ID: 1083553401

View in Genome Browser
Species Human (GRCh38)
Location 11:63607599-63607621
Sequence GTTTCGGTCTTGAAAGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083553397_1083553401 -3 Left 1083553397 11:63607579-63607601 CCTGAGCACCTGAGATTTTTGTT 0: 1
1: 0
2: 3
3: 21
4: 297
Right 1083553401 11:63607599-63607621 GTTTCGGTCTTGAAAGATGAGGG 0: 1
1: 0
2: 0
3: 18
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083553401 Original CRISPR GTTTCGGTCTTGAAAGATGA GGG Intronic
902265184 1:15258184-15258206 GTTTCAGTTTTGCAAGATGAAGG - Intronic
905607245 1:39313049-39313071 GTTAAGGTCATGAAAGATGATGG - Intronic
907542091 1:55224973-55224995 GTTTGTGTCTTGAGAGATGGGGG - Intergenic
907761508 1:57366135-57366157 GTTTTGGTCTTGAAGGAGGAAGG - Intronic
908043919 1:60147663-60147685 GTTTCCTTCTTGAAAAATGCAGG + Intergenic
908696462 1:66848232-66848254 GTTGCTGTCTTTGAAGATGAAGG - Intronic
908872748 1:68633265-68633287 GTATAGGACTTGAAAGATAAAGG - Intergenic
911682102 1:100728925-100728947 GTTTCATTCTTAAAAGATGTGGG + Intronic
913446865 1:118959413-118959435 GTTTCAGGCCTGAGAGATGATGG + Intronic
916081077 1:161232772-161232794 GTTTGCCTCCTGAAAGATGAGGG + Intronic
917134662 1:171778042-171778064 GTTTCTGGCTTTGAAGATGAAGG - Intergenic
918543195 1:185653966-185653988 TGTTCTGTCTTGAAAGAGGAAGG - Intergenic
920752139 1:208688912-208688934 AGTTGGGTCTTAAAAGATGAAGG + Intergenic
921774536 1:219081871-219081893 GTTTCTGTCTTCAAAGAAGTGGG + Intergenic
1067510708 10:46892839-46892861 ATTTCAGGCTTGAAATATGAAGG - Intergenic
1067651547 10:48159023-48159045 ATTTCAGGCTTGAAATATGAAGG + Intronic
1071764797 10:88651334-88651356 GTTTTTCTCTTGAAAAATGAAGG - Intergenic
1077491576 11:2863147-2863169 GTTTCTGTCATGAAAGGCGAGGG - Intergenic
1078961172 11:16274050-16274072 CTTTCTGTTTTGAAAGATAAGGG - Intronic
1079092955 11:17493559-17493581 GTGTCGTTCTTGAAAGAAGCTGG + Intergenic
1080020253 11:27552628-27552650 GTTAAGGACTTGAAAGATGCAGG - Intergenic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1083553401 11:63607599-63607621 GTTTCGGTCTTGAAAGATGAGGG + Intronic
1085250958 11:75143635-75143657 GTCTCCGTTTGGAAAGATGAGGG + Intronic
1085664448 11:78401244-78401266 GTTTCAGTTTTGCAAGATAAAGG - Intronic
1089849231 11:121482129-121482151 GTTTTGGACTTGAAGGAGGAGGG + Intronic
1091790712 12:3270443-3270465 GTTCCGGGCTTCAAAGATGAAGG - Intronic
1092819860 12:12343331-12343353 GTTTTGGTCTTCAAAGGTCAAGG + Exonic
1095497868 12:42804337-42804359 GTTTCTTTCTCAAAAGATGAAGG - Intergenic
1095525083 12:43116300-43116322 GTCAAGGACTTGAAAGATGAAGG - Intergenic
1095988223 12:48014963-48014985 GAATTGGGCTTGAAAGATGAAGG + Intergenic
1096084227 12:48854738-48854760 GTCTCTGTCTCCAAAGATGATGG - Intergenic
1097980741 12:65735731-65735753 GGTTGGATCTTGAAAGATAATGG + Intergenic
