ID: 1083554371

View in Genome Browser
Species Human (GRCh38)
Location 11:63614208-63614230
Sequence ACTTTCTCGCCGGGGCCCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083554363_1083554371 -3 Left 1083554363 11:63614188-63614210 CCACCTCGCTCCCTTTAACAACT 0: 1
1: 0
2: 1
3: 4
4: 114
Right 1083554371 11:63614208-63614230 ACTTTCTCGCCGGGGCCCGGCGG 0: 1
1: 0
2: 0
3: 9
4: 150
1083554364_1083554371 -6 Left 1083554364 11:63614191-63614213 CCTCGCTCCCTTTAACAACTTTC 0: 1
1: 0
2: 1
3: 7
4: 123
Right 1083554371 11:63614208-63614230 ACTTTCTCGCCGGGGCCCGGCGG 0: 1
1: 0
2: 0
3: 9
4: 150
1083554360_1083554371 9 Left 1083554360 11:63614176-63614198 CCCCAGGAACAACCACCTCGCTC 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1083554371 11:63614208-63614230 ACTTTCTCGCCGGGGCCCGGCGG 0: 1
1: 0
2: 0
3: 9
4: 150
1083554361_1083554371 8 Left 1083554361 11:63614177-63614199 CCCAGGAACAACCACCTCGCTCC 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1083554371 11:63614208-63614230 ACTTTCTCGCCGGGGCCCGGCGG 0: 1
1: 0
2: 0
3: 9
4: 150
1083554359_1083554371 16 Left 1083554359 11:63614169-63614191 CCTCGGACCCCAGGAACAACCAC 0: 1
1: 0
2: 1
3: 16
4: 169
Right 1083554371 11:63614208-63614230 ACTTTCTCGCCGGGGCCCGGCGG 0: 1
1: 0
2: 0
3: 9
4: 150
1083554362_1083554371 7 Left 1083554362 11:63614178-63614200 CCAGGAACAACCACCTCGCTCCC 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1083554371 11:63614208-63614230 ACTTTCTCGCCGGGGCCCGGCGG 0: 1
1: 0
2: 0
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083554371 Original CRISPR ACTTTCTCGCCGGGGCCCGG CGG Exonic
900297357 1:1958520-1958542 AATTACTCGGCGGGGGCCGGGGG + Intronic
903737621 1:25540254-25540276 ACTATCTCGCTGGGGTCCTGTGG + Intergenic
903838877 1:26224390-26224412 ACTATCTCGGCCGGGCGCGGTGG - Intergenic
905058723 1:35121262-35121284 AGTTTCTCGGCCGGGCGCGGTGG + Intergenic
905584414 1:39105588-39105610 GCCTTCTCGCCGAGCCCCGGGGG - Intronic
910995956 1:93104867-93104889 ACATTCTCGGCCGGGCGCGGTGG + Intronic
912104673 1:106257350-106257372 CATTTCTCGCCGGGGCACAGTGG - Intergenic
912795315 1:112689638-112689660 ACTCACTCACCGGGGCCCAGTGG - Exonic
916336595 1:163677830-163677852 ACCTTCTCGGCCGGGCCCGGTGG - Intergenic
917564847 1:176203048-176203070 ACCTTCTCGGCCGGGCGCGGTGG + Intronic
922250874 1:223847169-223847191 ACGTTCTCGCCCGGGCGCAGTGG + Intergenic
923184701 1:231559613-231559635 ACTTTCTGGCCGGGCGCCGGTGG - Intronic
1063454632 10:6174520-6174542 GCTTTCTCGGCGGGGGCCGCAGG - Intronic
1065788407 10:29237542-29237564 ACTTTGTCACCAGGGCCCTGTGG + Intergenic
