ID: 1083560757

View in Genome Browser
Species Human (GRCh38)
Location 11:63671346-63671368
Sequence CCTTCAAAGCAGAAGCAGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 265}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083560751_1083560757 9 Left 1083560751 11:63671314-63671336 CCACTCGCTGAGGGGACAACATG 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1083560757 11:63671346-63671368 CCTTCAAAGCAGAAGCAGCAGGG 0: 1
1: 0
2: 1
3: 30
4: 265
1083560747_1083560757 28 Left 1083560747 11:63671295-63671317 CCTCTTGAGGCAGCTGCTGCCAC 0: 1
1: 0
2: 2
3: 32
4: 296
Right 1083560757 11:63671346-63671368 CCTTCAAAGCAGAAGCAGCAGGG 0: 1
1: 0
2: 1
3: 30
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083560757 Original CRISPR CCTTCAAAGCAGAAGCAGCA GGG Exonic
900353162 1:2246892-2246914 CCCAGAAAGCAGAAGCAGCCTGG - Intronic
900393163 1:2442643-2442665 CCTTGGGTGCAGAAGCAGCATGG + Intronic
901242153 1:7701714-7701736 CCTTTAAAGCAGATACAGCCGGG - Intronic
901823196 1:11843466-11843488 CCTTGAAAGAAAGAGCAGCAGGG - Intergenic
902852442 1:19170815-19170837 CCTTCCAAGGAGAAACTGCAAGG - Exonic
903664608 1:24998672-24998694 CCTTCAAAGGAGCAACAGAAAGG - Intergenic
903782613 1:25831174-25831196 CCTTCAAAGCAAAAACAAGAGGG - Intronic
903958697 1:27042615-27042637 CCTTAAAATTGGAAGCAGCAGGG - Intergenic
905306858 1:37025620-37025642 TCTGCAAAGCAGATGCAGAAAGG + Intronic
905654743 1:39678828-39678850 CCTTCTAAGCAGCAGTAGAAAGG - Exonic
906683914 1:47750393-47750415 CTGTCAGAGCAGAAGCTGCAAGG - Intergenic
906696009 1:47823935-47823957 CCTTCCAAACAGAGGGAGCAAGG - Intronic
906966478 1:50462157-50462179 GATACAAAGCAGAATCAGCAAGG - Intronic
907416933 1:54320995-54321017 CCTAGCAAGCAAAAGCAGCAAGG + Intronic
908074191 1:60496179-60496201 CCTTCTAAGGAGAAACAGGAAGG - Intergenic
910973659 1:92883100-92883122 TCTCTAAAGCAGCAGCAGCAAGG - Intronic
911191831 1:94956070-94956092 CCTCCAAGGGAGAAGCAGCAAGG + Intergenic
911680557 1:100710635-100710657 CCTGCAAAGCAGAAGAAGGCAGG - Intergenic
912214712 1:107595339-107595361 CCTTGAAAGCAGAAACTGAAAGG - Intronic
913212850 1:116595755-116595777 CCTTAAATACAGAAGCAGTAAGG - Intronic
913448015 1:118970519-118970541 CTTTCCAAGCAGCAGCAGGAAGG + Intronic
914985275 1:152451055-152451077 CCCCCAGAGCAGAAGCAGAAGGG + Intergenic
915038935 1:152951577-152951599 GATTCAAAGAAGAATCAGCAAGG - Intergenic
915704632 1:157832313-157832335 GCTTCAAAGTAGCAGCAGCCTGG + Intronic
915713162 1:157920408-157920430 CCTTCAGAGCTGAAGGAGCAAGG - Intergenic
918525178 1:185456873-185456895 CCTTCCAGGCAGAGGGAGCAGGG - Intergenic
918589943 1:186229874-186229896 CCTTTAAAGAAGAAGCATCAAGG - Intergenic
920831059 1:209466169-209466191 CTTTCAAAGGAGAAACAGAATGG + Intergenic
