ID: 1083571866

View in Genome Browser
Species Human (GRCh38)
Location 11:63765431-63765453
Sequence CACCCACACCTCCCCCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 1, 2: 4, 3: 51, 4: 425}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083571860_1083571866 10 Left 1083571860 11:63765398-63765420 CCCTAAACCCTCCTCTGCTAGCA 0: 1
1: 0
2: 1
3: 11
4: 145
Right 1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG 0: 1
1: 1
2: 4
3: 51
4: 425
1083571862_1083571866 3 Left 1083571862 11:63765405-63765427 CCCTCCTCTGCTAGCATTTCAAG 0: 1
1: 0
2: 2
3: 12
4: 182
Right 1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG 0: 1
1: 1
2: 4
3: 51
4: 425
1083571858_1083571866 25 Left 1083571858 11:63765383-63765405 CCTGAAATCCTAACTCCCTAAAC 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG 0: 1
1: 1
2: 4
3: 51
4: 425
1083571864_1083571866 -1 Left 1083571864 11:63765409-63765431 CCTCTGCTAGCATTTCAAGCACC 0: 1
1: 0
2: 0
3: 6
4: 137
Right 1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG 0: 1
1: 1
2: 4
3: 51
4: 425
1083571861_1083571866 9 Left 1083571861 11:63765399-63765421 CCTAAACCCTCCTCTGCTAGCAT 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG 0: 1
1: 1
2: 4
3: 51
4: 425
1083571863_1083571866 2 Left 1083571863 11:63765406-63765428 CCTCCTCTGCTAGCATTTCAAGC 0: 1
1: 0
2: 1
3: 11
4: 138
Right 1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG 0: 1
1: 1
2: 4
3: 51
4: 425
1083571859_1083571866 17 Left 1083571859 11:63765391-63765413 CCTAACTCCCTAAACCCTCCTCT 0: 1
1: 1
2: 2
3: 18
4: 335
Right 1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG 0: 1
1: 1
2: 4
3: 51
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083571866 Original CRISPR CACCCACACCTCCCCCAGAC TGG Intronic
900322175 1:2090319-2090341 CACCCAGCCCTCCCGCAGAAGGG + Intronic
900431709 1:2605876-2605898 CACCCGCGGCTCCCCCAGAGTGG + Intronic
900507537 1:3037203-3037225 CACCCACCCCTCCCCAGCACAGG + Intergenic
901221674 1:7587033-7587055 CACCACCAGCTCCCCCAGAAGGG + Intronic
901636488 1:10672778-10672800 CACCCACACATCCTGGAGACTGG - Intronic
901893819 1:12291631-12291653 CACGCACACCCACCCCAGATAGG + Intronic
902416406 1:16242416-16242438 CACCCACCCCTCCCTCAGCATGG + Intergenic
903360392 1:22773392-22773414 CAGCCCCACCAGCCCCAGACAGG + Intronic
903951176 1:26996741-26996763 CACCCACCCCACCCCCAAATCGG - Intronic
904607507 1:31705791-31705813 CTCCCACCCGTGCCCCAGACAGG + Intergenic
905339228 1:37266868-37266890 TGCCCCCACCTCCCCCACACAGG + Intergenic
905347177 1:37319091-37319113 CACGCACACCCCCAACAGACAGG - Intergenic
905347197 1:37319198-37319220 CACGCACACCTCCAACAGACAGG - Intergenic
905990624 1:42334770-42334792 CTCCCGCCCCTCCCCCAGGCGGG - Intronic
906238662 1:44228165-44228187 TTCCTACCCCTCCCCCAGACAGG + Intronic
906450264 1:45940065-45940087 CATCCACACCACCCCCACCCCGG + Intronic
906824167 1:48961071-48961093 CACACACACACACCCCAGACTGG - Intronic
907324357 1:53627200-53627222 CGCCCACACCTCCCCCTCCCAGG - Intronic
907345368 1:53773810-53773832 CACCCACAACTCCCCCAGACTGG + Intronic
908650922 1:66332266-66332288 CACCGACACCTCATCCAGGCGGG + Intronic
911967424 1:104385816-104385838 CCCCCACACCGCACCCACACTGG + Intergenic
912432574 1:109636802-109636824 CACCCACACTGCCACCAGCCAGG - Intergenic
912635844 1:111291825-111291847 TACCCCCACCCCCCCCCGACAGG - Intronic
914430734 1:147618961-147618983 CACCCCCACGTCCCCTGGACCGG + Exonic
915057546 1:153149106-153149128 CCCACACACCTCCCACACACAGG - Intergenic
915118962 1:153616775-153616797 CACGCACACTTCTCCCAGTCAGG + Intronic
915146891 1:153800712-153800734 CACACCCACCTCCCACAGGCCGG - Intergenic
915152855 1:153848973-153848995 ACCCCCCCCCTCCCCCAGACTGG + Intronic
915243058 1:154537529-154537551 CACCCTCACCTCCACCAACCTGG - Intronic
915471651 1:156129289-156129311 CACCCCCACCTCCCCCCACCAGG - Intronic
916086425 1:161273333-161273355 CACCCACACCCTCCCCAGCCAGG - Intronic
916484918 1:165250070-165250092 CCCCCACCCCACCCCCTGACAGG - Intronic
918041787 1:180918089-180918111 CACCGCCACATCCCCCAGGCTGG + Intronic
918133264 1:181647043-181647065 CACCCAGCCCTTCCCTAGACTGG - Intronic
919892163 1:201983177-201983199 CACCCTCACCTACCCCACCCGGG + Intronic
919939894 1:202278960-202278982 CCTCAACACCTCTCCCAGACTGG + Intronic
920345917 1:205305546-205305568 CAACCACCCCTTCCCCAGCCCGG - Intronic
922801393 1:228366279-228366301 CCCCCACATCCCCCCTAGACTGG + Intronic
923032998 1:230264517-230264539 CTCCCTCACCCCCCACAGACAGG - Intronic
923358600 1:233185122-233185144 CACACACACATCCCTCAGATTGG + Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1062824196 10:556442-556464 CACCCACACCTTCCCAAGAGGGG + Intronic
1062919304 10:1267159-1267181 CACCCACACCTACCCGGGAGGGG - Intronic
1064699562 10:18005067-18005089 CACCCCCACCCTCCCCCGACAGG - Intronic
1065186517 10:23174573-23174595 CACCCTGCCCTCCCCCAGCCCGG - Intergenic
1065288351 10:24206813-24206835 GACCCTCCCCTCCCCCATACGGG - Intronic
1065445107 10:25790180-25790202 CACCCACCCCCACCCCAGGCTGG - Intergenic
1067193363 10:44091320-44091342 CAGACACCCCTCCCCCAGCCAGG - Intergenic
1067739177 10:48881771-48881793 CCCTCACACCTCCACCAGCCAGG + Intronic
1068239651 10:54288799-54288821 CAGACGCACCTCCCCCAGCCAGG - Intronic
1068286402 10:54942275-54942297 AACCCACATCTCCCTCAGAATGG - Intronic
1069358190 10:67611992-67612014 CCCCCTCTCCTCCCCGAGACTGG - Intronic
1069798288 10:71067062-71067084 CTCTCACACCTCCCCCAGGGAGG - Intergenic
1069989824 10:72308387-72308409 CACAGACACCTCCCCCAGGAAGG - Intergenic
1070439456 10:76429049-76429071 CACACACACATTCCCCACACTGG + Intronic
1070479503 10:76868657-76868679 ATCCCAACCCTCCCCCAGACTGG + Intergenic
1070751710 10:78967875-78967897 ATCCCACACCCCTCCCAGACAGG + Intergenic
1071507556 10:86241833-86241855 CACCCCCACCTGACCCAGCCTGG + Intronic
1071932979 10:90495180-90495202 CACCTACATCTCTCCAAGACTGG + Intergenic
1073556650 10:104459602-104459624 CCCCCACCCCACCCCCTGACAGG + Intergenic
1073792161 10:106951575-106951597 CACACACACCTTCCCCTCACTGG + Intronic
1075382484 10:122030689-122030711 GACCCAGACCTCTGCCAGACTGG - Intronic
1075658273 10:124175809-124175831 CAGCCTCCCCTCCCCCAGCCTGG + Intergenic
1076601439 10:131659217-131659239 CACCCACACCTGCACCTGCCAGG - Intergenic
1076762399 10:132611982-132612004 CTCCCACACCTTCCTCTGACAGG - Intronic
1077020474 11:415057-415079 CACCCACCCCTTCCCTAGGCGGG + Intronic
1077049284 11:559494-559516 CTCTCACACCTCCTCCAGGCTGG - Intronic
1077097094 11:803695-803717 CACCCCCACCCCAGCCAGACAGG + Intronic
1077199489 11:1298377-1298399 CACCCACACCCTCCCCCGACTGG - Intronic
1077236942 11:1486410-1486432 TACACACCCCTCCCCCAGCCAGG + Intronic
1077324579 11:1958264-1958286 CAGCCTCCCCTCCCCCAGCCCGG + Intronic
1077352773 11:2100575-2100597 CCCCTGCACCTCCCGCAGACAGG - Intergenic
1077389587 11:2293923-2293945 CACCAACGGCTCCACCAGACTGG - Intergenic
1077405291 11:2379854-2379876 CAACCCCACCTCACCCAGCCTGG - Intronic
1077614603 11:3666054-3666076 CAGCCACAGCTCCTCCAGAAAGG - Exonic
1078697769 11:13651660-13651682 CAGACACCCCTCCCCCAGCCAGG - Intergenic
1079367019 11:19818150-19818172 CCCCTACCCCTCCCCCAAACTGG - Intronic
1080628230 11:34050934-34050956 CACCCACTCCACCCCAAGGCTGG + Intergenic
1080770458 11:35336158-35336180 CACCCACCCCACCCCCTGAGAGG - Intronic
1082283643 11:50298146-50298168 CCACAACACCTCCCCCAGCCAGG - Intergenic
1083335304 11:61918357-61918379 CTCCCAGTCCTCCCCTAGACAGG - Intronic
1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG + Intronic
1084782891 11:71422691-71422713 CCCCCACCCCACCCCCTGACAGG - Intergenic
1085465557 11:76721155-76721177 CACCCACCCCGCCCCCACTCCGG + Intergenic
1086976938 11:93142938-93142960 CTCCCACCCCACCCCCAAACAGG - Intergenic
1088750431 11:112837985-112838007 CACCCCCTCCTCTCCCAGGCAGG + Intergenic
1088842976 11:113642176-113642198 CCCCCACACCTTCCCCACCCAGG + Intergenic
1089551817 11:119285253-119285275 CACCACCACCGCCTCCAGACCGG + Exonic
1090187126 11:124746064-124746086 CACCCTCACCCCTCCCAGCCGGG + Intronic
1090535664 11:127638492-127638514 GACAGACACCTCCCTCAGACTGG - Intergenic
1202807558 11_KI270721v1_random:13441-13463 CAGCCTCCCCTCCCCCAGCCCGG + Intergenic
1092226688 12:6752740-6752762 CACTCAGGCCTCCCCCAGGCGGG + Intronic
1096075226 12:48799984-48800006 CCCCCACCCCGCCCCCACACTGG + Intergenic
1097224563 12:57469705-57469727 CAGCCACACCTCCCACACCCAGG - Intronic
1097322408 12:58240939-58240961 GAGCCACACCACCCCCAGCCTGG - Intergenic
1097813094 12:64039889-64039911 CAACCAAACTTCTCCCAGACAGG + Intronic
1097971759 12:65640497-65640519 CACCATCACCACCCCCAGACAGG + Intergenic