1098078199 12:66756137-66756159 GTTTCAGTTTTGCAAGATGAAGG - Intronic
1101693482 12:107102807-107102829 GTTTAGCTCTAGAAAAATGAAGG + Intergenic
1104222012 12:126794252-126794274 GTTTCGTGCTTGGAAGATGAAGG + Intergenic
1104341946 12:127958550-127958572 GTTTCTGGCTTTAAAGATGGAGG - Intergenic
1107358097 13:39589627-39589649 GTGTCTGTCTTTAAAAATGAAGG - Intronic
1107361815 13:39626340-39626362 GTTTCTGTTTTGCAAGATGAAGG - Intergenic
1111777241 13:92679901-92679923 GTTCCGCTCTTGAAAGAGAAGGG - Intronic
1116664501 14:47757826-47757848 GCTTCGGCCTTGGAAGTTGAGGG + Intergenic
1116949478 14:50865836-50865858 TTTTCAGTCCTAAAAGATGACGG - Intronic
1124409850 15:29427946-29427968 GTTTCGGACTTTTAAGGTGATGG - Intronic
1124449564 15:29774215-29774237 GTTGCGGACTGGAAAGCTGAGGG - Intronic
1124995128 15:34716368-34716390 GGTCCTGTTTTGAAAGATGAGGG - Intergenic
1130711887 15:86291248-86291270 GCTTAGATCTTGAAAGAAGAGGG - Intronic
1130813098 15:87402932-87402954 TTTTCAGTGTTTAAAGATGAGGG - Intergenic
1133734145 16:8601145-8601167 GTTGGGTTCATGAAAGATGATGG + Intergenic
1135342154 16:21658305-21658327 GTTTCAGTTTTGCAAGATAAAGG - Intergenic
1138698904 16:58842283-58842305 GTTGCAGTTTTGTAAGATGAAGG - Intergenic
1139368123 16:66446360-66446382 GTTTGGGGCTTGAAACGTGAAGG + Intronic
1140762851 16:78127033-78127055 GTTTCTATCTGGAAAGATGTAGG + Intronic
1142205518 16:88781175-88781197 CTTTCGGTGCTCAAAGATGAAGG - Intronic
1142898599 17:2998258-2998280 GTTTTCCTCTTGGAAGATGATGG - Exonic
1145744487 17:27304890-27304912 GTATGGGACCTGAAAGATGATGG + Exonic
1147047132 17:37761358-37761380 GTTTCAGTTTTGCAAGATGAAGG + Intergenic
1147051496 17:37798279-37798301 GATTGGATCTTGAAAGATGCTGG - Intergenic
1148170478 17:45515397-45515419 GCTTTGCTCGTGAAAGATGATGG + Intergenic
1148170955 17:45519390-45519412 GCTTTGCTCGTGAAAGATGATGG + Intergenic
1148278725 17:46330407-46330429 GCTTTGATCATGAAAGATGATGG - Intronic
1148300935 17:46548269-46548291 GCTTTGATCATGAAAGATGATGG - Intronic
1148365065 17:47049162-47049184 GCTTTGCTCATGAAAGATGATGG - Intergenic
1149101717 17:52914507-52914529 AATTCGGTCTTGAAAGATAAGGG + Intergenic
1149209273 17:54285682-54285704 ACTTCGGTCTTGAAAAATGAGGG - Intergenic
1150182187 17:63134858-63134880 ATTTCTATCTTGAAAGATGCTGG + Intronic
1150401572 17:64860994-64861016 GCTTTGATCATGAAAGATGATGG + Intronic
1153929126 18:9863251-9863273 GTTTCGTTTTTCAAAGAGGAAGG + Intergenic
1155196640 18:23481229-23481251 GCTTCATTTTTGAAAGATGATGG + Exonic
1158144556 18:54297307-54297329 GTTTCTGTCTTGAATGTAGAGGG + Exonic
1163467269 19:17475524-17475546 GACTCTGTCTTGAAAAATGAAGG + Intronic
1165052198 19:33148895-33148917 GTTTCCGTCATCAAAGGTGAGGG + Exonic
925113441 2:1355302-1355324 GTTTCGGTCATGTGAGATAAAGG - Intronic
