ID: 1083552999

View in Genome Browser
Species Human (GRCh38)
Location 11:63604948-63604970
Sequence TCCCTCTGGTTTCTGGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 291}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083552999 Original CRISPR TCCCTCTGGTTTCTGGGTGC TGG Intronic
900142910 1:1145942-1145964 ACCCTCTGGGGTCTGGGGGCCGG + Intergenic
900675315 1:3881522-3881544 TCTCTTTGGTTTCTGGCAGCTGG + Intronic
901184814 1:7366149-7366171 TCACACTGCTTTCTGGGTGCTGG - Intronic
902174528 1:14639206-14639228 TCACTCTGGCTTCTGTCTGCTGG - Intronic
902228084 1:15009292-15009314 TCTGTCGGGATTCTGGGTGCGGG - Intronic
903006177 1:20300422-20300444 TCCCTCTGGGCTCTGGGTCCTGG - Intronic
904305193 1:29584394-29584416 CCCCACTGGGTGCTGGGTGCTGG + Intergenic
904707797 1:32404587-32404609 TCCCTCTGGCTTCTGTGTAAGGG + Intergenic
905455778 1:38087087-38087109 TCACTCTGGCTGCTGGGTGGAGG + Intergenic
905535007 1:38714460-38714482 TGACACTGGTTTCTTGGTGCTGG - Intergenic
905582465 1:39092679-39092701 TCATTCTTGTTTCTGGGTGATGG - Intronic
905855139 1:41306036-41306058 TCCCTCTGGCCCCTGGGTGTGGG - Intergenic
906061210 1:42949892-42949914 TCCCCCTTGTTTCCGGGTACTGG + Intronic
907180251 1:52563330-52563352 AACCTCTGGTTCCTGGGTTCAGG - Intergenic
907413368 1:54297780-54297802 TCCCTTTGTTTTATGGGTACAGG - Intronic
907715655 1:56923637-56923659 TGTCTCTGGTTTCTCTGTGCTGG + Intergenic
907836165 1:58110655-58110677 CCTCTCTGCTTTCTGGCTGCAGG - Intronic
909669944 1:78177207-78177229 TGCCTCTGGTTGATGGGGGCTGG + Intergenic
913448986 1:118979750-118979772 TCCCTCAGGGTTCCGGGTCCCGG + Intronic
915224534 1:154402869-154402891 TCCTTCTGTTGTCTGGGTGAGGG + Intergenic
915312443 1:155011337-155011359 ACCTTTTGGTTTCTTGGTGCTGG + Intronic
915605147 1:156945723-156945745 TCCCTCTGGTTGCATGGGGCTGG - Intronic
915842221 1:159223521-159223543 TCCCTCAGGTTTCTGGAGGAGGG - Intergenic
916795630 1:168164776-168164798 TCACTCTGGTTGCAGGGTGGAGG + Intergenic
919575540 1:199304214-199304236 TCACTCTGGCTGCTGTGTGCAGG + Intergenic
919835182 1:201568446-201568468 TCCCTCTGAGTTTTGGGTGGTGG + Intergenic
920116628 1:203626409-203626431 CACCTCGGGTTTCTGGGTCCTGG + Intergenic
920268152 1:204742437-204742459 GCCCTCTGGTTTCTGGCAGGAGG - Intergenic
920978553 1:210809392-210809414 TGCTTCTGGTTTCTGGCTGGAGG - Intronic
921047617 1:211488725-211488747 TCCCTCTTTTGTCTGGGAGCCGG + Intronic
921276315 1:213524284-213524306 GGCCTCTGCTTTCTGGGTGATGG - Intergenic
921374594 1:214460769-214460791 CCTATCTGGTTTCTGGGAGCAGG + Intronic
922237461 1:223732880-223732902 TCCCTCTGGTATCTGGGCAGAGG + Intronic
922753465 1:228081898-228081920 TCCCTCTGTGTTCCGTGTGCTGG - Intergenic
924773379 1:247096421-247096443 TCCTTCAGTTTTCAGGGTGCAGG - Intergenic
1062858560 10:792241-792263 TCCATCAGGGTTGTGGGTGCGGG + Intergenic
