ID: 1083555201

View in Genome Browser
Species Human (GRCh38)
Location 11:63620588-63620610
Sequence CCTCCTTATCACAAGAGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083555201_1083555204 9 Left 1083555201 11:63620588-63620610 CCATTCCTCTTGTGATAAGGAGG No data
Right 1083555204 11:63620620-63620642 ATTTTTTTTTTTTTTTGAGACGG 0: 3384
1: 98629
2: 69896
3: 85742
4: 127980

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083555201 Original CRISPR CCTCCTTATCACAAGAGGAA TGG (reversed) Intergenic
No off target data available for this crispr