1066101454 10:32122022-32122044 ACTTTCTCTTTGGGGCCCTGAGG - Intergenic
1068081322 10:52321777-52321799 ACTTTTTCGGCCGGGCGCGGTGG + Intergenic
1072075906 10:91973615-91973637 ACTTTCCCGGCCGGGCGCGGTGG + Intronic
1074244328 10:111672526-111672548 ATTTTCTCGGCCGGGCGCGGTGG - Intergenic
1075802930 10:125163709-125163731 ACTTTCTCGGCCGGGCACAGTGG - Intergenic
1078246163 11:9574342-9574364 TCTTTCTCGCCGGTGCGCTGCGG + Exonic
1081297582 11:41410725-41410747 ACTTTCTCGGCCAGGCGCGGTGG - Intronic
1083554371 11:63614208-63614230 ACTTTCTCGCCGGGGCCCGGCGG + Exonic
1083941973 11:65900652-65900674 ACTTCCTCGCCGCGCCCAGGTGG + Intergenic
1089848113 11:121474309-121474331 AGTGTCTTGCCGGGGCCAGGGGG + Intronic
1092820321 12:12347769-12347791 AAATTCTCGCCTGGGCGCGGTGG + Intronic
1094421653 12:30277589-30277611 ACTTTCTCAGCCGGGCACGGTGG - Intergenic
1095590701 12:43900430-43900452 ACATTCTCGGCTGGGCACGGTGG + Intronic
1096698421 12:53366020-53366042 AGTTTCTGGCCTGGGCGCGGTGG - Intergenic
1097593685 12:61602010-61602032 AATTTCTGGCCGGGGCACAGTGG - Intergenic
1100314494 12:93431944-93431966 ACTTCCTCGGCTGGGCGCGGTGG + Intronic
1100592008 12:96037975-96037997 TCTTTCTCGGCCGGGCGCGGTGG - Intronic
1102536796 12:113587850-113587872 CCTTTCTCGCTGGGGCTCAGCGG - Intergenic
1103236063 12:119373647-119373669 ACTTTCTCTCCGGGGTGGGGTGG + Intronic
1104196865 12:126548605-126548627 ACTTTCTAGGCCGGGCGCGGTGG - Intergenic
1105936280 13:25102665-25102687 ACTTTCTTGGCCGGGCGCGGTGG + Intergenic
1107255849 13:38426073-38426095 ACTTTCTTGGCCGGGCGCGGTGG - Intergenic
1108101993 13:46966670-46966692 TCTTTCTCGGCCGGGCGCGGTGG + Intergenic
1112173174 13:96994408-96994430 ACTTGCTCGCTGGGCCTCGGAGG - Intronic
1114190286 14:20435497-20435519 AGTTTTTCGCCGAGGCCCAGCGG - Exonic
1117426021 14:55598146-55598168 GCTTTCTCGGCAGGGCGCGGTGG + Intronic
1120528928 14:85609187-85609209 ACTTTCTCACAGGGCCCTGGAGG - Intronic
1121017777 14:90558837-90558859 ACTTTCTCCCCAGGGCCCCCAGG + Intronic
1121634921 14:95447421-95447443 ACTTTCTTGGCTGGGCACGGTGG - Intronic
1122277175 14:100598259-100598281 ACTTTCTCAGCTGGGCACGGTGG - Intergenic
1125033383 15:35095374-35095396 ACTTTCTGGGCTGGGCACGGTGG + Intergenic
1125180572 15:36878203-36878225 ACTTTCTCGCCGGCGGACGTGGG + Intergenic
1128255326 15:66191786-66191808 ACCTACTAGGCGGGGCCCGGTGG + Intronic
1130564615 15:84982406-84982428 ACTTTCCCGCAGGGGCCGGGCGG + Intronic
1133303326 16:4796002-4796024 GCTTTCCCTGCGGGGCCCGGGGG - Exonic
1134185641 16:12083014-12083036 ATTTTCTCGGCCGGGCACGGTGG + Intronic