1063438379 10:6052833-6052855 TTCCTCTGTTTTGTGGCTGCTGG + Intronic
1065154042 10:22851624-22851646 TCACTCTGGCTTCTGAGTGGAGG + Intergenic
1067993193 10:51239220-51239242 TACTTCTGGTTTCTGGGTTACGG - Intronic
1069540567 10:69290989-69291011 TCACTCTGGTTGCGGGGTGAAGG - Intronic
1069720708 10:70547784-70547806 ACCCTCTTGTTTCTGGGTCCTGG + Intronic
1071517280 10:86306522-86306544 TCCCTTTGGTTTCTGAGCCCAGG - Intronic
1072417259 10:95259551-95259573 CCCCTCTGGTTTCTTATTGCAGG - Intronic
1072711467 10:97718339-97718361 TCCCTCTGGTTTCTGTCCTCAGG - Intergenic
1072794058 10:98340733-98340755 TCTCTCTGGTTCCAGGGTGGAGG - Intergenic
1073476359 10:103756490-103756512 GCACTCTGGTTTCTGGGTCCAGG - Intronic
1073759729 10:106616516-106616538 TCCATCTCCTTTCTGGGTGCTGG - Intronic
1075295216 10:121269490-121269512 TCAGTCTAGTTCCTGGGTGCTGG + Intergenic
1076130357 10:128009842-128009864 TCTCTCTTGTTTCTGAGTGGTGG + Intronic
1076151697 10:128167690-128167712 GCCCTCTGGTTGCTGTCTGCAGG - Intergenic
1076706703 10:132306263-132306285 TGCCTCTCGTTTCTGGCTGCGGG - Intronic
1076782047 10:132729739-132729761 TCCCACTGGTTTATTGGTGATGG - Intronic
1076866247 10:133167790-133167812 TCCCTCTGGTGTCTGAGGGTAGG - Intronic
1077109686 11:856626-856648 CTCCTCTGGTTTCCGGGTCCAGG + Intronic
1077268806 11:1665649-1665671 TCCCTCTGGGCTCAGGGAGCTGG - Intergenic
1077271947 11:1685531-1685553 TCCCTCTGGGCTCAGGGAGCTGG + Intergenic
1077318503 11:1929647-1929669 ACCCTCTTGTTTCTGGGGGTTGG + Intronic
1077359741 11:2135518-2135540 TCCCATTGGTGTCTGGGGGCGGG + Exonic
1077394316 11:2313632-2313654 TCCCTGTGGTCTCTCGGTGCAGG + Exonic
1078480409 11:11670778-11670800 TTCCTCTGCTCTCTGTGTGCAGG - Intergenic
1078975904 11:16476339-16476361 TACCAGTGATTTCTGGGTGCTGG - Exonic
1080084392 11:28260523-28260545 TCCCTCTGTTTTCTGGGATATGG + Intronic
1081643044 11:44770660-44770682 TCACTCTGGCTGCTGGGTGGAGG + Intronic
1081711220 11:45217062-45217084 TCCCTTTTGTATCTGGGAGCAGG + Intronic
1083552999 11:63604948-63604970 TCCCTCTGGTTTCTGGGTGCTGG + Intronic
1083579205 11:63813937-63813959 TCCCTCTCGGATCTGGGTCCAGG + Intronic
1083647930 11:64183896-64183918 TCCCTCTGGCTGCTGTGTGGAGG - Intergenic
1083758478 11:64803427-64803449 TCCCTCTGTCTTCTGGCTCCCGG - Intergenic
1085269576 11:75262351-75262373 TCCCTCTGTGTCCTGGTTGCTGG + Intergenic
1086797750 11:91129551-91129573 TCCTGCTGGTTTCTGGTTTCAGG + Intergenic
1087125392 11:94620658-94620680 TCACTCTGGCTTCATGGTGCTGG - Intronic
1088995299 11:114990555-114990577 TCCCACTGGTTGCTGTGGGCTGG - Intergenic
1089687898 11:120168730-120168752 TCCCTCTGGCTGCTGGGTGGAGG - Intronic
1090643790 11:128751045-128751067 TGTCTCTGGTTTCTGAGTCCAGG - Intronic
1090971782 11:131650057-131650079 TGCCTCTGGTTTCTGGAGGAGGG + Intronic
1092171722 12:6377541-6377563 TTCGTCTGCTCTCTGGGTGCTGG + Intronic