925795811 2:7541236-7541258 GTTTATGTCTGCAAAGATGATGG - Intergenic
927699046 2:25256375-25256397 GTTTAGGTGGTGAAAGTTGAAGG - Intronic
929848811 2:45561942-45561964 GTTTAGCTCTTTAAGGATGATGG - Intronic
932255390 2:70281329-70281351 TGTTCAGTGTTGAAAGATGATGG + Intergenic
935395957 2:102609432-102609454 GTTTCATTCTAGAAAGATGGGGG + Intergenic
937274010 2:120672745-120672767 GTTTTAGTTTTGCAAGATGAAGG - Intergenic
938121676 2:128638484-128638506 ATTGCCGTCTTGAAAGAGGAAGG + Intergenic
938595524 2:132783938-132783960 GTTTCGGACTTGGTGGATGAAGG + Exonic
939510803 2:143101868-143101890 GTTTTGGTCCTGAAGGGTGAGGG + Intronic
939929716 2:148217724-148217746 GCTTTGATCATGAAAGATGATGG - Intronic
944656950 2:201885006-201885028 GAGTGGGCCTTGAAAGATGATGG + Intronic
945838973 2:214866103-214866125 GTTGCTATCTTGAAAGGTGAAGG + Intergenic
948652150 2:239454737-239454759 GTTTCTGTCTTAAAGGATGAGGG + Intergenic
1168789565 20:567218-567240 GTTTCAGACTTGACAGCTGATGG + Intergenic
1170315520 20:15036701-15036723 CTTTGGGTATAGAAAGATGATGG - Intronic
1171083932 20:22218436-22218458 GTTTCGGTTTGGGAAGATAAAGG + Intergenic
1172864541 20:38085691-38085713 CTTTGGGTCTGGAGAGATGAAGG - Intronic
1175803823 20:61816181-61816203 GTTTAGGTTTGGGAAGATGATGG - Intronic
1178725525 21:35048168-35048190 CTTTCTCTCTTGAAAGATGCTGG + Intronic
1179676105 21:42983246-42983268 GTTTCAGTTTTACAAGATGAAGG - Intronic
1179920665 21:44505512-44505534 GCTTCGGTTTTGCAGGATGAAGG - Intronic
1183773556 22:39947488-39947510 GATTCCATCTTGAAAGATGGGGG + Intronic
953738716 3:45518059-45518081 GTTTCTGACCTGAGAGATGACGG - Exonic
954274295 3:49532412-49532434 GTTTCGGTCTCCAAAGGCGAAGG - Exonic
954728838 3:52639975-52639997 GTTTAGCTCTTGAGAGAAGAGGG + Intronic
958745947 3:98134717-98134739 ATTTCAGTATTGAAAGATGAAGG - Intergenic
958747197 3:98151418-98151440 ATTTCAGTGTCGAAAGATGAAGG - Intergenic
958751657 3:98199221-98199243 ATTTCAGTGTTGAAAGATAAAGG - Intergenic
958754942 3:98240388-98240410 ATTTCAGTGATGAAAGATGAAGG - Intergenic
963025583 3:140915810-140915832 GGTTAGATCTTGAAAGAAGATGG + Intergenic
965273306 3:166647369-166647391 ATTTCCGACATGAAAGATGAGGG + Intergenic
967938832 3:194750440-194750462 GTTTCAGCCTTGCAAAATGAGGG - Intergenic
967975698 3:195033666-195033688 GATTCTGGCTTGAAAGAGGAAGG + Intergenic
969184488 4:5465293-5465315 GTTTCCATATTGTAAGATGAGGG - Intronic
969377770 4:6774343-6774365 GTTTCAGTTTTGCAAGATGAAGG + Intergenic
970691684 4:18628237-18628259 GTATCATTCTTTAAAGATGAAGG - Intergenic
974303118 4:60096033-60096055 ATTTCGCTCTTGAAAAATAATGG + Intergenic
977094395 4:92721190-92721212 ATTTCAGTTTGGAAAGATGAAGG + Intronic
980470441 4:133243563-133243585 GTTACTGTTTTGAAAGATAAAGG + Intergenic
983356713 4:166670292-166670314 TTTTCTGTGTTGAAAGATTAAGG + Intergenic