923663672 1:235980115-235980137 CCTCCCCAGCAGAAGCAACACGG - Intronic
924091051 1:240501253-240501275 ACTTCAAAGCAGAAAGATCAGGG + Intronic
924325973 1:242894135-242894157 CCTTATAAGGAGAGGCAGCAAGG + Intergenic
924458113 1:244234298-244234320 CCTCCAAAGCAAAATCACCAAGG + Intergenic
1063843898 10:10103700-10103722 GCTTCAAATCAGTAGCATCAGGG + Intergenic
1064602214 10:17005522-17005544 TTTTCTAAGTAGAAGCAGCAAGG - Intronic
1064677846 10:17779783-17779805 AGTGCAAAGCAGATGCAGCAAGG - Intronic
1066750676 10:38653246-38653268 CCTTCATACCTGAATCAGCATGG - Intergenic
1066966369 10:42269867-42269889 CCTTCATACCTGAATCAGCATGG + Intergenic
1067102805 10:43345040-43345062 GCTTCAAAGCAGGAGGAGCGAGG - Intergenic
1069664345 10:70145034-70145056 CTTTCAGAGGAGAAGCAGCAGGG + Intronic
1069745948 10:70715179-70715201 CCTTAAAAGCAGCAGCATCTGGG - Intronic
1070131179 10:73656358-73656380 CTTTCAAAGTGGCAGCAGCAGGG + Intronic
1070993506 10:80754151-80754173 CCTTCCAACAAGGAGCAGCAGGG - Intergenic
1073172256 10:101520346-101520368 CATTAAAAACAGAAGCAGCCAGG - Intronic
1074420690 10:113306402-113306424 CCTCCAGAGCAAAAGCAGAAAGG - Intergenic
1074485157 10:113869551-113869573 CCTACAAAGAGGAAGCAGGAAGG - Intronic
1075616282 10:123892526-123892548 CCTGGAGAGCAGAAGCCGCAGGG - Intronic
1076505244 10:130968367-130968389 CCTTCAATTCAGAATGAGCAAGG - Intergenic
1079842191 11:25417385-25417407 CCTTCTTGGCAGAAGAAGCATGG + Intergenic
1080147093 11:28999364-28999386 CCTTCAAAACAGAAGTGACAAGG + Intergenic
1081778102 11:45690870-45690892 CATTCTTAGCAGAAGCATCAAGG + Intergenic
1082023546 11:47554145-47554167 GCTTCCAAGCAGAAGCCTCAAGG + Intronic
1082960433 11:58914181-58914203 TGTTAAAAGCAGAAACAGCATGG - Intronic
1082980373 11:59115338-59115360 TGTTAAAAGCAGAAACAGCATGG - Intronic
1083160571 11:60851724-60851746 CTTCCAAGGCAGAAGCAGCAGGG - Exonic
1083560757 11:63671346-63671368 CCTTCAAAGCAGAAGCAGCAGGG + Exonic
1084230118 11:67746134-67746156 CCCCCAAAGCAGGAGCAGCTGGG - Intergenic
1084733619 11:71090387-71090409 CCCTGAATGTAGAAGCAGCAGGG - Intronic
1086289155 11:85286445-85286467 CCTTCTCAGCAGATGGAGCAAGG - Intronic
1086420618 11:86633927-86633949 CCGTCATGGCAGAATCAGCATGG - Intronic
1088576619 11:111278313-111278335 CCAACAACTCAGAAGCAGCATGG - Intronic
1089007560 11:115105275-115105297 CCCTCAAAGCAGGTGCAGCTGGG - Intergenic
1089130796 11:116210387-116210409 CCTCCATAACAGATGCAGCAGGG - Intergenic
1089299503 11:117490091-117490113 CCCTCAAAGAGGAAGCACCACGG + Intronic
1089309321 11:117547450-117547472 CCTTCAGGGCAGGAGCAGAAGGG - Intronic
1090251310 11:125253814-125253836 CCTTCATCGCAGGAGCAGCCAGG + Intronic
1092669261 12:10843968-10843990 CATTCAAAAAAGAAGCAGAAAGG - Intronic