1098733880 12:74071992-74072014 CCCCCACCCCACCCCCGGACAGG - Intergenic
1098848431 12:75566201-75566223 CACACCCACCTTCCCCAGGCTGG - Intergenic
1099753377 12:86807274-86807296 CCCCCACTCCACCCTCAGACAGG + Intronic
1100744070 12:97626145-97626167 CACACATTCCTCCCCCACACAGG - Intergenic
1101789806 12:107916247-107916269 CCACCACACCTGGCCCAGACTGG - Intergenic
1101910431 12:108857225-108857247 CCCGCACAGCTCCCCAAGACAGG + Intronic
1102149529 12:110679199-110679221 CACCCAGACCACACCCAGATGGG - Intronic
1102417691 12:112778944-112778966 CACCCAAACCTCCACCTGAAAGG + Intronic
1102424102 12:112827209-112827231 CCCCAGCACCTCCCCCAGCCTGG + Intronic
1103014400 12:117482540-117482562 CTCCCACCCCTGCCCCAGCCAGG - Intronic
1103896133 12:124274477-124274499 CGCCCTCCCCTCCCCCAGAAGGG - Intronic
1104055232 12:125225008-125225030 ATCCCACACCTCCACCAGAAAGG - Intronic
1104711230 12:130988158-130988180 TATCAACACCTCCCCCAGAAAGG - Intronic
1104732107 12:131113003-131113025 CTTCCCCACCTCCCCCAGCCTGG + Intronic
1104944387 12:132409220-132409242 CGTCCACACCGTCCCCAGACGGG + Intergenic
1105717516 13:23082049-23082071 CGCCCACTCTTCCCCCAGGCAGG + Intergenic
1105928168 13:25026896-25026918 CACCCAGAACTCACCTAGACTGG - Intergenic
1106235504 13:27857322-27857344 CACCCCCCCCGCCCCCAGCCAGG - Intergenic
1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG + Intronic
1108395746 13:49989538-49989560 AACCCACACCCCTCCCAGTCAGG - Intergenic
1108713406 13:53056234-53056256 CATCCCCACATCCCCCAAACTGG + Intergenic
1113235726 13:108270476-108270498 CACCTCCAGCTCCCCCAGACTGG - Intronic
1113580289 13:111423905-111423927 CAACCACACCTGCTCCAGAGAGG - Intergenic
1113737494 13:112689448-112689470 CACCCTCCCCTCCCACTGACAGG + Intergenic
1113976006 13:114227869-114227891 CACACACACACCCCCCACACTGG - Intergenic
1115005457 14:28477500-28477522 CACCCACCCCACCCACTGACAGG + Intergenic
1115407412 14:33033188-33033210 CACCCACACCTGGCCCAAATAGG - Intronic
1116180466 14:41526046-41526068 CCACCACACCTGGCCCAGACTGG - Intergenic
1116490742 14:45499930-45499952 CACCCACACCCTTCCCAGATAGG + Intergenic
1117271031 14:54143549-54143571 CACCCACTCCCACCCCAGTCAGG - Intergenic
1117341889 14:54798705-54798727 CTTCCACACCTCCCTGAGACTGG - Intergenic
1117653939 14:57935111-57935133 CACTCACTCCTCCCCAAGAGAGG - Intronic
1118428579 14:65692611-65692633 CCCCCACCCCCCTCCCAGACGGG + Intronic
1119195096 14:72711913-72711935 CACCCCCACCACCCCCAAACTGG - Intronic
1119713627 14:76842416-76842438 CACCCAGTCCTATCCCAGACTGG + Intronic
1120619897 14:86750709-86750731 CACCCACCCCTTCCCCAGCCAGG + Intergenic
1120840020 14:89077552-89077574 CACCCACACCACAGCCAGAAGGG - Intergenic
1120840231 14:89078927-89078949 CACCCACACCACAGCCAGAAGGG + Intergenic
1121438149 14:93932360-93932382 CGGCCTCACCTCCCCCAGAGTGG + Intergenic
1122207169 14:100153574-100153596 CACCCAAACCTGGCCCAGCCTGG + Intronic
