ID: 1083552765

View in Genome Browser
Species Human (GRCh38)
Location 11:63602730-63602752
Sequence TGGCTCCTCTCTACAACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083552761_1083552765 8 Left 1083552761 11:63602699-63602721 CCAGGCTCATACATTTACATTGT 0: 1
1: 0
2: 0
3: 31
4: 254
Right 1083552765 11:63602730-63602752 TGGCTCCTCTCTACAACAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083552765 Original CRISPR TGGCTCCTCTCTACAACAGC AGG Intronic
901653936 1:10758663-10758685 TGGCTCCTCTGCAGAAGAGCTGG - Intronic
909086275 1:71172908-71172930 TGGCTCCTCGTTACTGCAGCAGG + Intergenic
911331395 1:96529580-96529602 TGGCTCCTTTCAGCCACAGCTGG - Intergenic
912233940 1:107828140-107828162 TAGCTCCTCTCTGGAACATCTGG + Intronic
912763898 1:112391561-112391583 TAGCTCCTGTCTACAAGACCAGG - Intergenic
914418732 1:147508923-147508945 TAGCCCGTCTCTCCAACAGCAGG + Intergenic
917421496 1:174868363-174868385 TGGCTCCTCCCTAGCACAGTAGG + Intronic
918119862 1:181529153-181529175 TGGCTCCTTTCAGCCACAGCTGG - Intronic
920443129 1:205994629-205994651 AGGCTCCTCTCTAATGCAGCTGG + Intronic
920594544 1:207255725-207255747 TGGCTCCTTTCAGCCACAGCTGG + Intergenic
924009180 1:239645275-239645297 TGGCTTCTCTCTTGAACACCAGG + Intronic
1064545453 10:16445757-16445779 AGGATCCTTCCTACAACAGCAGG - Intronic
1066074573 10:31860307-31860329 TAGCTGCTTTCTATAACAGCCGG + Intronic
1067666113 10:48280597-48280619 TGGCTCCTTTCAGCTACAGCTGG + Intergenic
1068584001 10:58776306-58776328 TTGTTCCTTTTTACAACAGCTGG - Intronic
1068766848 10:60773762-60773784 TAGCATCTCTCTAGAACAGCAGG + Intergenic
1071960310 10:90803676-90803698 GGGCTCCTCTCCCCAACACCAGG - Intronic
1072866514 10:99067594-99067616 TGGCTCCTTTTAACCACAGCTGG + Intronic
1076578598 10:131491245-131491267 TGGCTCATCTGTAAAACTGCTGG - Intergenic
1080033939 11:27691707-27691729 TTGCTCTTCTGTAGAACAGCTGG - Intronic
1080567502 11:33525488-33525510 TGGCTCCTCTCTAATTCTGCTGG - Intergenic
1083552765 11:63602730-63602752 TGGCTCCTCTCTACAACAGCAGG + Intronic
1084024516 11:66439480-66439502 TGTCTCCTCCCCACTACAGCAGG + Intronic
1086580377 11:88391973-88391995 TGGCCCCTTTCAACCACAGCTGG + Intergenic
1086721557 11:90127809-90127831 TGGGTCCCTTCCACAACAGCAGG + Intergenic
1086856157 11:91868494-91868516 TGTCAGTTCTCTACAACAGCAGG - Intergenic
1086969554 11:93065940-93065962 TGGCCCCTTTCAACCACAGCTGG + Intergenic
1087126032 11:94626464-94626486 TGGCTCCTTTCAGCCACAGCTGG + Intergenic
1088357455 11:108958929-108958951 TGACTCATCTTTGCAACAGCAGG - Intergenic
1091115206 11:133006186-133006208 AGGCTCCTCCCTACTACAGATGG - Intronic
1095908989 12:47406486-47406508 TGGCTCCTCCATGCAAGAGCTGG + Intergenic
1096589660 12:52649189-52649211 TGGCTCCTCTCTAAAATCCCAGG + Intronic
1096668863 12:53185853-53185875 AGGTTCCTTTCTCCAACAGCTGG + Intronic
1098203850 12:68085050-68085072 TGGCTCCTCCCCACAACATGTGG + Intergenic
1101374917 12:104163286-104163308 TGGCTCCTTCCTACAACACATGG + Intergenic