1093415045 12:18910030-18910052 TCCCTCTAGATTCTGGGAGTAGG - Intergenic
1094438950 12:30453559-30453581 TTCCTCTGACTTCAGGGTGCTGG + Intergenic
1095420455 12:42019019-42019041 GCCCTCTGATGTCTGGGGGCTGG - Intergenic
1095610340 12:44120758-44120780 TCGTCCTGGTTTCTGGGTGTTGG + Intronic
1096076473 12:48808867-48808889 TCACTGTGGTATCTGGGTGTGGG + Intergenic
1098172533 12:67761196-67761218 TCCCTGTGGTTGCTGGGGTCTGG - Intergenic
1100702829 12:97166030-97166052 TGCCTCTGATTTCTAAGTGCTGG + Intergenic
1103039591 12:117684280-117684302 TCCCACTGGTTTGGGAGTGCTGG + Intronic
1103992688 12:124809850-124809872 TCCCTCTGGCGTCTGGCTGGTGG - Intronic
1104496959 12:129249963-129249985 TCTCTCTGGTCTCTGGATTCTGG - Intronic
1105447504 13:20470376-20470398 TCCCTGTGGTTTCCCAGTGCTGG - Intronic
1105486619 13:20839180-20839202 AACCTCTGCCTTCTGGGTGCAGG - Intronic
1108576458 13:51795684-51795706 TCCTTCTGGTTCCTGGGCTCAGG - Intronic
1112047956 13:95616658-95616680 TGCCTCTGGCCTCTGGGTCCTGG - Intronic
1113104800 13:106760336-106760358 TCTCTCTGGTCTCTGCCTGCAGG + Intergenic
1114284787 14:21230883-21230905 TCTTTCTGTTTTCTGGGTGTGGG - Intronic
1119271793 14:73312309-73312331 AACCTCTGCTTTCTGGGTTCAGG - Intronic
1119473180 14:74911808-74911830 TCCCTCCGGTTGCCGGGTCCTGG + Exonic
1120155449 14:81088234-81088256 TCCCTCCTGTTTCTTGGAGCAGG - Intronic
1120278527 14:82409350-82409372 TCCCCCTGGATTTTGGGGGCAGG + Intergenic
1121245390 14:92458181-92458203 TCCCTTTGCTTCCTGGGAGCTGG + Intronic
1121617504 14:95322573-95322595 GTCCCCTGGTTTCTGGGTTCAGG - Intergenic
1122152124 14:99731004-99731026 TTCCTCTGTGCTCTGGGTGCTGG + Intergenic
1122953664 14:105060139-105060161 TCCCTCGGGTGCCTGTGTGCTGG + Intronic
1123181224 14:106472338-106472360 CCCTGCTGGTTCCTGGGTGCTGG + Intergenic
1202945669 14_KI270726v1_random:24362-24384 CCCTGCTGGTTCCTGGGTGCTGG - Intergenic
1123668301 15:22627952-22627974 ACCTTCTGTTTTCTGGGAGCAGG - Intergenic
1123777294 15:23592053-23592075 TCCCTCTGGTATCTGGTTAATGG + Intronic
1123821068 15:24030983-24031005 TCCCTCTTGTTTCTGGATGAAGG + Intergenic
1124524276 15:30434394-30434416 ACCTTCTGTTTTCTGGGAGCAGG - Intergenic
1124534390 15:30531828-30531850 ACCTTCTGTTTTCTGGGAGCAGG + Intergenic
1124764258 15:32475783-32475805 ACCTTCTGTTTTCTGGGAGCAGG - Intergenic
1124774377 15:32573319-32573341 ACCTTCTGTTTTCTGGGAGCAGG + Intergenic
1125333206 15:38602377-38602399 TCCCTCAGGTTTATGGCTGAGGG - Intergenic
1126183418 15:45808295-45808317 TGCCTCAAGTTTCTGGGTGGGGG - Intergenic
1126970435 15:54105066-54105088 CTCCTATGGTTTCTGGGAGCAGG + Intronic
1128742858 15:70095896-70095918 TCACTCCGGGTTCTGGGTGTCGG - Intronic
1129119592 15:73388055-73388077 TCCCTCTAGATGCTGGGTTCTGG - Intergenic
1129681556 15:77661197-77661219 TCCCTCTGCCTTCTTGGTGTGGG - Intronic