1092783076 12:12005206-12005228 ACTTGAAAGCAGAAGGATCATGG - Intergenic
1092890046 12:12960888-12960910 AGATCAAAGCAGAAGCTGCAAGG - Intergenic
1094828627 12:34289724-34289746 CCTTCAAAGCAGCCCCTGCATGG - Intergenic
1098433973 12:70449651-70449673 ACTTCAAAGCAGTCGCATCAGGG + Intergenic
1098529835 12:71529303-71529325 CAATCATGGCAGAAGCAGCAAGG + Intronic
1099272996 12:80536635-80536657 CCTTAAGAGCAGAAGGAGAAAGG + Intronic
1101208466 12:102512766-102512788 CCTTCTAAACAGAAGGGGCAAGG + Intergenic
1101943254 12:109116496-109116518 CCTTCAAAGCAGCAACAACCCGG - Intergenic
1102925036 12:116820059-116820081 CCTTAAAAGCAAAAGAAACAAGG - Intronic
1102946878 12:116997624-116997646 CAGTCCAAGCAGAGGCAGCAGGG + Intronic
1103376205 12:120457986-120458008 CATTCAAAGCAGGAGGAGCATGG + Intronic
1103524913 12:121561133-121561155 CCTTCAAAGCAGGGGCCACAGGG - Intronic
1103783597 12:123415753-123415775 CCTTCAAAGCAGACTGAGGAGGG - Exonic
1103884115 12:124188203-124188225 CCTTGAGAACAGAAACAGCACGG + Intronic
1104385731 12:128350257-128350279 ACCTCAACGCAAAAGCAGCAGGG - Intronic
1104793244 12:131497428-131497450 CCTTCAAGGCTGAAGCAGGGGGG - Intergenic
1104934709 12:132358260-132358282 CCCTCAGAGCAGCAACAGCAAGG + Intergenic
1105048109 12:133023803-133023825 CAATCAAGGCAGAAGCCGCATGG - Exonic
1106525762 13:30539997-30540019 ACTCTAATGCAGAAGCAGCAGGG - Intronic
1107532298 13:41295044-41295066 CCTGCAAATCACATGCAGCAAGG - Intergenic
1107692235 13:42965466-42965488 CCCTCAAAGCAGGATCTGCAAGG + Intronic
1108120982 13:47186656-47186678 CCTTCAAAACAGAGTCAGCGGGG + Intergenic
1109600965 13:64627934-64627956 CCTGCAAAGCAGCAGAAGCTAGG + Intergenic
1110281579 13:73699768-73699790 TTTTAAAGGCAGAAGCAGCAGGG + Intronic
1110352859 13:74530004-74530026 TCTTCAATGCAGAAGTAGCCTGG + Intergenic
1111379611 13:87430813-87430835 CCTGCAAAACAGAAGCACCCTGG + Intergenic
1111800632 13:92975439-92975461 CCATCACAGCAGCTGCAGCAGGG - Intergenic
1113019476 13:105867822-105867844 GCTTCAAAACAGAAACAGCAAGG - Intergenic
1113339021 13:109404299-109404321 CCATCACAGCAGTTGCAGCAGGG + Intergenic
1115047712 14:29016876-29016898 CCTTCAAGGAAGAAGCAGCCGGG + Intergenic
1115398789 14:32936787-32936809 CCCTCAAGGCAGGAGCACCAGGG + Intronic
1117102711 14:52366711-52366733 CCTGCCAAGCAAAAGTAGCAGGG + Intergenic
1117140752 14:52789188-52789210 ACTTCAAAACAGTGGCAGCAGGG - Intronic
1119430222 14:74562583-74562605 CCTTAAAAGAAAAATCAGCAAGG + Intronic
1121005927 14:90490701-90490723 CCTTCACTGGAGAGGCAGCAAGG + Intergenic
1122939123 14:104973428-104973450 CCTGCCAAGCAGCAGGAGCAGGG + Intronic
1123989035 15:25669582-25669604 CTCTCGAAGCAGAAGCACCAAGG - Intergenic
1124041732 15:26111640-26111662 CCTACAAAGCCGCAGCAGCCAGG - Intergenic