1102304213 12:111792347-111792369 TGGCTGCTCTCTGCATCATCAGG + Intronic
1102351852 12:112198500-112198522 ACTCTCCTCTCCACAACAGCTGG - Intronic
1105235937 13:18553729-18553751 TGGCTCCTCTTAGCCACAGCTGG - Intergenic
1105359007 13:19689188-19689210 TGGCTGCTGTCTAGAGCAGCCGG - Intronic
1108268064 13:48732174-48732196 TGGCCCCTCTCTGCTCCAGCCGG + Intergenic
1109721062 13:66277190-66277212 TGGCTCCTCTCAGCCCCAGCTGG - Intergenic
1112861270 13:103831471-103831493 TGGCCCCTTTCCACCACAGCTGG + Intergenic
1113055072 13:106259300-106259322 TGGCTCCTCTCTGGAGGAGCAGG + Intergenic
1115887726 14:37992630-37992652 TGGCTCCTCTTGCTAACAGCAGG - Intronic
1118745767 14:68771909-68771931 AGGCTCCTCCCTGCACCAGCCGG - Intergenic
1119450161 14:74702439-74702461 TGGCTCCTTTCAGCCACAGCTGG + Intronic
1120258795 14:82155933-82155955 TGACTCCTAGGTACAACAGCAGG - Intergenic
1120541217 14:85753283-85753305 TGGGTCCTCTCCACAACAGGTGG + Intergenic
1124454788 15:29832086-29832108 TGGCTCTTCTCATCAACAGATGG + Intronic
1124598508 15:31111693-31111715 TGGCACCCCTCTTCAACACCTGG + Intronic
1124666034 15:31593624-31593646 TGGCTCATGTATACAACAGGAGG + Intronic
1125485483 15:40108383-40108405 AGGCTCCTCTCCTTAACAGCTGG - Exonic
1126811900 15:52415024-52415046 GGGCTGCTCTCTAGAGCAGCAGG - Intronic
1127254983 15:57282432-57282454 AGGTTCCTCTCTAAAACAGGGGG - Exonic
1127525142 15:59785430-59785452 TAGCTCTTCTATACACCAGCAGG + Intergenic
1129413129 15:75360767-75360789 TGGCTCCTCTCTGTAGGAGCTGG - Intronic
1131170425 15:90174452-90174474 AGCCTCATCTCTAAAACAGCAGG + Intronic
1132578923 16:676320-676342 CGGCTCCTCACTGCAGCAGCTGG + Exonic
1138481976 16:57309519-57309541 TGGCTCCTCTGCAAAACATCAGG + Intergenic
1138856814 16:60703964-60703986 TGGCTACTCTCTAAAACACTGGG - Intergenic
1139957068 16:70698175-70698197 TGGCCCCTCTCTCCCACAGCTGG - Intronic
1140111079 16:72005636-72005658 TGGCTGCTCTCTCCAGCAACCGG + Intergenic
1141434690 16:83993278-83993300 TGGCTTCTCTATAAACCAGCAGG - Intronic
1148386646 17:47238834-47238856 TGGCTCCTCCCTGCTGCAGCTGG + Intergenic
1151040010 17:70848482-70848504 TGGCTCCTTTCCACAACACATGG + Intergenic
1152879746 17:82808271-82808293 TGCCTCCTCTCCTCCACAGCAGG - Intronic
1154513607 18:15136269-15136291 TGGCTCCTCTTAGCCACAGCTGG + Intergenic
1156480648 18:37434469-37434491 TGGCCCCTGTCTAAAACAGGGGG + Intronic
1156508461 18:37614620-37614642 TGGCAGCTCTCTACAAAAACTGG + Intergenic
1157034786 18:43958440-43958462 ATGGTCCTCTCTAAAACAGCTGG + Intergenic
1157250018 18:46087124-46087146 TGGCTGCTCTCTCCAGCAACCGG + Exonic
1157553659 18:48598500-48598522 TGGCTCCCCTCAACCTCAGCAGG - Intronic
1158071426 18:53475478-53475500 TGGCTCCTTTCAGCCACAGCTGG - Intronic
1160601363 18:80015001-80015023 TGGCCCCTTTCTGCCACAGCTGG + Intronic
1163350367 19:16773113-16773135 AGGCTCCTCTCTGCAACAAAGGG - Exonic
1165848014 19:38831445-38831467 TGGCTCCTCTGCACAAGAGGAGG - Exonic
1166225381 19:41391944-41391966 CGGCTCTTCTCTGCAACACCTGG + Exonic
930254768 2:49077342-49077364 TGGCTCCTTTCAGCCACAGCTGG + Intronic