1132552196 16:558141-558163 GCCCTGTGGTTGCGGGGTGCTGG + Intergenic
1133269449 16:4603420-4603442 AACCTCTGCTTTCTGGGTTCAGG - Intergenic
1134232563 16:12439949-12439971 TCCAGCTGGTGTGTGGGTGCAGG + Intronic
1134673934 16:16076115-16076137 TCCTTCTGCTTTCTGGGTCTGGG + Intronic
1134689745 16:16183431-16183453 TCCCTCTGGTCACTGGGTGGAGG - Intronic
1135603539 16:23803262-23803284 TCCACCTCTTTTCTGGGTGCTGG - Intergenic
1135935447 16:26775904-26775926 TGCCTCTGGTTTCTGTGTCAAGG + Intergenic
1136380597 16:29892970-29892992 TCCTTCTGACTTCTGGGGGCAGG - Intronic
1137341342 16:47609423-47609445 TCCCTCTTTTTTGTGGGTGGGGG + Intronic
1137510291 16:49093756-49093778 TCTCTCTGGTTTCCTGGGGCTGG - Intergenic
1138526604 16:57611741-57611763 TCCCCCTGGTTTCTGGTGGTTGG - Intronic
1138715413 16:59016641-59016663 TCACTCTGGTTTGTGGGAACTGG - Intergenic
1139587982 16:67916603-67916625 GCCCTCTGGGTTCTGGGTAATGG + Intronic
1141179466 16:81742640-81742662 TCCCACTGCTTTCAGGGAGCTGG + Intronic
1144370454 17:14585246-14585268 TCAATCTGATTTCTGTGTGCTGG + Intergenic
1144505116 17:15822833-15822855 GCTCTCTGGTCTCAGGGTGCAGG + Intergenic
1144645397 17:16970343-16970365 GCTCTCTGGTCTCGGGGTGCAGG - Intronic
1144956369 17:19020873-19020895 TCCCTCTGGCATTTGGGAGCCGG - Exonic
1145169293 17:20640716-20640738 GCTCTCTGGTCTCAGGGTGCAGG + Intergenic
1145203981 17:20970904-20970926 GCTCTCTGGTTTCAGGGTGCAGG + Intergenic
1145234056 17:21196301-21196323 CCCCTCAGGTGTCTGAGTGCTGG - Intergenic
1147951660 17:44111093-44111115 TCTCCCTGGTTCCTGGGAGCTGG + Intronic
1147986236 17:44309076-44309098 TCCCTCTGGGTTCTGGGCCTGGG - Intronic
1148687836 17:49510472-49510494 TGCCTCAGGCTCCTGGGTGCTGG - Exonic
1150211227 17:63442621-63442643 TCCCTCTGGTTGCAAGGTTCTGG - Intronic
1151848806 17:76677356-76677378 CCCCTCTGGTTTCTGCTTGCTGG - Exonic
1152602728 17:81273027-81273049 GCCCACAGGTTTCAGGGTGCAGG + Intronic
1153475810 18:5497302-5497324 TCATTCTGGCTTCTGAGTGCAGG + Intronic
1153662745 18:7339913-7339935 TGCCACTGGGTTCTGGGTTCTGG - Intergenic
1154054567 18:11000616-11000638 TCCCTTTGGTTCAGGGGTGCAGG - Intronic
1154313783 18:13287502-13287524 TCCCTCTGGAGAGTGGGTGCAGG + Intronic
1154491537 18:14925796-14925818 TCCCTCGGGCCTCTGGGTCCGGG - Intergenic
1156469785 18:37370077-37370099 TCCCTGTGGTTTCAGGCTGTAGG - Intronic
1157626440 18:49055057-49055079 TCTCTCTCTTTTCTGGGGGCTGG + Intronic
1157808819 18:50678780-50678802 TCCCCTTGTTTTCTGGGTGAAGG + Intronic
1158188927 18:54803534-54803556 TCTCCCTGGCTTCTGGGTGGAGG + Intronic
1160739407 19:679104-679126 CCCCTCTGGCTTCTGGGAGAAGG + Intronic
1163054216 19:14706186-14706208 TCCCTCTGGCCTCTGTGTCCAGG - Intronic
1163711686 19:18850899-18850921 TTCGTGTGGTTTCTGGTTGCGGG + Intronic
1165542432 19:36503376-36503398 CCCCACTGGTTTCCAGGTGCAGG + Intergenic