1124233909 15:27970426-27970448 ACTTCACAGCACATGCAGCATGG + Intronic
1127394214 15:58530418-58530440 CCTGCAAACCAGGAGCAGCCAGG + Intronic
1127486354 15:59421351-59421373 CCTTTAAAGCAGAGCCATCATGG - Intronic
1127729894 15:61790035-61790057 CATTCACAGAAGAATCAGCAGGG - Intergenic
1127963806 15:63909018-63909040 CCATCAAAGAAGAAGGGGCATGG - Intronic
1128703592 15:69822042-69822064 CCTACAAAGCAGCAGAAGCCAGG - Intergenic
1129703072 15:77779053-77779075 CATTCAAAGCAGAGGAAACAGGG - Intronic
1129897487 15:79119182-79119204 GCTTCAAAGGAGAAGCACGAGGG - Intergenic
1130610844 15:85359562-85359584 TGTTCAAAGCCCAAGCAGCAGGG - Intergenic
1130811896 15:87388160-87388182 CCTTCACACCAGCAGCAGGAAGG + Intergenic
1131135108 15:89928406-89928428 CCCTCAAAGCAGAAATACCAGGG + Intergenic
1136732047 16:32423839-32423861 CCTTCATACCTGAATCAGCATGG + Intergenic
1138315479 16:56066035-56066057 CCCTAAAAGCAGCAGGAGCATGG + Intergenic
1139197783 16:64940993-64941015 TCTTCAAAGGAGAAGCCGAAAGG + Intergenic
1139217753 16:65145708-65145730 ACTTCTGAGCAGAAGCAGCCTGG - Intergenic
1139236578 16:65345825-65345847 CCTTGAAGACAGAAGAAGCATGG - Intergenic
1140054548 16:71514562-71514584 CCTTGAATGCAGATGCAGAAAGG - Intronic
1141115681 16:81307036-81307058 ACTTGAAAGCAGAAGCCGGAAGG - Intergenic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1141818636 16:86430241-86430263 CCTGCAAAACATAAACAGCAGGG + Intergenic
1142259976 16:89038132-89038154 CCTAAAAAGTAGAAGCAGAAAGG + Intergenic
1202994347 16_KI270728v1_random:93405-93427 CCTTCATACCTGAATCAGCATGG - Intergenic
1203021034 16_KI270728v1_random:405747-405769 CCTTCATACCTGAATCAGCATGG - Intergenic
1203039369 16_KI270728v1_random:678905-678927 CCTTCATACCTGAATCAGCATGG - Intergenic
1147638262 17:41977260-41977282 CCTTCAAAGCTGAAGCCGCCAGG + Exonic
1148123770 17:45226484-45226506 CCTCCAAAGAAGGAGCAGCCGGG - Intronic
1148236661 17:45973746-45973768 CCTTCACAGCAGAGGCAGGAGGG - Intronic
1148838256 17:50478043-50478065 CCCACAAAGCAGAAACATCATGG - Intergenic
1150580427 17:66468881-66468903 CATTCAAAGCAGAACCTTCAGGG - Intronic
1151240584 17:72754637-72754659 CCTCCTAAGCAGAAACACCAGGG + Intronic
1152312251 17:79558483-79558505 CTTCCAAAGCAGAAACACCAGGG + Intergenic
1152407287 17:80104920-80104942 CCTGCAAAGCAGGGGCTGCAGGG + Intergenic
1152689189 17:81710239-81710261 GCTCCAAAGCAGAAAGAGCAGGG - Intergenic
1154156348 18:11947515-11947537 TCTTCAAACCAGAAGCACCGCGG + Intergenic
1156610207 18:38716425-38716447 CATTGAAAGCAGGAGAAGCAAGG + Intergenic
1158655098 18:59323697-59323719 CCTTCCATGTAGAACCAGCATGG - Intergenic
1158954512 18:62524951-62524973 CCCTCAGAGCAGAAGCCACAAGG - Intronic
1161170688 19:2810996-2811018 CATTCAAAGCAGAGGCTCCAGGG - Intronic