932325411 2:70856358-70856380 TTGATCCTCTCCACACCAGCTGG - Intergenic
933397901 2:81754964-81754986 TGGCTCCTTTCAACCACTGCTGG + Intergenic
933657539 2:84902115-84902137 TGGCCCATCTCTACCATAGCAGG - Intronic
933739792 2:85524509-85524531 TGGCTCTTCTCCACTCCAGCAGG - Intergenic
938513848 2:131980880-131980902 TGGCTCCTCTTAGCCACAGCTGG + Intergenic
946699018 2:222392142-222392164 TGGCTGGTTTCTCCAACAGCTGG - Intergenic
947543905 2:230997154-230997176 TGGGTCCTTCCTACAACACCTGG - Intronic
1168802176 20:650668-650690 CAGCTCCTCTCCACAGCAGCTGG + Intronic
1170578251 20:17680837-17680859 TGGCTCCTTCCTACAAGTGCTGG + Intronic
1170621692 20:18001771-18001793 TGGCTCCTCTCTGCAAGAGGTGG - Intronic
1174064653 20:47855843-47855865 TGGCTCCTCTGTGTAACAGTGGG + Intergenic
1176376946 21:6091525-6091547 TGGCTCTTCCCTGCCACAGCCGG - Intergenic
1176779936 21:13182015-13182037 TGGCTCCTCTTAGCCACAGCTGG - Intergenic
1177186972 21:17808004-17808026 TAGCTCCTCTTTACTGCAGCTGG - Intronic
1179746529 21:43446719-43446741 TGGCTCTTCCCTGCCACAGCCGG + Intergenic
1181734888 22:24873891-24873913 TGGCTCCTCTCCTCATTAGCTGG + Intronic
1182662269 22:31933433-31933455 TGTCTCCTCTCTCCAACCTCAGG + Intergenic
950694609 3:14689125-14689147 TGGATTCTCTCTACACCAGCAGG + Intronic
951021843 3:17789759-17789781 TCGATCCTTTTTACAACAGCTGG - Intronic
952541265 3:34370605-34370627 TGGCCCCTTTCAACCACAGCTGG - Intergenic
953984341 3:47429751-47429773 TGCTTTCACTCTACAACAGCAGG + Intronic
954743487 3:52773289-52773311 TCCCTCCTCTCTCCAACAACTGG - Intergenic
955056732 3:55461714-55461736 GGGCTCCTCCCTCCATCAGCTGG - Intergenic
960146892 3:114213009-114213031 TGGCACCACACGACAACAGCAGG + Intergenic
960842921 3:121978559-121978581 TGGCCCCTTTCAACCACAGCTGG - Intergenic
961550675 3:127669053-127669075 TGGCCCCGCTCTCCAACAGCTGG - Intronic
961652558 3:128424189-128424211 TGGCTGCTCCCTACACCAGCAGG + Intergenic
965766530 3:172136481-172136503 TGGCCCCAATCAACAACAGCTGG - Intronic
966311861 3:178602668-178602690 TGCCTCCTCTCTCCAGCTGCAGG - Intronic
967157090 3:186703249-186703271 TCTCTCCTCTCTAGAACAGGTGG - Intergenic
967565012 3:190962592-190962614 TGGCTCCTTTCAGCCACAGCTGG - Intergenic
970999070 4:22302154-22302176 CGGCTCATCTCTACAACAATCGG - Intergenic
973651411 4:53000542-53000564 TGGCTCCTCTGTACACAATCTGG - Intronic
975697206 4:77024914-77024936 TTGCTCCACTCCACAAAAGCTGG + Intronic
976706695 4:88026825-88026847 TGGCTCCTTTTAACCACAGCTGG - Intronic
976842668 4:89450231-89450253 TGGTTTCTCTTTAAAACAGCAGG + Intergenic
977026097 4:91821097-91821119 TGGCTCCTTTCAGCCACAGCTGG + Intergenic
979320713 4:119321910-119321932 TGGATCCTCTCTACCACATCAGG + Intronic
980896442 4:138865159-138865181 TGGCTCCTCTCCACACCAACCGG + Intergenic
981843317 4:149137322-149137344 TGAGCCATCTCTACAACAGCAGG - Intergenic
984545884 4:181102044-181102066 TCCTTCCTCTCTGCAACAGCAGG + Intergenic
987791400 5:22573183-22573205 TTGCTCCTCTATACAAAAGTTGG + Intronic
990264531 5:54061199-54061221 TGGCCCTTTTCTGCAACAGCTGG - Intronic
990364209 5:55053386-55053408 TGGCTGTTCTCCAGAACAGCAGG + Intergenic
993662161 5:90650919-90650941 TTGCTCCCCTGTGCAACAGCTGG + Intronic
995925529 5:117369283-117369305 TGGCTCCTTTTAGCAACAGCTGG - Intergenic
996178237 5:120386800-120386822 TGGCTCTTATCTCCAACTGCAGG + Intergenic
998576680 5:143324410-143324432 TGGCTCCTTTCAGCCACAGCTGG + Intronic
1000028560 5:157381684-157381706 GGGCTCCCCTCTTGAACAGCTGG + Intronic
1002495067 5:179606256-179606278 TGGCCCCTCACTTCAACAGAAGG - Intronic
1005916507 6:30356778-30356800 TGTCTCCTCTTTACAACTGTGGG + Intergenic
1006527104 6:34615957-34615979 TGGTTTCTCTTTACAACTGCTGG - Intronic
1006629138 6:35418827-35418849 TGGGTCCTCTCTGCCACAGTTGG + Intronic
1011139566 6:84137670-84137692 TGTCTTTTCTCTACAACTGCAGG + Intronic
1012539178 6:100340685-100340707 TCGCTCCACTGTTCAACAGCAGG + Intergenic
1015805685 6:137106138-137106160 TGGCTTCTCTTTGCAGCAGCTGG - Intergenic
1018235023 6:161715734-161715756 TGGATCCTCTCAGCCACAGCTGG - Intronic
1018756987 6:166858448-166858470 TGGATCCTTTATACAACAGGTGG + Intronic
1019675255 7:2307757-2307779 TGGCTCCTCTCAGACACAGCAGG + Intronic
1025227880 7:57179808-57179830 GGGCTCCTCTCTCCCACTGCCGG + Intergenic
1031374947 7:121013008-121013030 ATGCTCCTCTCTATTACAGCTGG - Intronic
1035322093 7:158037887-158037909 TGTCTACTCTGTACCACAGCAGG + Intronic
1039912541 8:41836378-41836400 TGTCTCCTGTCTGCAATAGCAGG + Intronic
1040413900 8:47180974-47180996 TGGCTCCTCTCCCCTCCAGCAGG + Intergenic
1042294367 8:67203632-67203654 TGGTTTCTCTCTAAACCAGCGGG + Intronic
1042526344 8:69768630-69768652 TGGCCTCTCTCTACACGAGCAGG + Intronic
1042730748 8:71931511-71931533 TGGTTCCTCTCTACATCTCCAGG - Intronic
1042953614 8:74225569-74225591 TGGCCCCTTTCTGCCACAGCTGG + Intergenic
1047298025 8:123588432-123588454 TGTCTCCTCTGTAAACCAGCTGG + Intergenic
1048924730 8:139261312-139261334 TGGCAGCTCTGTACATCAGCTGG + Intergenic
1049515081 8:143050072-143050094 TGGCTCCTTTCCAAAGCAGCTGG + Intronic
1050668154 9:7965213-7965235 TTGCTCCTCTCTGTAACAGATGG - Intergenic
1053002818 9:34586585-34586607 TGGCCCTTCTCTACCACAGAAGG + Intronic
1055665402 9:78547863-78547885 TGGCTTTTCCCTACCACAGCAGG - Intergenic
1057233654 9:93341344-93341366 TGTGTCCTCTCTACAACAAGAGG + Intronic
1057252189 9:93512647-93512669 TGTGTCCTCTCTACAACAAGAGG - Intronic
1057307319 9:93919944-93919966 TGGGTCCCCTTTACAACATCTGG + Intergenic
1057316488 9:93972127-93972149 TGGCTCCTTTCAACAACTACTGG + Intergenic
1060177155 9:121505559-121505581 GGTCTTCTTTCTACAACAGCGGG - Intergenic
1061782324 9:133003486-133003508 TGGGTCCTCTCTGCAACAGAGGG + Intergenic
1186426295 X:9465879-9465901 GGGCTCTTCTCCCCAACAGCGGG - Intronic
1189321322 X:40089346-40089368 TGGCTCCTCTCCGCAACTCCAGG - Intronic
1195228060 X:102818388-102818410 TGGCTCCTTTCAGCCACAGCTGG + Intergenic
1196636781 X:118011309-118011331 TGGCTCCTGTCTACCTCACCAGG - Intronic
1197594403 X:128449241-128449263 TGGCTCCTTTTAACCACAGCTGG + Intergenic