ID: 1083564968

View in Genome Browser
Species Human (GRCh38)
Location 11:63706441-63706463
Sequence CTGTGGATGGCTAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7917
Summary {0: 1, 1: 1, 2: 10, 3: 408, 4: 7497}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083564968_1083564975 14 Left 1083564968 11:63706441-63706463 CCTTCCACCTTAGCCATCCACAG 0: 1
1: 1
2: 10
3: 408
4: 7497
Right 1083564975 11:63706478-63706500 GCATGAGCCACCACCACACCTGG 0: 11
1: 65
2: 169
3: 335
4: 795

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083564968 Original CRISPR CTGTGGATGGCTAAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr