCTGAAGGCTGG - Intronic
1079158587 11:17972372-17972394 GGGATGTGGTTGCTGAAGACTGG - Intronic
1079769401 11:24439913-24439935 AGTATGTCATTGTTGAGGAGGGG - Intergenic
1079986459 11:27205355-27205377 CTCATGTCACTTTTGAAGACAGG - Intergenic
1083551228 11:63591551-63591573 CGGATGTCATTGTTGAAGACTGG - Intronic
1086851909 11:91819549-91819571 CCCATGTCATTGTTGAGGAGAGG + Intergenic
1091535007 12:1398466-1398488 CAGATCTCAGTCTTGAAGACTGG - Intronic
1093186559 12:16026752-16026774 CGGAAGAGATTGTAGAAGACTGG - Intronic
1095792098 12:46178597-46178619 ATGATGTCCTTGTTGAACACCGG - Intergenic
1099934785 12:89111870-89111892 ATGAGGTAATTGTTGAAGACAGG - Intergenic
1104156655 12:126139542-126139564 ATGGTGTCATTGTTGAAGAGTGG - Intergenic
1106873731 13:34049543-34049565 CAGATCTCAATCTTGAAGACTGG + Intergenic
1110017919 13:70432414-70432436 GTGATGTCAGTGTTGAAAACAGG + Intergenic
1113555859 13:111233569-111233591 CAAATATCATTTTTGAAGACTGG - Intronic
1117487199 14:56210354-56210376 GGGAAGTCAGTGTTGAAGAAGGG + Intronic
1128046529 15:64622878-64622900 GAGATGTCATTGTTGACCACTGG - Exonic
1130042653 15:80418162-80418184 CAGATGTGCTTGTTGAAGAGAGG + Intronic
1135267528 16:21040279-21040301 CTGATGTCCATGTTGAACACTGG - Intronic
1139329858 16:66178919-66178941 GGGATGTTATTAGTGAAGACAGG + Intergenic
1151184398 17:72352569-72352591 CGGAGGCCATTTTTGAGGACTGG - Intergenic
1151434351 17:74085626-74085648 CTGATGTCGCTGTTGGAGACTGG - Intergenic
1153412277 18:4807216-4807238 CGGAGGTCAATGTTGAAGTCAGG + Intergenic
1156564311 18:38167093-38167115 TGGTTCTCATTGTTGAAGAATGG - Intergenic
1157760539 18:50260654-50260676 CGGTTGTCATTTTTTGAGACAGG - Intronic
1160315967 18:77848006-77848028 CTGATGTCATTGTAGCAGCCAGG - Intergenic
1167694447 19:51006613-51006635 CTGAGGTCCTTGTTGAAGCCAGG + Exonic
1168030272 19:53673894-53673916 TAGAAATCATTGTTGAAGACAGG - Intergenic
925153640 2:1634495-1634517 AGGATTTCATAGTTGCAGACAGG + Intronic
925439949 2:3876804-3876826 CTGTTGTGAGTGTTGAAGACTGG - Intergenic
926924554 2:17973988-17974010 AGGATGTCTTTGATGAAAACTGG + Intronic
937485084 2:122307341-122307363 CAGATGTCACAGTTGATGACTGG + Intergenic
944295219 2:198053810-198053832 TGACTGCCATTGTTGAAGACAGG + Intronic
944543034 2:200771988-200772010 GGCATGTCATTGTTACAGACTGG + Intergenic
946771029 2:223089188-223089210 CGGATGTGTGTGTTGGAGACTGG + Intronic
1178612519 21:34096705-34096727 TGGATGTCTTTGATGAAGCCCGG - Exonic
952133810 3:30394839-30394861 GGGATGTCATTTTTTAAGATAGG - Intergenic
953158542 3:40396823-40396845 GTGATGTCACTGTTGAAGATGGG + Intronic
953479456 3:43237836-43237858 ATGATGTCAATGTTGAACACTGG + Intergenic
964164948 3:153692056-153692078 CTGATGTTATTGTTGAGAACTGG - Intergenic
964623091 3:158734490-158734512 CTGATGGCATTGTTGAACACAGG + Intronic
972365762 4:38372993-38373015 AGGGTGTTGTTGTTGAAGACTGG - Intergenic
974713981 4:65641711-65641733 CAGATGTTAATATTGAAGACAGG - Intronic
975395938 4:73873303-73873325 GGGACATCATTGGTGAAGACAGG - Intergenic
977213169 4:94245010-94245032 GCAATGTCATTGTTGAAGCCTGG + Intronic
985152095 4:186957927-186957949 CGGATATAATAGTTGAAAACTGG + Intergenic
990749842 5:59002610-59002632 TGGCTGGCATTGCTGAAGACTGG - Intronic
991393708 5:66179923-66179945 CTAATGTCATTCTTGAAAACAGG - Exonic
1002827388 6:785699-785721 AGGATGTAAATGTTGAACACAGG - Intergenic
1002934721 6:1661847-1661869 CGGATGTCATTGTTAAGGGGCGG + Intronic
1003985619 6:11431760-11431782 GGGATGTCATTGTGCAAGAAAGG + Intergenic
1007990154 6:46246774-46246796 AGGAGGTCATAGTTGAGGACTGG + Exonic
1016348892 6:143146336-143146358 CGGGTCACATTGTTGAGGACAGG - Intronic
1027759553 7:82260755-82260777 TTGATGTCATTGTTAAAAACAGG - Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1031375179 7:121015789-121015811 CGGTTGTCATCGCTGAAGAAAGG + Exonic
1040469602 8:47726433-47726455 CAGATGTCCTTGTTGAAAAGCGG - Intronic
1047324641 8:123824679-123824701 CAGATGTCATTAGTTAAGACTGG + Intergenic
1058577586 9:106420551-106420573 AGGAAGTCATTGTTGCAGAGGGG + Intergenic