1161780551 19:6289008-6289030 CCTTCTCAGGAGAAGCTGCAAGG + Intergenic
1161952793 19:7477130-7477152 CCCGCAAAGCAGAAGCCGCCAGG - Exonic
1162870005 19:13579170-13579192 ACTTGAAAGCAGAAGCTGCAAGG - Intronic
1163132045 19:15280368-15280390 CCTTCTCTGCAGAAGCAGCTGGG + Exonic
1164745060 19:30605883-30605905 CCTCAAAACCTGAAGCAGCACGG - Intronic
1167522123 19:49961212-49961234 CTTTCACAGGGGAAGCAGCAGGG + Intergenic
1167523258 19:49969513-49969535 CTTTCACAGGGGAAGCAGCAGGG - Intergenic
924982295 2:235322-235344 CCATCAAATGAGAGGCAGCATGG + Intronic
928683424 2:33725998-33726020 CCTTCAAGGCAGTACCAGCTTGG - Intergenic
931284577 2:60821123-60821145 TCTCCAAAGCAGAACCTGCAAGG - Intergenic
932113003 2:69018365-69018387 CCTGCAAATCAGCACCAGCAGGG - Intronic
932266836 2:70374897-70374919 CCTTCCAAGAAGAATTAGCAAGG - Intergenic
935427873 2:102940165-102940187 CCTTTAAAGAAGAAACACCAGGG + Intergenic
935518903 2:104078981-104079003 ACTTCAACTCAGAAGGAGCAGGG + Intergenic
935940109 2:108229157-108229179 GGTTCTAAGCAGAAGCTGCAAGG + Intergenic
936252268 2:110876017-110876039 CCTTGAAAGCAGAGGCATCCAGG - Intronic
937118953 2:119428968-119428990 TGTTAAAAGCAGAAACAGCATGG - Intergenic
937250871 2:120522908-120522930 CCCTCCAAGAACAAGCAGCATGG + Intergenic
940794254 2:158060445-158060467 CATTCAAAGCAGAGGCAGGATGG - Intronic
943599351 2:189895621-189895643 TCTCCAAAGGAGAAGCATCATGG + Intronic
945047683 2:205796359-205796381 CTCTCAAGGCTGAAGCAGCATGG - Exonic
945940685 2:215946392-215946414 CTTTCAAAGCAAAAGGATCAAGG + Intronic
946337058 2:219044906-219044928 CCTCCAAAACAGTAGCTGCAGGG - Intergenic
946580109 2:221119190-221119212 TCTGCAAAGAGGAAGCAGCAGGG + Intergenic
948034698 2:234848534-234848556 CCTTCTCAGCAGCTGCAGCAGGG + Intergenic
1172972182 20:38881580-38881602 CCTACAATGGAGATGCAGCAGGG + Intronic
1174441953 20:50562751-50562773 ACTTCACAGCAGAATCACCAAGG - Intronic
1175225872 20:57443501-57443523 CCTGCAAAGCTGGAGAAGCAGGG + Intergenic
1175802356 20:61808078-61808100 CCTGCCACACAGAAGCAGCATGG + Intronic
1176312518 21:5160328-5160350 CCACCAAAGCAGAAGCAGACTGG - Intergenic
1177107124 21:16973476-16973498 GCTTCCAGGCAGAAGCAGAAAGG + Intergenic
1177335056 21:19713075-19713097 CCTTCAATGCATAAGTACCAAGG - Intergenic
1178098553 21:29241244-29241266 CCTACACAGCAGCAGCTGCAAGG - Intronic
1178429553 21:32506901-32506923 CCCCCAAAGCAGGAGCAGCTGGG + Intronic
1179844530 21:44101702-44101724 CCACCAAAGCAGAAGCAGACTGG + Intronic
1180540423 22:16441306-16441328 CCTTCATACCTGAATCAGCATGG - Intergenic
1180613665 22:17113775-17113797 CTTACAAAGAAGAGGCAGCAGGG + Exonic
1181994818 22:26868971-26868993 GCTTCAAAACAGAAGCAGTATGG - Intergenic