1166862110 19:45816709-45816731 TCCCTCTGGTTGGTGGGGACTGG - Intronic
926029184 2:9570701-9570723 TCCCTCAGGATTCTGAGTCCTGG + Intergenic
927712149 2:25332650-25332672 TCCCTCTGATTCCAGGCTGCTGG + Intronic
927827250 2:26317409-26317431 GCCCTCTCTTTTCTGGGTCCTGG + Intronic
928583915 2:32738194-32738216 AGCCTCTGGTCTCTGGCTGCCGG + Intronic
929453788 2:42052665-42052687 TCACTCTGCTTCCTGGGTGCGGG - Intronic
932578185 2:72974111-72974133 TCCATGGGATTTCTGGGTGCTGG + Intronic
933647062 2:84821455-84821477 TCACTCTTGGTTCTGGATGCAGG - Intergenic
934579228 2:95425213-95425235 GCTCTCTGGTTTCTGAGTGATGG + Intergenic
934600218 2:95651511-95651533 GCTCTCTGGTTTCTGAGTGATGG - Intergenic
936533568 2:113293507-113293529 GCTCTCTGGTTTCTGAGTGATGG - Intergenic
937094824 2:119228606-119228628 TCACCCTGATTTCTGGCTGCTGG - Intronic
937342744 2:121101609-121101631 TCTCTCTGCTTTCTGGGAGGTGG - Intergenic
939153954 2:138502225-138502247 GCCCTCTGCTCTCTGGGTCCCGG + Intronic
940990278 2:160089028-160089050 TCCCTCTGCCCTCAGGGTGCTGG - Intergenic
941005733 2:160245114-160245136 CCACTCTGGCTTCTGTGTGCTGG - Intronic
946547109 2:220756380-220756402 TTTCTCTGGTTTCTGGGAGAAGG - Intergenic
947791974 2:232873710-232873732 TGCCTCAGGCTTCTGGGGGCTGG - Intronic
948424354 2:237877934-237877956 TCCCTCAGCCTCCTGGGTGCTGG + Intronic
1169149483 20:3277977-3277999 TCCATCTGATTTCTGCTTGCTGG + Intronic
1169361870 20:4957111-4957133 TCCCTCTTCTTACTGGCTGCAGG + Intronic
1170586214 20:17735985-17736007 TGACTATGGTTTCTGGGTGGTGG - Intergenic
1170738448 20:19031339-19031361 TCCATCTGGTATCTGGATGGCGG + Intergenic
1170827206 20:19807013-19807035 TCCCACTGATGTCTGGGTTCAGG + Intergenic
1172200035 20:33119123-33119145 CCCCTCTGGGTACTGGGTACTGG + Intergenic
1172390098 20:34560088-34560110 TCCCTCTGGGTGCTGGCTGGTGG + Exonic
1172629460 20:36368182-36368204 TCCTGCTGGTGTCTGGGTGGAGG - Intronic
1173138561 20:40461603-40461625 TCCCTCTGGTTTCTAGGTATAGG - Intergenic
1173432723 20:43005125-43005147 GCACCCTGGTTCCTGGGTGCTGG - Intronic
1173703947 20:45096499-45096521 GCCCTCAGGATACTGGGTGCTGG - Intronic
1174042695 20:47711106-47711128 TCCCAGTGGTTTCTGGTTGCAGG - Intronic
1174500517 20:50980930-50980952 GCCCTCTGGGGTCTGGGTGGAGG + Intergenic
1174913677 20:54633220-54633242 TCCCTATGCTTTCTGGGCCCTGG - Intronic
1175877052 20:62235337-62235359 TCCCCCAGGTTTCTGGGTCTGGG - Intronic
1178157064 21:29867119-29867141 TGTCTCTTGTTTCTGGGTGCAGG + Intronic
1180594966 22:16967153-16967175 CCACTCAGGTTTCTGGATGCTGG + Intronic
1180727644 22:17958528-17958550 TCCCTCTGGTTTTTGGGGTAGGG - Intronic
1181535089 22:23537674-23537696 TCCCGCTGGGTCCCGGGTGCTGG - Intergenic
1181935573 22:26436100-26436122 TCCCACTGTTTCCTGGGGGCAGG - Intronic
1182656961 22:31898291-31898313 GCCCTCTGGGTTCTGGGCTCTGG - Intronic
