ID: 1083553755

View in Genome Browser
Species Human (GRCh38)
Location 11:63609789-63609811
Sequence TCCAGGATGTTTATGACCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 338}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083553755_1083553761 22 Left 1083553755 11:63609789-63609811 CCAAAGGTCATAAACATCCTGGA 0: 1
1: 0
2: 2
3: 14
4: 338
Right 1083553761 11:63609834-63609856 CCTCCCAGACTTTGACCACCAGG 0: 1
1: 0
2: 1
3: 15
4: 154
1083553755_1083553764 28 Left 1083553755 11:63609789-63609811 CCAAAGGTCATAAACATCCTGGA 0: 1
1: 0
2: 2
3: 14
4: 338
Right 1083553764 11:63609840-63609862 AGACTTTGACCACCAGGCCCAGG 0: 1
1: 0
2: 0
3: 29
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083553755 Original CRISPR TCCAGGATGTTTATGACCTT TGG (reversed) Intronic
901900418 1:12356932-12356954 TCCAGGATTTGTATCACATTTGG + Intronic
902279913 1:15366890-15366912 TCCTGCCTGTTTATGCCCTTTGG - Intronic
904248448 1:29205079-29205101 CCCAGGAGGTTAATGCCCTTAGG + Intronic
906534082 1:46541987-46542009 ACCATGATGTCTGTGACCTTAGG - Intergenic
907565753 1:55431556-55431578 TCTTTGATGTTGATGACCTTTGG - Intergenic
907958011 1:59249998-59250020 TCCAGGCTGATTGTGTCCTTGGG - Intergenic
908624178 1:66021428-66021450 TCTAGGATTTTTATGGCTTTAGG + Intronic
909416126 1:75407740-75407762 TCTAGGATTTTTATGGTCTTAGG - Intronic
909535895 1:76735729-76735751 TCTAGGGTTTTTATGACTTTAGG + Intergenic
909634209 1:77797203-77797225 TCCAGGTTGTTTCTGATTTTAGG + Intronic
909685533 1:78344122-78344144 TCTAGGATTTTTATGGCTTTAGG + Intronic
910453986 1:87375815-87375837 TCCAGGGTTTTTATGATTTTGGG + Intergenic
911368365 1:96967541-96967563 TTCAGAATGTTTAAGACCCTTGG + Intergenic
911690274 1:100825081-100825103 TCTAGGATTTTTATGATCCTAGG - Intergenic
911848122 1:102780412-102780434 TCTAGGGTTTTTATGACTTTAGG - Intergenic
914980639 1:152411485-152411507 ACCAGGATGATGATGGCCTTAGG - Intronic
916274422 1:162978393-162978415 TCCAGGATGTGCAAGACCCTGGG - Intergenic
916593789 1:166221980-166222002 TCCAGGATTTTTATCATTTTAGG + Intergenic
917274751 1:173319844-173319866 TCTTTGAGGTTTATGACCTTTGG - Intergenic
918165757 1:181945980-181946002 TCCAGGATTTTTATGGTTTTGGG - Intergenic
918805742 1:189040995-189041017 TCCAGGTTGTTTATGGCATTTGG + Intergenic
918936933 1:190932789-190932811 TCCAGGGTTTTTATGGCTTTAGG - Intergenic
920619337 1:207528610-207528632 TTCAGGATTATTAGGACCTTAGG - Intronic
920621119 1:207547165-207547187 TTCAGGATTATTAGGACCTTAGG - Intronic
920803729 1:209212866-209212888 CCCAGGATGATTCTGACCTTAGG + Intergenic
921431751 1:215073875-215073897 GACAGGATGTTTATGGCCCTGGG + Intronic
921664312 1:217849711-217849733 TTCAGGAAGTTTATGATCTGGGG - Intronic
921800323 1:219395729-219395751 TCCAGGATTTTTATAATTTTGGG + Intergenic
921947794 1:220898575-220898597 TCCAGGATTTTTATGGTCCTAGG + Intergenic
921954618 1:220969168-220969190 TCTAGGATTTTTATGATTTTAGG + Intergenic
1063771377 10:9206098-9206120 TGCAGGATGTTTATGTATTTAGG - Intergenic
1065108649 10:22417638-22417660 TCCAGTGTGTTGCTGACCTTGGG + Intronic
1066298005 10:34072482-34072504 TCTAGGATTTTTATGGCCCTAGG - Intergenic
1067199279 10:44152507-44152529 TCCAGGGTTTTTATGATTTTTGG - Intergenic