1122209563 14:100165972-100165994 CTCCCCCTACTCCCCCAGACAGG - Intergenic
1122209583 14:100166018-100166040 CTCCCCCCACTCCCCCAGACAGG - Intergenic
1122209602 14:100166064-100166086 CTCCCCCAACTCCCCCAGACAGG - Intergenic
1122209641 14:100166156-100166178 CTCCCCCCACTCCCCCAGACAGG - Intergenic
1122209687 14:100166271-100166293 CTCCCCCCACTCCCCCAGACAGG - Intergenic
1122716419 14:103699278-103699300 CACCCGCCCCACCTCCAGACCGG + Intronic
1122780182 14:104140168-104140190 CACCCTGCCCTGCCCCAGACAGG - Intronic
1122782410 14:104149303-104149325 CACGCACCCCTCCCCAGGACGGG - Intronic
1122857235 14:104565790-104565812 CACCCTCTCCTTCCCCAGAGAGG + Intronic
1122871512 14:104641031-104641053 CACCCTCACCCCACCCAGCCGGG + Intergenic
1123056933 14:105575154-105575176 CGCCCACCCCTCCCCCAGGCAGG + Intergenic
1123081277 14:105696631-105696653 CGCCCACCCCTCCCCCAGGCAGG - Intergenic
1123119047 14:105908609-105908631 CACACAGACCAACCCCAGACGGG - Intergenic
1123943770 15:25229199-25229221 CACCAACACCAACCCCACACAGG - Intergenic
1124426798 15:29570057-29570079 CACCCCCACCGCCCCCGGTCAGG + Intronic
1125906739 15:43399938-43399960 CACCCACTCCTCTCACAAACAGG - Intronic
1127673718 15:61220489-61220511 CAGCCACTCCTCCCCATGACTGG + Intronic
1128088015 15:64899019-64899041 AACCCACTCCTTCCCCAGGCAGG - Intronic
1128156943 15:65396985-65397007 CTCCCTCTCCTTCCCCAGACGGG - Exonic
1128622351 15:69161022-69161044 CACCCACCCCTACCCCAAGCCGG - Intronic
1128838597 15:70831477-70831499 CACCCACAGCTCTGTCAGACAGG + Exonic
1129878644 15:78993220-78993242 CACACACACATCACCCACACAGG - Intronic
1131075078 15:89490346-89490368 GACCCACAGCTCTCCCACACTGG - Intronic
1131550507 15:93353028-93353050 CACCACCACAACCCCCAGACTGG - Intergenic
1132061066 15:98692902-98692924 CACTCATACCTCCCCCACCCAGG - Intronic
1132598118 16:762395-762417 CGCCCACCCCTCTCCCAGAAGGG - Intronic
1132836967 16:1959010-1959032 CTCCCTGCCCTCCCCCAGACAGG + Intergenic
1133231892 16:4370863-4370885 CACCCACACCCCCTCCAGCCCGG - Intronic
1133441495 16:5824569-5824591 CTTCCACACCTCAGCCAGACAGG - Intergenic
1136519145 16:30785237-30785259 CACCCAGTCCTCCCACAGCCTGG + Intronic
1136690483 16:32024960-32024982 CCCCCTCACCTCCCCCACAAAGG + Intergenic
1136791068 16:32968520-32968542 CCCCCCCACCTCCCCCACAAAGG + Intergenic
1138436252 16:57001873-57001895 CATCCCCACCTCCCCCACCCTGG + Intronic
1140256889 16:73345389-73345411 CCCCCACCCCACCCCCCGACAGG + Intergenic
1141165926 16:81661115-81661137 CACCCACGTCTCTGCCAGACAGG + Intronic
1141636415 16:85316452-85316474 CACCCACACCTCCCAGCCACTGG + Intergenic
1142073202 16:88102746-88102768 CACCCCCACCTACCCCAGGGAGG - Intronic
1203093278 16_KI270728v1_random:1229981-1230003 CCCCCACACCTCCCCCACAAAGG + Intergenic
1142524614 17:531242-531264 CACCCACACCCTCCCCATTCTGG + Intronic