1183133570 22:35864435-35864457 TCCCTCTAGTTATTGGGTGGTGG - Intronic
1183391819 22:37549715-37549737 CTCATCTGGTTTGTGGGTGCTGG - Intergenic
1184377854 22:44125786-44125808 TCACTTAGGCTTCTGGGTGCAGG + Intronic
1184568624 22:45308749-45308771 TCCCACTGTTTTCTGGGCTCTGG + Intergenic
1184852008 22:47126408-47126430 TCCCTCTTGTAACTGGGTGGAGG + Intronic
1184929663 22:47671803-47671825 TCCCACTGGCTTCTGGGTGTTGG + Intergenic
953986491 3:47447310-47447332 AACCTCTGCTTTCTGGGTTCAGG - Intronic
954645563 3:52129575-52129597 TACCTCTGGTAGCTGGGGGCAGG - Intronic
954724672 3:52597596-52597618 TCACTCAGGTTTCAGGGTACTGG + Intronic
958718819 3:97821052-97821074 CCCCTCTGGCTTTCGGGTGCTGG - Intergenic
960944377 3:122956260-122956282 TCCCTGTGGGTTCTGGGTTTGGG + Intronic
961141359 3:124559296-124559318 TCTCTCTCCTTTCTGGGTCCTGG - Intronic
961662931 3:128479934-128479956 TGCCCTTGGTTTCTGGGGGCTGG - Exonic
961930346 3:130526522-130526544 TCCCTCTGATTGCTGTGTGAAGG + Intergenic
965519301 3:169657571-169657593 TCCCTCTGGAGACTGGGTTCTGG - Intronic
966100816 3:176267416-176267438 TCCCACTGGGGTCAGGGTGCTGG + Intergenic
966876132 3:184322899-184322921 TCCCTCTGGCTTCTGCATACTGG - Exonic
968571595 4:1345097-1345119 TCCCTCTGGTTGCTGCATGATGG + Intergenic
968603255 4:1520317-1520339 TCCCCGTGGCTTGTGGGTGCCGG - Intergenic
969523846 4:7694113-7694135 TTGCTCTGTTTTCTGGCTGCAGG + Intronic
969914904 4:10481143-10481165 AACCTCTGGTTCCTGGGTGAGGG + Intergenic
971244642 4:24917114-24917136 CCCCTCTGGTATCTGGCTGCTGG - Intronic
972726440 4:41749889-41749911 TTCCTCAGGCTTTTGGGTGCTGG + Intergenic
973852672 4:54976843-54976865 TCCCTCTGGTGTGCAGGTGCTGG - Intergenic
975673236 4:76802376-76802398 TCCCTTTGGCTTCTTGGTGAGGG + Intergenic
978682580 4:111399749-111399771 GCCCTCTGGCTTCTGGCTGGTGG + Intergenic
979548459 4:121963798-121963820 TCCTTCTTGTTTCTAGCTGCCGG + Intergenic
981281884 4:142967855-142967877 TCCCTCTGGCGTCTGTGTGTTGG - Intergenic
984305447 4:177983633-177983655 TCCCTCTGATTTCTATTTGCTGG + Intronic
990820415 5:59833326-59833348 TCCCTCTCCTTGCTGGGGGCTGG - Intronic
991104483 5:62828892-62828914 TCTCTCTGGCTTCTGGAAGCTGG - Intergenic
991498185 5:67248805-67248827 TTCCTGTGGTCTCTGGGAGCTGG - Intergenic
996477346 5:123936749-123936771 TCCCCATGGTTCCTGGGTCCTGG + Intergenic
997896950 5:137727378-137727400 TCCCTCTGGAGTCTGGGAGGAGG - Intronic
999262055 5:150244503-150244525 TCCCTCTGCTCTCTGGGGCCTGG - Intronic
999869604 5:155735552-155735574 TGCCAGTGGTTTCTGGCTGCTGG + Intergenic
1000338618 5:160260325-160260347 TCCCTCTGGTTTCCAGGTCTTGG + Intronic
1000541039 5:162540347-162540369 TCCCTCTGGCTGCTGAGTGGAGG + Intergenic
1001019467 5:168170734-168170756 TCCCTCTGGCTGCTGTGTGGAGG - Intronic
1001052398 5:168423778-168423800 TCCCTCTGCCTTCTGGGTCTTGG - Exonic