1067230688 10:44406818-44406840 TCTAGGATTTTTATGATTTTAGG + Intergenic
1067576736 10:47413908-47413930 TCCAGGTTGTTTTTAATCTTTGG - Intergenic
1068314767 10:55325597-55325619 TCCAGGATGTTTATAGTTTTAGG - Intronic
1068689515 10:59901654-59901676 TCCAGGCAGTTTCAGACCTTTGG - Intronic
1068815283 10:61302953-61302975 ACCAGCTTGTTTATAACCTTAGG + Intergenic
1069560155 10:69423476-69423498 TCGAGGATGCATGTGACCTTTGG + Intergenic
1071203248 10:83244816-83244838 TCGAGGATTTTTATGATTTTAGG - Intergenic
1071736625 10:88308157-88308179 TCCAGGGTGTTTATAGCGTTGGG - Intronic
1072479958 10:95801310-95801332 TCCAGGATTTTTATGGTTTTGGG + Intronic
1072920669 10:99574379-99574401 TTCAGGAGGTCTATGAACTTGGG + Intergenic
1073652381 10:105375154-105375176 TCCATCATGTTTAGGAACTTGGG - Intergenic
1079877513 11:25878191-25878213 TCTAGGGTGTTTATGGCTTTAGG + Intergenic
1080489018 11:32742767-32742789 TCCAGGATTTTTATGGTCCTAGG + Intronic
1080737146 11:35027405-35027427 TCCAGGATTTTTATGGTCCTAGG - Intergenic
1080987945 11:37493471-37493493 TCCAGGGTTTTTATGATTTTAGG + Intergenic
1081995372 11:47360236-47360258 ACCCGGATGCTTTTGACCTTGGG - Intronic
1082712304 11:56567818-56567840 TCCAGGATTTTTATAGCTTTAGG + Intergenic
1082851040 11:57765045-57765067 TCCAGGAAGTTTAAGAAATTAGG - Intronic
1083287540 11:61670008-61670030 TCCAACATGTTGGTGACCTTGGG + Intergenic
1083553755 11:63609789-63609811 TCCAGGATGTTTATGACCTTTGG - Intronic
1083778371 11:64905775-64905797 TGCAGGATGGTGATGACCGTCGG + Exonic
1084095640 11:66909337-66909359 TCCATGACGAGTATGACCTTGGG - Intronic
1084321849 11:68377647-68377669 GCCAGGCTGTTTATGGCCTTGGG + Intronic
1085353869 11:75818103-75818125 TCCAGGATGTTAATAATTTTGGG - Intronic
1086267652 11:85020572-85020594 TCCAGGATTTTTATGGTTTTAGG + Intronic
1086408025 11:86515966-86515988 TGCAGGATGTTTAGTGCCTTGGG - Intronic
1086877739 11:92117362-92117384 TCTAGGATTTTTATGGCTTTAGG - Intergenic
1087094089 11:94304003-94304025 TCCAGCATTTTTATCATCTTTGG + Intergenic
1088018956 11:105095993-105096015 GCCTGGATGATTATCACCTTGGG + Intronic
1088616391 11:111633765-111633787 TCCAGGACTTTTATGGCATTTGG + Intronic
1090606890 11:128431006-128431028 TCCAGGATGTTTCTCACACTTGG + Intergenic
1091206861 11:133827617-133827639 TGCAGGATGTATTTGACCATGGG - Intergenic
1092248138 12:6874907-6874929 GCCAGTGTGTGTATGACCTTGGG + Intronic
1093770579 12:23012997-23013019 TCCAGGATTTTCATAACTTTGGG + Intergenic
1095819005 12:46456472-46456494 TCCAAGATTTTTTTGAGCTTGGG - Intergenic
1096538768 12:52291455-52291477 TCCAGGAGGATCATGACCTGCGG - Exonic
1096748699 12:53745184-53745206 ACCAGAATGGTTTTGACCTTGGG + Intergenic
1096925592 12:55141241-55141263 TCCAGGATTTTTATAATTTTAGG - Intergenic
1098816279 12:75168403-75168425 TCCAGCTTCTTTATGGCCTTAGG - Intronic
1098918176 12:76278463-76278485 TCCAGTCTGTTCATGACCATTGG + Intergenic
1099252940 12:80280407-80280429 TCTAGGTTTTTTATGATCTTAGG + Intronic
1099489282 12:83268502-83268524 TCCAGGGTTTTTATGGCTTTAGG + Intergenic
1099502147 12:83427142-83427164 TCCAGGATTTTTATGGTTTTGGG + Intergenic
1099524234 12:83699395-83699417 TCTAGGATTTTTATGGCTTTAGG - Intergenic
1100126491 12:91433025-91433047 TGCAGAATATTTATAACCTTGGG - Intergenic
1100441200 12:94618710-94618732 TCTAGGATGTTTCTGAACTCTGG + Intronic
1101628154 12:106466563-106466585 TCTAGGATTTTTATGATCCTAGG + Intronic
1102025663 12:109713176-109713198 TCCTGGATGTTTTTGTCCTAAGG - Intergenic
1102151686 12:110692793-110692815 TCCAGGAGGTCTATTAACTTGGG + Intronic
1102345461 12:112158356-112158378 TCCTTGATGTTGGTGACCTTTGG + Intergenic
1105659417 13:22477208-22477230 TCCAGGGTTTTTATGATTTTAGG - Intergenic
1107192585 13:37607383-37607405 TCCATGGTTTTTATGACTTTAGG - Intergenic
1108577211 13:51800721-51800743 CAAAGGATGTTTATGAGCTTGGG + Intronic
1108673924 13:52720454-52720476 TCCTTGATGTTGGTGACCTTTGG + Intronic
1109106376 13:58256276-58256298 TCTAGGATTTTTATGATCCTAGG + Intergenic
1109553428 13:63936645-63936667 TCTAGGGTTTTTATGACTTTGGG + Intergenic
1110488822 13:76078722-76078744 TCTAGGATTTTTATGGCTTTGGG - Intergenic
1110543698 13:76733655-76733677 TCAAGTATGTTTATTCCCTTTGG - Intergenic
1110598382 13:77343220-77343242 TGCAGGATGTTTATCATCTGTGG - Intergenic
1112908530 13:104453849-104453871 TCCAGGGTTTTTATAACTTTGGG - Intergenic
1113387748 13:109865943-109865965 TAAAGAATCTTTATGACCTTAGG + Intergenic
1114859430 14:26496605-26496627 TCCAGGCTGTTTATGGTTTTAGG + Intronic
1114933536 14:27506061-27506083 TCCATGAAGTTGCTGACCTTTGG + Intergenic
1115365916 14:32556865-32556887 TCCAGGAGGTTTATCATTTTGGG + Intronic
1115548232 14:34482073-34482095 TCCAGGCTGCTTTTGAACTTCGG - Intergenic
1116320456 14:43455101-43455123 TCCTTGAGGTTTCTGACCTTTGG - Intergenic
1116598361 14:46884117-46884139 GCCATGTTGTTGATGACCTTAGG - Intronic
1116771351 14:49130923-49130945 TCTTTGATGTTTTTGACCTTTGG + Intergenic
1121155239 14:91677102-91677124 TCCAGGATTTTTATGGCTTTGGG - Intronic
1122779403 14:104137375-104137397 TCCGGGTCGTTGATGACCTTAGG - Intergenic
1125329547 15:38568724-38568746 TCTAGGGTGTTTATGATTTTAGG + Intergenic
1125788583 15:42344631-42344653 TCCAGAATGTTCATGAACTATGG + Intronic
1126934306 15:53689094-53689116 TCCAGGATTTTTATGGTTTTAGG - Intronic
1127218873 15:56855770-56855792 ACGAGCATCTTTATGACCTTGGG + Intronic
1127829396 15:62737211-62737233 GCCAGCATCGTTATGACCTTTGG - Intronic
1128012652 15:64312634-64312656 TCTAGGATTTTTATGGCTTTAGG - Intronic
1131917123 15:97279842-97279864 TCCAGGGTTTTTATGGCTTTAGG + Intergenic
1139717047 16:68822114-68822136 TCAATGATGTTTATGACCTGAGG - Exonic
1142524283 17:527996-528018 GACAATATGTTTATGACCTTGGG - Intronic
1143428256 17:6857940-6857962 TCCAGGATTTTTATGGTTTTAGG + Intergenic
1144641329 17:16938935-16938957 TCGAGGAAGCTTGTGACCTTGGG - Intronic
1145114603 17:20197671-20197693 TCCACCTTGTTTATGTCCTTGGG - Intronic
1147000738 17:37359849-37359871 TCCAGCATGTATAACACCTTTGG - Intronic
1148523948 17:48311558-48311580 GCCATGATATTAATGACCTTTGG - Intronic
1150100070 17:62415540-62415562 TCCAGGATATTTACTGCCTTGGG + Intronic
1153637293 18:7123681-7123703 TTCATGATGTTTATAAGCTTTGG + Intergenic
1153991781 18:10406666-10406688 GCCAGGATGTTCATGAGCCTGGG + Intergenic
1154381790 18:13858401-13858423 TCCAGGATTTTTATGGTCCTGGG + Intergenic
1155661540 18:28254341-28254363 TCCAGGGTTTTTATGGCTTTGGG - Intergenic