1182594618 22:31409468-31409490 CCTTCAAATCAGAATCTGCAGGG + Intronic
1183034753 22:35133159-35133181 CATTCATAGCAGCAGCAGCATGG + Intergenic
1184402890 22:44284231-44284253 CCTCCAAAGAGGAGGCAGCAAGG + Intronic
1184530467 22:45052096-45052118 CCTTAAGAACAGAAGCGGCACGG + Intergenic
1184769610 22:46589582-46589604 CCTGCAAAGCAGGGGCAGCATGG - Intronic
950013602 3:9741059-9741081 CCCTCAAACCAGGATCAGCATGG + Intronic
951297447 3:20956212-20956234 CAGTCAAAGCAGAAGCAGACAGG + Intergenic
952133632 3:30392749-30392771 CATTCAAAGCAGAAGAAACCAGG + Intergenic
952470782 3:33649121-33649143 CATTCTAGGCAGAAGAAGCAAGG - Intronic
953302140 3:41788286-41788308 CATTTAAAGCAGAAGAAGCATGG + Intronic
953551028 3:43903137-43903159 CCTGCAAAGCAAAAGGGGCATGG + Intergenic
953594464 3:44296728-44296750 CATTCAAAGAAGAATCAGCATGG + Intronic
953662124 3:44899010-44899032 GCTTGAAAGGAGAAGCAGCCAGG - Intronic
955934178 3:64086972-64086994 CATTCAGGGCAGAAGCAACACGG + Intergenic
956587873 3:70883387-70883409 TCTGCAAATCAGAAGCTGCAAGG + Intergenic
956937246 3:74117085-74117107 CATTCTAGGCAGAAGGAGCAGGG - Intergenic
957046686 3:75381162-75381184 CCCCCAAAGCAGGAGCAGCTGGG - Intergenic
957538842 3:81541606-81541628 CCTCCACAGCAGAAGAAACAAGG - Intronic
958636114 3:96749951-96749973 CCATCACAGCAGCTGCAGCAGGG + Intergenic
959089687 3:101888769-101888791 CCTTCAAGGCAGAAGCAGAAGGG + Intergenic
960101676 3:113748363-113748385 CCTTCAATTGAAAAGCAGCATGG - Intronic
961878751 3:130045230-130045252 CCCCCAAAGCAGGAGCAGCTGGG - Intergenic
962326115 3:134433631-134433653 CCTACAAACCAGAAGCAGCCAGG - Intergenic
962743017 3:138377057-138377079 CATTTATAGCAGGAGCAGCAGGG + Intronic
963637043 3:147811044-147811066 GCATGAAAACAGAAGCAGCAAGG - Intergenic
963724092 3:148899828-148899850 CATACAAAGCAGCAGCAGCAAGG + Intergenic
963863583 3:150335886-150335908 TCTTCAAAGCAGAGGCTGCCTGG + Intergenic
964075672 3:152688714-152688736 CCCCCACAGCAGATGCAGCAAGG + Intergenic
964255174 3:154767040-154767062 CCATCAAACCAGCTGCAGCAGGG - Intergenic
965813212 3:172613064-172613086 CAGTCAAAGCACAAGCAGCCTGG - Intergenic
968274559 3:197430047-197430069 CCTTCAAAGGAGAAGATGCCAGG - Intergenic
968328978 3:197847760-197847782 ACTTCAAAGCAAAAGTTGCATGG + Intronic
968558746 4:1265044-1265066 CCATCACAGCACAAGCAGCCCGG - Intergenic
968636465 4:1683652-1683674 GCTTCAAAGAAGAGGCACCAAGG + Intronic
968864279 4:3197877-3197899 CCTTCAAGGAAGATGCAGCCAGG - Intronic
969824365 4:9745257-9745279 CCCCCAAAGCAGGAGCAGCTGGG + Intergenic
969927655 4:10600268-10600290 GACTCAAAGCGGAAGCAGCAGGG - Intronic
970166231 4:13241270-13241292 CATTCTAAGGAGAAGAAGCAAGG - Intergenic
971501261 4:27320263-27320285 CCTTCAAGGCAGTACCTGCATGG - Intergenic