1001449184 5:171810888-171810910 TCCCTCTGGCTACTGGATGGAGG - Intergenic
1002061349 5:176627716-176627738 CCCCTCCTGTCTCTGGGTGCTGG - Intronic
1002214365 5:177619371-177619393 TCCCTCTCGGTGCTGGGTTCTGG + Intergenic
1006895617 6:37468041-37468063 TCCCTCTGTTTTGTGGGGGGGGG + Intronic
1007495698 6:42259297-42259319 TCCTCCTGGGCTCTGGGTGCTGG - Intronic
1008383773 6:50863450-50863472 ACCCTCTAGTTTCTGGGGGTGGG + Intergenic
1009720865 6:67467549-67467571 TTCCTGTGGTTTCTGGGAGCAGG - Intergenic
1010147669 6:72690188-72690210 AACCTCTGGCTTCTGGGTTCAGG - Intronic
1014747852 6:125220938-125220960 TCCCTCTGCATTCTGTGTCCTGG + Intronic
1014862213 6:126483843-126483865 TCCCTCTGTTTTCTGTTTTCTGG + Intergenic
1015151988 6:130050167-130050189 TTCCTCTGGCTTCAAGGTGCAGG - Intronic
1016521942 6:144955435-144955457 TACCTCTGGTGTCTGGGAGGAGG - Intergenic
1019154838 6:170031988-170032010 CCTCTCTGGTTTCGGGCTGCTGG - Intergenic
1021669453 7:23020712-23020734 TGCCTCTGCTCTCTGGGTGAGGG - Intergenic
1021867367 7:24971506-24971528 TCTCTCTGGACTCTGGGTGTGGG - Intronic
1021902782 7:25303854-25303876 TCCTAGTGGTTTCTGGGTGATGG + Intergenic
1022280969 7:28909009-28909031 TCCCTCTGGTGTTTGGTTCCAGG + Intergenic
1022465961 7:30653390-30653412 TTCCTCTGGGTTCTCTGTGCTGG - Exonic
1022813912 7:33895522-33895544 TCTCTCGGGAGTCTGGGTGCTGG + Intergenic
1023474285 7:40560321-40560343 TCCCTCTACTTTTTGGGTGGAGG + Intronic
1024978717 7:55137809-55137831 TGCCTCTGGTGTATGGGGGCAGG + Intronic
1026470552 7:70691580-70691602 TCCCTATGCTTTCTGGAAGCGGG - Intronic
1026790661 7:73329196-73329218 TCTCTCTGCATTTTGGGTGCCGG - Intronic
1026989465 7:74575491-74575513 TCCCTCTGGTTGCTGGCTTGAGG + Intronic
1028201399 7:87966577-87966599 TGCCTCTGGTTTGTTGGAGCAGG + Intronic
1028251814 7:88546265-88546287 TCTCCATGGTTCCTGGGTGCCGG + Intergenic
1028566410 7:92237045-92237067 TCCCACTTGTTTCATGGTGCTGG - Intronic
1028773880 7:94657367-94657389 TTCCTCTGTTTTCTTGGAGCAGG + Intronic
1029261540 7:99306072-99306094 TCACTCTTGTTTCTCAGTGCGGG + Intergenic
1029692102 7:102189346-102189368 TCCTTCTTTTTTTTGGGTGCGGG + Intronic
1031498286 7:122479112-122479134 TCACTCTGGTGTCTGGGAGTGGG + Intronic
1032447486 7:131997024-131997046 TCTCTCTGGCTTCTGGAAGCTGG + Intergenic
1034864002 7:154624976-154624998 TCCCACTGGTGTCCGGGTGATGG - Intronic
1035777739 8:2202664-2202686 TCCCACTGGTTGCGGGGTTCTGG + Intergenic
1036763797 8:11533318-11533340 TCCATCGGGTTTGAGGGTGCAGG - Intronic
1037315368 8:17595216-17595238 TCCCTCTGGCATTTGGGAGCAGG - Intronic
1040059334 8:43091274-43091296 TCCCTCAGGTTTCAGTGCGCTGG + Intergenic
1043531787 8:81159362-81159384 TCCCTCTTGCCTCTGGGAGCAGG + Intergenic
1045249728 8:100473444-100473466 CCCCGCAGGTGTCTGGGTGCTGG - Intergenic
1045378025 8:101594491-101594513 TGCCTCTGGTTTCTGAAAGCTGG - Intronic