1156826812 18:41439741-41439763 TGCAGGATGTTTATGGGTTTGGG + Intergenic
1159844022 18:73437191-73437213 TCCTTGATTTCTATGACCTTGGG - Intergenic
1162386871 19:10365204-10365226 TCCAGCATGTGTATGATTTTGGG - Intronic
1164035133 19:21447237-21447259 TCTAGGATTTTTATGGTCTTAGG + Intronic
1164112843 19:22185357-22185379 TCTTTGATGTTGATGACCTTCGG - Intronic
1165967978 19:39600409-39600431 TCCAGGATGTTTATAGTTTTGGG - Intergenic
1167259150 19:48448514-48448536 TCCAGGATAGTTAACACCTTTGG - Intronic
926732941 2:16050836-16050858 CCCAGGCTGTTTACTACCTTTGG + Intergenic
926778665 2:16447294-16447316 ACCAGGATGATTATAACATTAGG - Intergenic
927494404 2:23542876-23542898 TCCAGGCTCTTTGTGACCTTGGG + Intronic
928194262 2:29203449-29203471 TGCAGGATCTTTATCACCATTGG + Intronic
929418320 2:41766512-41766534 TCAAGAATGTTGATGACCTCTGG - Intergenic
931213528 2:60220431-60220453 AACATGATTTTTATGACCTTTGG - Intergenic
932006812 2:67935562-67935584 TCTAGGATTTTTATGGCCCTAGG - Intergenic
933989029 2:87620226-87620248 TCTAGGATGATCATGACCTTTGG - Intergenic
935226254 2:101055519-101055541 TGGAGGTTATTTATGACCTTGGG - Intronic
936290402 2:111219193-111219215 TCCAGGATCTTTTTAACCTAAGG + Intergenic
936304814 2:111330600-111330622 TCTAGGATGATCATGACCTTTGG + Intergenic
936904175 2:117517632-117517654 TCCAGGATTGTTAAAACCTTAGG + Intergenic
937143248 2:119619578-119619600 TCTTGGATGTTGGTGACCTTCGG - Intronic
940594962 2:155779564-155779586 TTCTGGATGTTTTTGAGCTTAGG - Intergenic
940942723 2:159580946-159580968 TCTAGGATTTTTATGATTTTAGG - Intronic
942123510 2:172801644-172801666 CCCAGCAGCTTTATGACCTTGGG - Intronic
943074535 2:183178688-183178710 TCTTTGATGTTGATGACCTTTGG + Intergenic
943086930 2:183323390-183323412 TCTAGGATTTTTATGGCTTTAGG + Intergenic
943130400 2:183846854-183846876 TCTAGGATGTTAATGCCTTTAGG - Intergenic
943205089 2:184884724-184884746 TCCAGGGTTTTTATGTCTTTAGG - Intronic
943307369 2:186280279-186280301 TCCAGGATTTTTATCACTTTGGG + Intergenic
943978418 2:194512911-194512933 TACAGGATGCTTCTGAGCTTAGG - Intergenic
944455669 2:199891623-199891645 TCTAGGATTTTTATGATTTTGGG - Intergenic
944627881 2:201591095-201591117 TCCAGGGTTTTTATGATTTTAGG + Intronic
946147706 2:217743470-217743492 TCCAGGCTGTTTCTGAGGTTTGG - Intronic
948042834 2:234917394-234917416 ACCAGGATTTTAATGGCCTTAGG - Intergenic
1171943420 20:31353230-31353252 TCCAGGTGGTTTATTTCCTTTGG - Intergenic
1174990287 20:55501455-55501477 TCTAGGATTTTTATGATTTTAGG + Intergenic
1175048178 20:56126921-56126943 TCCTGCATGTTTATGGCTTTGGG - Intergenic
1175720939 20:61286926-61286948 TCCAGTATGTTTAAGACAATCGG - Intronic
1177132601 21:17276433-17276455 TCTAGGATTTTTATGATTTTAGG - Intergenic
1177309948 21:19377041-19377063 TCTAGGATTTTTATGGCTTTAGG - Intergenic
1177445059 21:21183999-21184021 ACCAGAATGTTTATTATCTTAGG + Intronic
1180724450 22:17935458-17935480 TCTAGGATTTTTATGATTTTAGG - Intronic
1181414445 22:22749262-22749284 TCAAGGATGTTCAGGAACTTGGG - Intronic
1185207811 22:49550163-49550185 TCCTGGATGCTTCTGACCCTGGG + Intronic
950619220 3:14189909-14189931 TCTAGGATGTTTATGGTCCTAGG + Intronic
953523341 3:43664410-43664432 TCTAGGATTTTTATGGCCCTAGG - Intronic