1134653413 16:15928454-15928476 ACTTTCCTGGTGGGGCCCGGTGG + Intergenic
1138427907 16:56948530-56948552 CCTTTCTCTCTGGGGCCTGGTGG - Intergenic
1139769248 16:69259895-69259917 ACTTTCTTGGCTGGGCACGGTGG - Intronic
1140075832 16:71698132-71698154 ACTTTCTGGGCCGGGCGCGGTGG - Intronic
1140172570 16:72622105-72622127 ACTTTCTTGGCTGGGCCTGGTGG - Intergenic
1147437843 17:40428696-40428718 TCTTTCTCGGCCGGGCGCGGTGG - Intergenic
1147667779 17:42159734-42159756 ACTTTCTCCCCAGGACCTGGAGG - Exonic
1148872368 17:50666182-50666204 ACTTCCTCGGCTGGGCACGGTGG + Intronic
1151166830 17:72211122-72211144 ACTTTTTCGGCCGGGCGCGGTGG - Intergenic
1151645919 17:75431650-75431672 ACTTTCTCGGCCGGGCGCGGTGG + Intergenic
1151672152 17:75576974-75576996 ACATTCTCGGCCGGGCACGGTGG + Intergenic
1151728595 17:75898192-75898214 ACTCTCTCTCCAGGGGCCGGTGG + Intergenic
1151804162 17:76395477-76395499 ACTTTCTCGGCCGGGCGCAGTGG - Intronic
1152036770 17:77878195-77878217 ACTTTCTGCCAGGGGCCTGGAGG - Intergenic
1153666706 18:7372731-7372753 ACTTTCTGGCCTGGACCCGTAGG - Intergenic
1161130537 19:2585985-2586007 ACATTTTGGCCGGGGCACGGCGG - Intronic
1161810920 19:6470943-6470965 ACTTTGTTGCCTGGGCACGGTGG - Intronic
1162963131 19:14140322-14140344 ACTTTCTTGGCCGGGCGCGGTGG + Intergenic
1163509504 19:17726642-17726664 ACCTTCTCGCCGGGGCCGGCGGG - Exonic
1168031379 19:53682684-53682706 AGTTTCTCGGCCGGGCGCGGTGG - Intergenic
1168085019 19:54039198-54039220 ACTTTCTGGGCTGGGCACGGTGG + Intergenic
1168420288 19:56197521-56197543 ACTTTCTCGGTCGGGCCCAGTGG - Intronic
930641335 2:53857252-53857274 TCTTTCTCGGCCGGGCGCGGTGG - Intronic
935645425 2:105329949-105329971 ACGCTCTCGCCCGGGGCCGGCGG - Exonic
936631371 2:114206594-114206616 TCTTTCTCGGCTGGGCACGGTGG - Intergenic
940830149 2:158457304-158457326 ACCTGCGCGCCGGGGGCCGGGGG + Intronic
940845025 2:158631225-158631247 ACTTTCTCTGCCGGGCGCGGTGG - Intronic
942721409 2:178957158-178957180 GCTTTCTCGGCCAGGCCCGGTGG - Intronic
943581683 2:189691341-189691363 ATTTTCTCTCCCGGGCGCGGCGG - Intronic
943980797 2:194547886-194547908 ACTTTCTCGGCCGGGCGCGGTGG - Intergenic
945130912 2:206571186-206571208 GCTTTCTCGGCCGGGCGCGGTGG + Intronic
945153877 2:206817126-206817148 ATTTTCTCGGCTGGGCACGGTGG + Intergenic
1169224648 20:3848384-3848406 CCTTTCTCGGCCGGGCGCGGTGG - Intronic
1173346186 20:42202255-42202277 ACTTTCTCGGCTGGGCACGGTGG - Intronic
1173968300 20:47130550-47130572 ACCTTCTCGGCCGGGCGCGGTGG - Intronic
1179907435 21:44430714-44430736 ACTTGCTCGGCCGGGCGCGGTGG - Intronic
1182672965 22:32013082-32013104 ACTTTGTCGGCCGGGCACGGTGG - Intergenic