1045540619 8:103080920-103080942 GCCCACTGGGTGCTGGGTGCTGG + Intergenic
1048204616 8:132405383-132405405 TGCCACTGGTGGCTGGGTGCTGG - Intronic
1048488741 8:134872121-134872143 TCCCCTTGGTTTCAGGTTGCAGG + Intergenic
1048646054 8:136421136-136421158 TGCCTCTGGTTTCAGGCTGCCGG + Intergenic
1049346075 8:142139415-142139437 GCGCTGTGGTTGCTGGGTGCAGG + Intergenic
1049407889 8:142459884-142459906 TCCCTCTGCCTGCTGGGGGCAGG - Intronic
1049467309 8:142757500-142757522 CTCCTCTGGGTTCTGGGTGAGGG - Intergenic
1049798546 8:144507316-144507338 TCCCTCTGGCCTCTGGTTGTGGG + Intergenic
1049995373 9:1029236-1029258 TTCCTGTGGTTGCTGTGTGCAGG + Intergenic
1051121018 9:13752444-13752466 TCCCTCCAGTTTCTGGCTTCTGG - Intergenic
1057861947 9:98647613-98647635 TCCCCCTGGATACTGAGTGCTGG + Intronic
1058631680 9:106995063-106995085 TCCCTCTGTATTTTGGGTCCAGG + Intronic
1059348122 9:113646119-113646141 TCCCTCTGGCAGCTGGGTGGAGG + Intergenic
1060010136 9:120036658-120036680 TCCATCTGGTTAATGGGTGCAGG + Intergenic
1060964882 9:127706895-127706917 GCCCTCTTCTTGCTGGGTGCCGG - Intronic
1061245485 9:129399369-129399391 TCCCGCTGGGTCCCGGGTGCTGG + Intergenic
1061370743 9:130196053-130196075 TCACTCTGGCATCTGGGTGGAGG + Intronic
1062253932 9:135612332-135612354 CCTCCCTGGTGTCTGGGTGCTGG - Intergenic
1187206153 X:17183687-17183709 TCCCTCTGGCTGCAGGGTGGAGG - Intergenic
1189634864 X:42996212-42996234 TCCCTCTGGCTTCTTTGTGTAGG - Intergenic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1191065627 X:56343880-56343902 TTCCTCTGGTTTCGGGGTGGGGG + Intergenic
1192111290 X:68367586-68367608 TCCCTCTGGAATCAGGGTACAGG - Intronic
1196102089 X:111857163-111857185 TCCTTCTGGTTACTGGGTGGAGG + Intronic
1196340892 X:114596018-114596040 ACCCTCTGTTATCTGGGTTCTGG - Intronic
1198048635 X:132927335-132927357 TTCCTCTGGCTTCTGTGTGAAGG - Intronic
1198283096 X:135162325-135162347 TCCATGTGGCTTCTGGGTTCAGG - Intronic
1198285416 X:135185562-135185584 TCCATGTGGCTTCTGGGTTCAGG - Intergenic
1198309225 X:135413516-135413538 TCCTTCAGTTTTCTTGGTGCCGG - Intergenic
1198960153 X:142174795-142174817 GCCCTCTCATTTCTGGGTGAGGG - Intergenic
1199305348 X:146261141-146261163 TCACTCTGGCTGCTGTGTGCAGG - Intergenic
1199853370 X:151740714-151740736 CACTTCTGGTTTCTGGGAGCTGG + Intronic
1199984150 X:152938312-152938334 ACCCTCTGGCTTCTGGGGCCAGG + Intronic
1200972096 Y:9163718-9163740 TCCCTGTGCTTTCTGGGGCCTGG + Intergenic
1201495392 Y:14587393-14587415 TCCCTGTGGTTTTTGTCTGCAGG - Intronic
1201574398 Y:15446665-15446687 TCTCTCTGACTTCTGGGAGCTGG - Intergenic
1202138928 Y:21700573-21700595 TCCCTGTGCTTTCTGGGGACTGG - Intergenic
1202244880 Y:22810083-22810105 TCTCTCTCCTTTCTGGGTCCAGG - Intergenic
1202397869 Y:24443829-24443851 TCTCTCTCCTTTCTGGGTCCAGG - Intergenic
1202472912 Y:25226258-25226280 TCTCTCTCCTTTCTGGGTCCAGG + Intergenic