984760580 4:183359567-183359589 CTTTTGGTCAGGAAAGATGAAGG + Intergenic
985132796 4:186756262-186756284 GTTGCTGTTTTGATAGATGATGG - Intergenic
986137231 5:4992095-4992117 ATGTGGGTCTTGAAAGAAGAGGG - Intergenic
986825933 5:11522790-11522812 GTTTTTTTCTTGAACGATGAAGG + Intronic
988226873 5:28424407-28424429 GTTTCAGATTTAAAAGATGAGGG + Intergenic
995659231 5:114462431-114462453 GTTTCTGTGTTCAAGGATGAAGG + Intronic
995951252 5:117716572-117716594 GTTTCAGTTTTACAAGATGAAGG - Intergenic
997274411 5:132572622-132572644 TTTTAGGTCTTATAAGATGATGG + Intronic
998192697 5:140041074-140041096 GTATCGATCTAGAAAGATGAAGG + Intronic
999196857 5:149787367-149787389 ATTGCTGTCTGGAAAGATGATGG + Intronic
1000187882 5:158878558-158878580 GTTTCCTTGTTGAAAAATGAAGG - Intronic
1000611723 5:163382454-163382476 TTTTCTGTCTTAAAAGATGGAGG + Intergenic
1001575159 5:172758466-172758488 CTTTGGGTCTAGAAAGATAATGG - Intergenic
1010088361 6:71948893-71948915 TTTTCAGTCTTTAAAGATTAAGG + Intronic
1013179573 6:107706807-107706829 GTTACAGGCTTTAAAGATGATGG + Intronic
1015667020 6:135642965-135642987 GTTTCTGTCTTAAAACATGGTGG - Intergenic
1020457283 7:8388174-8388196 CTTTAGGACTTGAAAGTTGAAGG + Intergenic
1026024671 7:66734784-66734806 TTCTCGGTCTTCAAAAATGACGG + Intronic
1026606389 7:71819587-71819609 GTTTCAGTCTGGGAAGATGAAGG - Intronic
1026893056 7:73993676-73993698 TTCTCGGTCTTCAAAAATGACGG + Intergenic
1032110690 7:129072767-129072789 GTTTCAGTTTTGCAAGATGAGGG + Intergenic
1033157457 7:138969238-138969260 GTTTCAGCTTTGCAAGATGAAGG - Intronic
1033900871 7:146137489-146137511 ATTTAGGACTTGAAAGAAGAAGG + Intronic
1036192598 8:6684310-6684332 GTATCAGTTTTGCAAGATGAAGG + Intergenic
1051441886 9:17093526-17093548 GTTTTGGTGTTGTGAGATGATGG + Intergenic
1056706976 9:88959674-88959696 GTTTCTCTCTTGAGAAATGAAGG + Intergenic
1057207693 9:93183591-93183613 GCTTCGGTCTTGAAAGTTCTGGG + Intergenic
1057787301 9:98096612-98096634 GTTTCTGGCCTGAGAGATGAAGG - Intronic
1058628612 9:106962009-106962031 GGATCGGCCTGGAAAGATGAAGG + Intronic
1058646890 9:107139290-107139312 ATTTGGGTCTTAAAGGATGATGG + Intergenic
1058912023 9:109529764-109529786 GTTTCAGTTTTGCAAGATGAAGG - Intergenic
1060932137 9:127495949-127495971 GTTTCTGTCTTGCAGGAAGAGGG + Exonic
1186095313 X:6094835-6094857 GTTTCTGTATTGAAGCATGAAGG + Intronic
1186944759 X:14553496-14553518 CTTTCTGCCTTGATAGATGATGG + Intronic
1192015995 X:67331867-67331889 GTTCCAGTTTTGCAAGATGAAGG - Intergenic
1197572855 X:128170786-128170808 CTTCCAGTCTTCAAAGATGATGG + Intergenic
1198508521 X:137325839-137325861 AGCTGGGTCTTGAAAGATGAGGG - Intergenic
1199039532 X:143095541-143095563 GTTTCTGTTTTGAAGGATGTCGG + Intergenic
1199516560 X:148683266-148683288 GTTTCGTGCTTGCAAGATGAGGG + Intronic
1201411989 Y:13708269-13708291 GTTTCTGTTTTGTAAGATGTTGG + Intergenic