972323614 4:37994663-37994685 CTTTAAAAGCAGCAGCAACAAGG - Intronic
972415619 4:38837337-38837359 ACTGCAAAGCAAAAGTAGCATGG + Intronic
974370086 4:61004864-61004886 GCCTCAAGGCAGAAGCAGCAAGG - Intergenic
976455043 4:85236670-85236692 CCTAGGAAACAGAAGCAGCAAGG - Intergenic
983719678 4:170833953-170833975 CCTTTAATTCAGAGGCAGCAAGG + Intergenic
984463092 4:180059606-180059628 CCTTCCGTGCAGAAGGAGCAAGG - Intergenic
985164430 4:187077859-187077881 CCTTCAAAGCAGAACCTGACAGG + Intergenic
985914345 5:2906266-2906288 GTTTAAAAGCAGAAGCAACATGG - Intergenic
988369986 5:30356226-30356248 CCTGCAAATCGGAATCAGCATGG - Intergenic
988538482 5:32089148-32089170 CCTTCACAGCATTCGCAGCAGGG - Exonic
989354814 5:40531665-40531687 CTTTCCAAGCATAAGCATCAGGG - Intergenic
990944787 5:61238556-61238578 ATGGCAAAGCAGAAGCAGCATGG - Intergenic
992024440 5:72656722-72656744 ACTTAAAAGAAGAGGCAGCAGGG - Intergenic
992493658 5:77270767-77270789 CCTTCTGGGAAGAAGCAGCAGGG + Intronic
992665688 5:79006799-79006821 CCTCCAGAGAAGCAGCAGCAGGG + Intronic
993379415 5:87189171-87189193 CCCTAAAGGCAGAGGCAGCATGG + Intergenic
993598094 5:89884763-89884785 CCTTCTCCACAGAAGCAGCATGG + Intergenic
994578583 5:101611274-101611296 GATGAAAAGCAGAAGCAGCAGGG - Intergenic
994703344 5:103166125-103166147 CAGTCAAAGCAGAAGCAGACTGG + Intronic
995369269 5:111400619-111400641 CCAGAAAAGCAGAAGGAGCAAGG - Intronic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
997588705 5:135060033-135060055 CTTTCAGAACAGCAGCAGCAGGG + Intronic
999052051 5:148533518-148533540 CCTTAATTGCAGAAGGAGCACGG - Intronic
999822073 5:155238396-155238418 CATTCAAAGCAGAAGTAGGGAGG - Intergenic
1000352708 5:160364746-160364768 CCCTCAGAGCAGAAACAGCAAGG - Intronic
1000359989 5:160438202-160438224 CCTTCAAAGCAGCAACCACAGGG - Intergenic
1002864027 6:1105452-1105474 CCTTCAGAACAGAAACAGCAAGG + Intergenic
1002992686 6:2252471-2252493 AATGCATAGCAGAAGCAGCAGGG + Intergenic
1003112979 6:3264425-3264447 ACTCCAGAGCAGAAGCAGCTGGG - Intronic
1005153786 6:22780706-22780728 TCTTCCAAGCAGAAGGAGGAAGG - Intergenic
1005489816 6:26337238-26337260 TGTTCAAAGCAGAAGAAGGATGG + Intergenic
1009383892 6:63066422-63066444 ACTTCAATGCAGTTGCAGCAGGG + Intergenic
1010235389 6:73571088-73571110 GCTTAAAAGCAGCAGCAGCACGG - Intergenic
1011415183 6:87111583-87111605 CCTGCAAATCACATGCAGCAAGG - Intergenic
1011536894 6:88385520-88385542 CTTTTAAAGCAGAAGCTACAAGG + Intergenic
1011699398 6:89941760-89941782 CATTTAGAGCAGAAGCAGAATGG - Intronic
1012043539 6:94239885-94239907 TCTTCCAAGCTAAAGCAGCAAGG + Intergenic
1016582517 6:145645545-145645567 CCTTCGAGGCTGAAGCAGAAGGG - Intronic
1017266627 6:152453626-152453648 CTTCCAGAGCAGGAGCAGCAGGG - Exonic