1142949258 17:3464871-3464893 CCCCCACCCCCCTCCCAGACGGG - Intronic
1143101975 17:4509526-4509548 CGCCCACACCTCCCTCACCCTGG - Intronic
1143102549 17:4512406-4512428 CACCCACAGCCCCAGCAGACTGG - Intronic
1143164869 17:4892720-4892742 CACGGGCACCTCCCCCAGGCTGG + Exonic
1143499041 17:7328331-7328353 CACACACACCTCCCTCACCCTGG + Intronic
1144432464 17:15206764-15206786 CTCCCACCCCACCCCCTGACAGG - Intergenic
1144577296 17:16437155-16437177 CACCCCCACATCCCCAAGTCTGG + Intergenic
1144959969 17:19039459-19039481 CCCCCACACATCCCCCTGCCAGG + Intronic
1144975191 17:19135065-19135087 CCCCCACACATCCCCCTGCCAGG - Intronic
1145157735 17:20554075-20554097 AACCCACCCCTCCCCCACCCTGG + Intergenic
1145822724 17:27852168-27852190 CACCCCCACCATCACCAGACTGG + Intronic
1146842215 17:36163985-36164007 CCCCCACACCTCCCCTCGTCCGG + Intergenic
1146854525 17:36251944-36251966 CCCCCACACCTCCCCTCGGCCGG + Intronic
1146866094 17:36336432-36336454 CCCCCACACCTCCCCTCGGCCGG - Intronic
1146870426 17:36375836-36375858 CCCCCACACCTCCCCTCGTCCGG + Intronic
1146877783 17:36426917-36426939 CCCCCACACCTCCCCTCGGCCGG + Intronic
1147073309 17:37976460-37976482 CCCCCACACCTCCCCTCGGCCGG + Intergenic
1147080488 17:38016581-38016603 CCCCCACACCTCCCCTCGGCCGG - Intronic
1147084830 17:38055998-38056020 CCCCCACACCTCCCCTCGGCCGG + Intronic
1147100778 17:38179964-38179986 CCCCCACACCTCCCCTCGGCCGG + Intergenic
1147153340 17:38531096-38531118 CCCCCCCACCTCCCCCACAAAGG + Exonic
1147190131 17:38733611-38733633 CACTCCCGCCTGCCCCAGACTGG - Exonic
1147420779 17:40321254-40321276 CACCCACACCCGAGCCAGACTGG - Intronic
1147454943 17:40531297-40531319 CACCCACCCCACCCCCAATCTGG + Intergenic
1148177438 17:45579458-45579480 CACCTACACCTCCCTAAGAATGG - Intergenic
1148461219 17:47840099-47840121 CATCCATCCCTCCCCCAGCCTGG - Intronic
1148902305 17:50887577-50887599 CCCCCACACCTCCCTCAAAGAGG - Intergenic
1149845366 17:60006428-60006450 CCCCCACACCTCCCCCAGCCTGG + Intergenic
1150083711 17:62263011-62263033 CCCCCACACCTCCCCTCGGCCGG + Intergenic
1150226413 17:63527039-63527061 CACCCACGCCTGCCCCGCACTGG + Intronic
1150292454 17:63989333-63989355 CCCCCACACCCGCCCCAGGCCGG - Intergenic
1150527419 17:65937725-65937747 CCCCCACCCCCCTCCCAGACTGG - Intronic
1150527441 17:65937775-65937797 CCCCCACCCCCCTCCCAGACGGG - Intronic
1151758823 17:76089370-76089392 GACCCACGCCGCCCCCAGCCAGG - Intronic
1151821282 17:76498243-76498265 CCGCCACTCCTCCCCCAGCCTGG + Intronic
1152160342 17:78664754-78664776 CGCCCACCCCTCTCCCAGCCAGG - Intergenic
1152601003 17:81262143-81262165 CATCCACACCACCCACTGACTGG - Intronic
1152905460 17:82968234-82968256 CACGCACAGCAGCCCCAGACTGG + Intronic
1154383416 18:13872282-13872304 CACCCACACCTCTCGCTGTCTGG - Intergenic
1155955321 18:31951916-31951938 CTTCCCCCCCTCCCCCAGACGGG - Intronic
1157551583 18:48585524-48585546 CACCCACACCATCCACACACTGG + Intronic