953793110 3:45963469-45963491 TCCAGGATATCTTTGACATTTGG - Intronic
954703796 3:52467563-52467585 TCCAGGCTGTTTTTCACCTTGGG - Intronic
955991646 3:64634049-64634071 ACCATGATGTGTATAACCTTGGG + Intronic
956034532 3:65076246-65076268 TCCAGGGTTTTTATGGCGTTAGG + Intergenic
956067248 3:65410077-65410099 TCCAAGGTATTTATGACTTTAGG - Intronic
956144854 3:66182364-66182386 TCCAGAACCTTTTTGACCTTTGG + Intronic
956398012 3:68846670-68846692 TCTTTGATGTTCATGACCTTTGG + Intronic
956843872 3:73164651-73164673 TGCAGGATATTTAACACCTTGGG - Intergenic
959259046 3:104051568-104051590 TCTAGGATTTTTATGGCTTTGGG - Intergenic
959482722 3:106893031-106893053 TCCAGGATTTTTATGGTTTTTGG - Intergenic
960386679 3:117028955-117028977 TCCATGTTGTTTATGTCCTTGGG + Intronic
963128829 3:141839440-141839462 TCCTGAAAGTTTATGTCCTTAGG - Intergenic
963421642 3:145068600-145068622 TCATGGATGTTTATGATCTGGGG + Intergenic
963629186 3:147712309-147712331 TCTTTGATGTTGATGACCTTTGG + Intergenic
964092492 3:152893072-152893094 TGCATTCTGTTTATGACCTTGGG - Intergenic
964134110 3:153325159-153325181 TCCAGGATTTTTATGGTTTTAGG + Intergenic
965345906 3:167549805-167549827 TCCAGGATGTTTACGGTTTTAGG + Intronic
965656883 3:170996134-170996156 TTCAGGATGCTGATGGCCTTTGG - Intergenic
967181380 3:186908686-186908708 TCTTGGATGTTGGTGACCTTCGG + Intergenic
967335033 3:188335145-188335167 TCCAGTATGTTGATGACTGTGGG + Intronic
969194870 4:5552942-5552964 TCCTGGCTGTTTGTGAACTTTGG - Intronic
970151850 4:13098256-13098278 TCCAGGATCTTTAGGCCCTCAGG - Intergenic
970461667 4:16280418-16280440 TCCTTGATGGTCATGACCTTGGG - Intergenic
971050894 4:22861401-22861423 CCCAGGAAGTGTATCACCTTGGG - Intergenic
972877182 4:43376938-43376960 TCTAGGATTTTTATGGTCTTGGG - Intergenic
974990106 4:69076894-69076916 TCTAGGATTTTTATGATTTTAGG + Intronic
975032695 4:69641506-69641528 TCCAGGCTTTTTTTGGCCTTGGG - Intronic
975381490 4:73705370-73705392 TCTAGTATCTTAATGACCTTAGG - Intergenic
975501930 4:75096115-75096137 TCTAGGATTTTTATGGTCTTAGG + Intergenic
975750662 4:77519826-77519848 TCTAGGATTTTTATGATTTTAGG + Intronic
975763413 4:77640916-77640938 GCAAGTATGTTCATGACCTTAGG + Intergenic
976580082 4:86725930-86725952 TCTAGGATTTTTATGGCTTTAGG + Intronic
977426002 4:96867888-96867910 TCCAGGGCTTTTATGGCCTTAGG - Intergenic
978663454 4:111154730-111154752 TCCAGGCTGTTTGTGACCAGGGG + Intergenic
978845393 4:113267361-113267383 TCTAGGATTTTTATGGCTTTAGG + Intronic
980741196 4:136951567-136951589 TCCAGGATCTTTATTCCCTGTGG + Intergenic
981687115 4:147467038-147467060 TCCAGGATTTTTATGGTTTTAGG + Intergenic
982625025 4:157755931-157755953 TCCAGGATTTTTATGGTCCTAGG + Intergenic
982882170 4:160733171-160733193 TCCACGAATTTTATGAGCTTGGG + Intergenic
983560132 4:169092618-169092640 TCCAAGAGGTCTCTGACCTTGGG - Intergenic
984050924 4:174864490-174864512 TTCAGTATGTATATGACCTTTGG - Intronic
984200827 4:176719527-176719549 TCCAGGATGTTTATAAACCAAGG - Intronic
985383218 4:189417709-189417731 TTAAAGATGTTGATGACCTTAGG - Intergenic
988022231 5:25635790-25635812 TCCAGGATTTTTATGGTTTTTGG + Intergenic
988672185 5:33393733-33393755 TCCAGGATTTTTATGGTTTTAGG - Intergenic