1020313807 7:6890158-6890180 CCCCCAAAGCAGGAGCAGCTGGG - Intergenic
1021568478 7:22038717-22038739 CCTGAAAAGCAGAAGCTGCAGGG - Intergenic
1021601063 7:22363934-22363956 CATTCTCAGCAGAGGCAGCACGG - Intergenic
1021670304 7:23028931-23028953 CCTTCAAAGCAGTTGCATCAAGG + Intergenic
1023503924 7:40880325-40880347 CCTTCAGAGCATTTGCAGCAGGG - Intergenic
1023859427 7:44208572-44208594 CCTTCAATGCAAACGCTGCAAGG - Intronic
1023992357 7:45135935-45135957 CCTCCAGAGCAAAAGCAGCTTGG - Intergenic
1024487659 7:49937554-49937576 CCTTCAATGCAATAGCAGCCTGG - Exonic
1025754308 7:64321345-64321367 CCTTCAAAGCAAAAGGTGCATGG - Intronic
1028550557 7:92057721-92057743 CCTTCAAAGCAGAACCTGGCAGG - Intronic
1029578316 7:101418885-101418907 CCTTCAGAGTACAAGAAGCAAGG - Intronic
1030380908 7:108810965-108810987 CCTGGCAAGCAGAAGCAGCTGGG - Intergenic
1034491351 7:151394628-151394650 CCTTCACAGCAACAGCAGCAGGG + Intronic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1036953317 8:13161654-13161676 CCCTCAAACCAGAAGGGGCAGGG - Intronic
1042864577 8:73345939-73345961 TCTTCAAAGCAAAAAGAGCATGG - Intergenic
1044476250 8:92629960-92629982 CCTTCAAAGGAGCAGGAGAATGG - Intergenic
1045338659 8:101232307-101232329 AGTTCCAAGCAGAAGAAGCATGG + Intergenic
1045396948 8:101770535-101770557 CCTGCAAAGAAGAAGCAGGCTGG + Intronic
1046678154 8:117135459-117135481 CCTACAATTCAGAAGCAACAAGG - Intronic
1047390240 8:124444703-124444725 ACTTCAAGGAAGAAGCAGCTGGG - Intergenic
1048465138 8:134659303-134659325 CCTTCAAACCAGCAGGAGCGAGG - Intronic
1050238028 9:3603571-3603593 CCTTCAAAGCAGAGTAAGCAAGG + Intergenic
1051349180 9:16183038-16183060 TCTTTAAAGCAGAAGCTGCAGGG - Intergenic
1051640105 9:19216702-19216724 CCCTCAAAGCAGAATCAAAAAGG - Intergenic
1052727967 9:32252906-32252928 TCTGCAAAGCAGAAGAACCAAGG + Intergenic
1055591371 9:77817900-77817922 CCCTCCAAGGAAAAGCAGCATGG + Intronic
1056332017 9:85528892-85528914 CCATCAATGAAGAGGCAGCATGG + Intergenic
1056908675 9:90677584-90677606 GTTTAAAAGCAGTAGCAGCAGGG - Intergenic
1059311116 9:113389686-113389708 CCTGCAAAGCAGAGTCATCAGGG + Exonic
1062416536 9:136454066-136454088 TCTCGAGAGCAGAAGCAGCATGG - Intronic
1186384301 X:9093596-9093618 ACTTTAAAGCAGGAGCTGCAGGG - Intronic
1189637016 X:43022189-43022211 CAATCAAAGCAAAAGCAGAATGG - Intergenic
1190972731 X:55367503-55367525 ACATGAAAGTAGAAGCAGCATGG + Intergenic
1191872805 X:65764337-65764359 TCTTCAAAGCTAAAGGAGCATGG - Intergenic
1193635972 X:83949117-83949139 CCTTCTCAGCAGGAGCAGCTAGG + Intergenic
1197602749 X:128548914-128548936 CCTTCCTAGCAGCGGCAGCATGG - Intergenic
1197807411 X:130411013-130411035 ACCTCAAAGCACAAGCATCAGGG - Intronic
1201181592 Y:11352896-11352918 CCTTCATACCTGAATCAGCATGG - Intergenic