1184683391 22:46085087-46085109 ATTTCCTCTCCGGGGCCCGCAGG - Intronic
1185034653 22:48466323-48466345 AGTTTCTCGGCCGGGCGCGGTGG - Intergenic
952913334 3:38209907-38209929 ACTTCTTGGCCGGGGCACGGTGG - Intronic
953125026 3:40083848-40083870 ACATTCTCGGCCGGGCGCGGTGG + Intronic
954717787 3:52534920-52534942 ACTTGCTCACTGGGGCCCTGGGG - Intronic
957199385 3:77112529-77112551 TCTTTCTCGGCAGGGCGCGGTGG - Intronic
961413053 3:126737031-126737053 ACTTTCTTGGCTGGGCGCGGTGG + Intronic
961833903 3:129640724-129640746 ACTTTCTCGGCCGGGCGCGGTGG - Intergenic
961860195 3:129910933-129910955 AATTTCTCGGCTGGGCCCAGTGG + Intergenic
963078719 3:141371628-141371650 TGTTTCTCGGCTGGGCCCGGTGG - Intronic
968235280 3:197027576-197027598 ACCTCCTGGCCTGGGCCCGGCGG + Intronic
969713747 4:8858776-8858798 TCATTCTCGACGGGGCCCAGTGG - Intronic
972014008 4:34221315-34221337 ACCTTCTCGGCCGGGCGCGGTGG + Intergenic
978397819 4:108300741-108300763 ACTTTCTCGGCTGGGCACAGTGG + Intergenic
982344396 4:154341079-154341101 ACGTTTTCGCCCGGGCGCGGTGG + Intronic
983078041 4:163349827-163349849 ACTTTCTGGGCTGGGCACGGTGG + Intronic
983212984 4:164977576-164977598 CCTTCCTCGCGGGGGCTCGGTGG - Exonic
987056803 5:14200969-14200991 ACATTCTCGGCTGGGCGCGGTGG + Intronic
991669900 5:69037400-69037422 ACTTTCTCGGCCAGGCGCGGTGG + Intergenic
991987795 5:72308071-72308093 ACGTTCGCGCCGGGGCCCTCTGG + Intronic
995374265 5:111456212-111456234 AATTTCTCGGCCGGGCGCGGTGG + Intronic
998551773 5:143084756-143084778 ACTTTCTCCGCTGGGCGCGGTGG + Intronic
998947490 5:147355385-147355407 ACCTTCTCGGCCGGGCGCGGTGG + Intronic
1000386860 5:160682750-160682772 GCTTTCTCGGCCGGGCGCGGTGG + Intronic
1002161119 5:177314612-177314634 ATTTTCTCACAGGGGCCCAGGGG - Intergenic
1002565356 5:180110105-180110127 GCATTCTCCCCGGGGCCCTGGGG + Intronic
1003930134 6:10916700-10916722 ACTTTCTAGCCGAGGCGTGGTGG + Intronic
1004660648 6:17706471-17706493 ACTTTTGGGCCGGGGCCGGGCGG - Exonic
1005197113 6:23300442-23300464 ATTTTCTCGGCCGGGCGCGGTGG - Intergenic
1005206387 6:23410140-23410162 ATTTTCTCGGCCGGGCGCGGTGG - Intergenic
1005484071 6:26282895-26282917 ACGTTCTCGACTGGGCGCGGTGG + Intergenic
1006216298 6:32446138-32446160 AGTTTCTCGGCTGGGCACGGTGG + Intergenic
1007038159 6:38697198-38697220 ACTTTCTGGGCCAGGCCCGGTGG - Intronic
1008215413 6:48782453-48782475 TCTTTGGCGCCGGGGCCAGGGGG + Intergenic
1011106274 6:83785185-83785207 AGTTTCTCGGCTGGGCGCGGTGG - Intergenic
1013532088 6:111029542-111029564 CCTTTCTCGGCCGGGCGCGGTGG + Intergenic
1014787147 6:125632219-125632241 ATTTTCTGGGCGGGGCACGGTGG + Intergenic
1014789256 6:125653133-125653155 ATTATCTCACCGGGGCACGGCGG - Intergenic
1017896611 6:158685529-158685551 ACTTTTTTGACCGGGCCCGGTGG + Intronic
1019867653 7:3727776-3727798 AATTTCTCGGCCGGGCGCGGTGG - Intronic
1021670096 7:23026993-23027015 ACTATCTCGGCTGGGCACGGTGG + Intergenic
1024155855 7:46624421-46624443 ACTTTCTAGGCTGGGCGCGGTGG - Intergenic
1031362940 7:120868647-120868669 ACTTTCTAGGCAGGGCGCGGTGG + Intergenic
1033020590 7:137720543-137720565 ACTTTTTCGGCCGGGCGCGGTGG - Intronic
1034985902 7:155515303-155515325 AGTTCCTGGCCGGGGCCGGGGGG - Intronic
1037141883 8:15530070-15530092 ACTTTTTCGGCCGGGCGCGGTGG - Intronic
1037253178 8:16920657-16920679 ACTCTCTCGGCCGGGCACGGTGG - Intergenic
1037742106 8:21616280-21616302 GCTTTCTCGCTGGGGCCTGCAGG - Intergenic
1040469921 8:47728612-47728634 ACTTTCTCTTCCGGGCCAGGGGG + Intronic
1044242491 8:89902841-89902863 ACTTCCTCGCCGGGGATGGGAGG + Intronic
1046170679 8:110501298-110501320 AATTTCTCGGCCGGGCGCGGTGG + Intergenic
1047741134 8:127808053-127808075 ACTGTCTCAGCCGGGCCCGGTGG - Intergenic
1049807764 8:144548599-144548621 CCTTCCTCGCTGGGGCCCTGTGG + Intronic
1050304989 9:4298249-4298271 ACTGGCTCGGCGGGGACCGGGGG - Intronic
1051289736 9:15533116-15533138 TCTTTCTGGCCGGGGCGCGGTGG - Intergenic
1052799623 9:32955890-32955912 GCTTTCTCCCCGGCGCCCGCAGG - Intergenic
1053826113 9:42026307-42026329 TCTTTCTCGGCCGGGCACGGTGG + Intronic
1053867439 9:42454729-42454751 CCTTTCTCGGCCGGGCGCGGTGG + Intergenic
1054604450 9:67161089-67161111 TCTTTCTCGGCCGGGCACGGTGG - Intergenic
1055074919 9:72204100-72204122 ACTTGCTCGGCCGGGCGCGGTGG - Intronic
1055563907 9:77549219-77549241 ACTTTCTTGGCTGGGCACGGTGG - Intronic
1056069682 9:82973367-82973389 ACTTTCTCGGCCGGGCGTGGTGG - Intergenic
1056606973 9:88093832-88093854 ACATTCTCGGCCGGGCACGGTGG - Intergenic
1058436063 9:104964741-104964763 AATTTCTCGGCCGGGCGCGGTGG + Intergenic
1061051541 9:128199078-128199100 TCTTTCTCGGCTGGGCACGGTGG + Intronic
1062022452 9:134326026-134326048 ACTTGCGCGCAAGGGCCCGGAGG - Intronic
1185647012 X:1623173-1623195 ACCTTCTCGCCGAGGCCCCAGGG + Exonic
1186252439 X:7682827-7682849 ACTTTATCGGCCGGGCACGGTGG + Intergenic
1196802231 X:119554155-119554177 ACATTCTCGGCCGGGCACGGTGG + Intronic
1196817718 X:119678231-119678253 ACTGTCTCGGCCGGGCGCGGTGG + Intronic
1197781556 X:130165452-130165474 AGTTTCTCGCGGGGACGCGGGGG + Intronic
1198589023 X:138155344-138155366 ACTTCCTCGGCCGGGCGCGGTGG - Intergenic
1199424109 X:147681538-147681560 ACTATCTCGCAGGGGCCCTCAGG + Intergenic