988944365 5:36180814-36180836 TAAAGGATGTTTCTGACTTTAGG + Intronic
989766131 5:45085521-45085543 TCTTTGATGTTTGTGACCTTCGG - Intergenic
989766234 5:45086846-45086868 TCTTTGATGTTTGTGACCTTCGG + Intergenic
990091924 5:52062382-52062404 TCCAGGATGTTTAGGTTCTCAGG - Intronic
992423843 5:76635161-76635183 TCCAGGATGAATATGAAATTAGG - Intronic
992852720 5:80827020-80827042 TCAAGGATGTTAATGATCCTTGG - Intronic
993540139 5:89139086-89139108 TCCAGAATGTTTATGGTTTTAGG + Intergenic
994084338 5:95742161-95742183 TCTAGGATGCTCATGACTTTAGG + Intronic
994142743 5:96360480-96360502 TCTTTGATGTTGATGACCTTTGG + Intergenic
994697360 5:103089331-103089353 TCCAGGAAGTTAATCAGCTTTGG - Intronic
995320317 5:110826046-110826068 TCCATCTTGTTTATGTCCTTGGG + Intergenic
996008595 5:118454694-118454716 TCTAGGATGTTTATTGCTTTAGG + Intergenic
997804730 5:136905851-136905873 TCCAGGATCTTTAGGCACTTGGG + Intergenic
998732633 5:145097752-145097774 TCTAGGATTTTTATGACTTTAGG + Intergenic
999564989 5:152848997-152849019 TCTAGGATGTTTATGGTTTTGGG - Intergenic
1000463848 5:161551376-161551398 TCTAGGGTTTTTATGATCTTAGG + Intronic
1000868705 5:166548018-166548040 TCCAGGGTTTTTATGGCTTTAGG + Intergenic
1000995453 5:167954018-167954040 TCAAGGATATTTATTAGCTTAGG - Intronic
1001010445 5:168093033-168093055 TCCTGGCTGTGTGTGACCTTGGG - Intronic
1002997620 6:2301871-2301893 TCTAGGATTTTTATGGCTTTAGG - Intergenic
1003639338 6:7863445-7863467 TCCAGGATTTTTGTTACCCTTGG + Intronic
1004767221 6:18743734-18743756 TCTAGGATATTTATAACCTAAGG + Intergenic
1004822683 6:19384770-19384792 TCCAGAATATTTATGACTTCAGG - Intergenic
1006217440 6:32456898-32456920 TCCAGGGTTTTTATGATTTTTGG - Intergenic
1006700801 6:35971665-35971687 TCCTAGATGTATGTGACCTTGGG - Intronic
1008050735 6:46898173-46898195 GCCAGGCTGTTTATGACCCGTGG - Intronic
1008454863 6:51697644-51697666 ACCAGGATGATTTTGCCCTTCGG - Intronic
1009335670 6:62487571-62487593 TCCAGCATGTTTTTGACCTTGGG - Intergenic
1009802123 6:68552020-68552042 TCCAGGATTTTTATGGTTTTAGG - Intergenic
1011082081 6:83500668-83500690 TCTAGGATTTTTATGATTTTAGG - Intergenic
1011289186 6:85758424-85758446 TCCAGGGTTTTTATGATTTTAGG + Intergenic
1011985276 6:93435933-93435955 TCTAGGATTTTTATGATCCTAGG - Intergenic
1011986065 6:93447612-93447634 TCCGGGATGTCCATGACATTTGG - Intergenic
1014163791 6:118200797-118200819 TGCAGGATCTTTATCATCTTGGG - Intronic
1014660344 6:124162575-124162597 TCCAGAATGTTTATGGAATTTGG + Intronic
1015433106 6:133154215-133154237 TCCTTGATGCTGATGACCTTTGG + Intergenic
1015599261 6:134896495-134896517 GCTAGTATGTTTATAACCTTTGG - Intergenic
1016375903 6:143420282-143420304 TCTTGGATGTTTGTGCCCTTTGG - Intergenic
1018963668 6:168466787-168466809 TCCAGGATGACTTTGACTTTTGG - Intronic
1020429082 7:8101149-8101171 TCTAGGATTTTTATGGCCCTAGG - Intergenic
1020566785 7:9808017-9808039 TGCAGGGTGATTATGACTTTTGG + Intergenic
1020987377 7:15153453-15153475 TCCAGAATGTTTATGATTTGGGG + Intergenic
1021771784 7:24010077-24010099 TCTAGGATTTTTATGATTTTAGG + Intergenic
1022119323 7:27292201-27292223 TCCAGGATTTTTATGGTTTTAGG + Intergenic
1024143148 7:46482132-46482154 TCTAGGATTTTTATGATTTTAGG + Intergenic
1024814420 7:53251759-53251781 TCCAAGATGGTTATTACATTTGG + Intergenic
1024825198 7:53383219-53383241 TCCAAGCTCTTTATTACCTTAGG - Intergenic
1027939873 7:84663865-84663887 TCCTGGATTTGTAAGACCTTTGG - Intergenic
1028077987 7:86538146-86538168 TCCAGGGTGTTTATGGTTTTGGG - Intergenic
1028630153 7:92925852-92925874 TCCTTGATGTTGGTGACCTTTGG + Intergenic
1028784778 7:94780096-94780118 TCCATGATCTTGAAGACCTTCGG + Intergenic
1028857994 7:95613520-95613542 TCTTGGATGTTGCTGACCTTTGG - Intergenic
1030482412 7:110120663-110120685 TCTTTGATGTTGATGACCTTTGG - Intergenic
1031062844 7:117071338-117071360 TGCAGGATGTCTAAGACATTTGG - Intronic
1032029203 7:128468373-128468395 TCCAGGATATTTACTGCCTTGGG + Intergenic
1033056156 7:138056683-138056705 TCTAGGATTTTTATGATTTTAGG + Intronic
1033596212 7:142860924-142860946 TCCTGGATATATATGGCCTTGGG - Intronic
1033802663 7:144919384-144919406 TCCAGGGTTTTTATGGCTTTAGG - Intergenic
1036097448 8:5739700-5739722 TCCAGGATATTTATGGTTTTAGG + Intergenic
1039102251 8:33953078-33953100 TCCAGGATTTTTATAATTTTGGG + Intergenic
1039145625 8:34443376-34443398 TCTAGGATTTTTATGGTCTTAGG - Intergenic
1039802219 8:40968863-40968885 TCTAGGGTTTTTATGACTTTAGG - Intergenic
1040355404 8:46612908-46612930 TCCAGGATTTTTATGGTCCTAGG - Intergenic
1041314806 8:56550143-56550165 TCCAGGATTTTTATGGTTTTAGG + Intergenic
1042381616 8:68121235-68121257 TCCATGATGTTTATAACCTTGGG - Intronic
1043343338 8:79268670-79268692 TCCAGGATTTTTATGGTTTTAGG - Intergenic
1043368166 8:79559800-79559822 TCTGTGATGTTGATGACCTTTGG + Intergenic
1043532551 8:81166652-81166674 TCTTTGATGTTGATGACCTTTGG - Intergenic
1043602282 8:81955061-81955083 TCCAGAATATTTATGACCTAGGG - Intergenic
1043736588 8:83754777-83754799 TTTAAGATGTGTATGACCTTGGG + Intergenic
1043836486 8:85053067-85053089 TCCAGGATTTTAATGATCCTAGG - Intergenic
1044168812 8:89023405-89023427 TCTAGGATTTTTATGGCTTTAGG + Intergenic
1045342130 8:101264528-101264550 TCCAGGGTGTTTATGTGGTTGGG + Intergenic
1045729390 8:105217589-105217611 TCCAGGATGTTTATAGCTTCAGG + Intronic
1045948497 8:107825198-107825220 TCTAGGGTTTTTATGATCTTCGG + Intergenic
1046034475 8:108823864-108823886 TACAGGATATTTATGGGCTTGGG + Intergenic
1050031883 9:1394373-1394395 TCTTTGATGTTGATGACCTTTGG - Intergenic
1050284431 9:4086487-4086509 TGCAGAATGTTTATTACATTGGG + Intronic
1050404942 9:5298046-5298068 TCTAGGATTTTTATGGCCCTAGG - Intergenic
1050409220 9:5344349-5344371 TCAAGTAGGTATATGACCTTAGG + Intergenic
1050943049 9:11484899-11484921 TCTTTGATGTTGATGACCTTTGG + Intergenic
1051883389 9:21863890-21863912 TCAAGTATGATTATGACCCTTGG + Exonic
1052096472 9:24390629-24390651 TCTTTGATGTTGATGACCTTTGG + Intergenic
1052486875 9:29112647-29112669 TCCAGTATGTTTTTGACAGTTGG - Intergenic
1056003412 9:82242151-82242173 TCTTGGATGTTGGTGACCTTCGG + Intergenic
1056953960 9:91067633-91067655 TGCAGGTTGTTTATGTCCCTGGG - Intergenic
1058206516 9:102115591-102115613 TTCAGGATGTTGATTACTTTTGG + Intergenic
1058493508 9:105528660-105528682 TCCAGGATTTTTATGGTTTTAGG - Intronic
1060071533 9:120553556-120553578 TCCAGGATGATGGTTACCTTTGG + Intronic
1061004728 9:127922025-127922047 TCCAGGATGTGTAGGGCGTTGGG + Exonic
1186379418 X:9042073-9042095 AGCAGGATTTTTGTGACCTTGGG + Intronic
1186822929 X:13310140-13310162 TTCAGCAAGTTTATGAACTTTGG + Intergenic
1186834804 X:13427132-13427154 TCCATGATGCTTGTGAACTTTGG + Intergenic
1187728582 X:22229852-22229874 TCTAGGATTTTTATGGCTTTAGG + Intronic
1188730581 X:33640907-33640929 TCTAGGGTTTTTATGACTTTAGG - Intergenic
1190604250 X:52124179-52124201 TCCAGGGTTTTTATGGCTTTAGG - Intergenic
1190636850 X:52443241-52443263 TCCAGGATTTTTATGTTTTTAGG + Intergenic
1190977231 X:55417280-55417302 TCCATGAGGTTGCTGACCTTTGG - Intergenic
1191087259 X:56582635-56582657 TCTAGGATTTTTATGATTTTAGG + Intergenic
1191164790 X:57377258-57377280 TCCAGGATTTTTATGGTTTTAGG + Intronic
1191788177 X:64939811-64939833 TCTAGGATTTTTATGATTTTAGG - Intronic
1191947864 X:66554781-66554803 TCTTTGATGTTGATGACCTTCGG - Intergenic
1191947870 X:66554857-66554879 TCTTTGATGTTGATGACCTTAGG - Intergenic
1191987021 X:66993051-66993073 TCCAGGGTTTTTATGGCCCTAGG + Intergenic
1192640548 X:72858134-72858156 TCTAGGATTTTTATGATTTTAGG - Intergenic
1192641163 X:72862642-72862664 TCTAGGATTTTTATGATTTTAGG + Intergenic
1192991490 X:76462987-76463009 TCTAGGATCTTTATGGTCTTGGG + Intergenic
1192999514 X:76549575-76549597 TCTTTGATGTTGATGACCTTTGG + Intergenic
1193006343 X:76622896-76622918 TCCAGGATTTTTATAATTTTGGG - Intergenic
1193090414 X:77488055-77488077 TCCAGGGTTTTTATGATTTTAGG - Intergenic
1193327389 X:80195481-80195503 TCCAGGGTTTTTATGATTTTAGG - Intergenic
1193434078 X:81450256-81450278 TCTTTGATGTTGATGACCTTCGG - Intergenic
1193593672 X:83420111-83420133 TGCTTGATGTTTCTGACCTTTGG - Intergenic
1194029861 X:88799337-88799359 TCTAGGATTTTTATAACTTTAGG + Intergenic
1194508619 X:94764693-94764715 TCCAGGGTTTTTATGGCTTTAGG + Intergenic
1194837357 X:98698259-98698281 TCTTTGATGTTGATGACCTTTGG + Intergenic
1194953978 X:100157709-100157731 TCCAGGGTGTTTGTGATTTTAGG + Intergenic
1195332587 X:103816460-103816482 TCTAGGATGTTTATGGTCCTAGG - Intergenic
1195568700 X:106375417-106375439 TCCAGGATTTTTATCATTTTGGG - Intergenic
1196553772 X:117062357-117062379 TCTAGGGTTTTTATGACTTTAGG + Intergenic
1197184102 X:123567438-123567460 TCTAGGATTTTTATGGTCTTAGG - Intergenic
1197430867 X:126361942-126361964 TCTAGGATTTTTATGGCTTTAGG + Intergenic
1197505569 X:127299436-127299458 TCCAGGGTTTTTATGATATTGGG - Intergenic
1199263621 X:145804758-145804780 TCCAGGGTTTTTATGATTTTGGG - Intergenic
1200335005 X:155341213-155341235 TCCAGGATTTTTATGGTTTTAGG + Intergenic
1200351462 X:155500008-155500030 TCCAGGATTTTTATGGTTTTAGG - Intronic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200870935 Y:8097574-8097596 TCCAGGATTTTTATGGTTTTAGG + Intergenic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1201011843 Y:9554906-9554928 TGCATAATGTATATGACCTTTGG - Intergenic
1201688698 Y:16737254-16737276 TCTTTGATGTTTGTGACCTTTGG + Intergenic
1202166944 Y:21999570-21999592 TCCAGGGTTTTTATGATTTTAGG - Intergenic
1202224416 Y:22586803-22586825 TCCAGGGTTTTTATGATTTTAGG + Intergenic
1202318698 Y:23608857-23608879 TCCAGGGTTTTTATGATTTTAGG - Intergenic
1202552069 Y:26061200-26061222 TCCAGGGTTTTTATGATTTTAGG + Intergenic