1157619335 18:49007066-49007088 CACCCACTCCTCTCTCAGCCTGG + Intergenic
1159161823 18:64651884-64651906 CACACACACCTCTTCCACACTGG + Intergenic
1160786098 19:900799-900821 CACCCATACCCGCCCCAGCCAGG + Intronic
1160831643 19:1107216-1107238 CACCCCCACACCCCCCAGCCAGG - Intergenic
1160939964 19:1615599-1615621 CACGCACACCGCACCCACACTGG - Intronic
1160988315 19:1850250-1850272 CACCATCACCTCCACCAGAGTGG - Intergenic
1161312907 19:3604590-3604612 CCACCCCACCTCCCCCAGACAGG + Intronic
1161330333 19:3683873-3683895 GTCCCACACCTCCCCCACACTGG + Intronic
1161383950 19:3981150-3981172 CACCCACACCTGTCCCGGATGGG + Intronic
1161719011 19:5892991-5893013 CACCCACCCCGCACCCAGAGGGG - Exonic
1161788089 19:6340695-6340717 CACCCACGCCCAGCCCAGACCGG + Intergenic
1161844900 19:6706975-6706997 CAGCCCCACCCCCACCAGACAGG + Intronic
1161983428 19:7642105-7642127 CCCCCTCACCTCGCCCAGACTGG - Exonic
1162164766 19:8744791-8744813 CACCCACACATCCCACAGGCAGG + Intergenic
1162165837 19:8752259-8752281 CACCCACACATCCCACAGGCAGG + Intergenic
1162166903 19:8759715-8759737 CACCCACACATCCCACAGGCAGG + Intergenic
1162167969 19:8767175-8767197 CACCCACACATCCCACAGGCAGG + Intergenic
1162168908 19:8773469-8773491 CACCCACACATCCCACAGGCAGG + Intergenic
1162170654 19:8786237-8786259 CACCCACACATCCCACAGGCAGG + Intergenic
1162381735 19:10335407-10335429 CACCCTCATCCCCCCCAGTCAGG + Intronic
1162739027 19:12763430-12763452 CAACCACACCTCCTCCTGAAGGG - Exonic
1163153411 19:15427844-15427866 CACCCACATCTGCCCCTGTCTGG - Intronic
1164195116 19:22949926-22949948 CAGACACACCTCCCCCAACCAGG - Intergenic
1164698492 19:30264660-30264682 CACACACACCCACCCCAGTCTGG + Intronic
1166302545 19:41920796-41920818 CAGACACACCTTCCCCAGCCTGG - Intronic
1166534405 19:43563197-43563219 CCACCACACCTGGCCCAGACTGG - Intronic
1166827121 19:45616554-45616576 CCCCTCCCCCTCCCCCAGACGGG - Exonic
1167053534 19:47094807-47094829 CTCCTACCCCTCCCCCAGCCAGG - Intronic
1167563347 19:50239927-50239949 CTCCCAAAACTCCCCCAGGCTGG - Intronic
1167593918 19:50417771-50417793 CCCCCACCCCTCTCCCAGGCTGG + Intronic
1167631367 19:50628168-50628190 CACACACAGCTACCCCAGATTGG + Intronic
927650235 2:24908619-24908641 TACCCACCCCTCCCCCAACCAGG + Intronic
928722151 2:34133144-34133166 GCCCCCCACCTCCCCCGGACGGG + Intergenic
929451835 2:42043135-42043157 CACCCCCACCTCCCTCAGGTAGG - Intergenic
929591973 2:43153535-43153557 CACCCTCACCCCCCCCACCCTGG + Intergenic
929596194 2:43177901-43177923 CACCCACACCACCCCCATTGTGG + Intergenic
929665666 2:43832004-43832026 CACATACACCTCCCCCAGGAAGG + Exonic
931083887 2:58807498-58807520 CATCCACACCTCAGCCACACTGG - Intergenic
931817304 2:65917294-65917316 CACCCACAAGCCCTCCAGACAGG - Intergenic
931842916 2:66173431-66173453 CCCTCCCACCTCACCCAGACAGG - Intergenic
932563559 2:72892067-72892089 CTACCACCCCTCCCCCAGGCTGG + Exonic
932824456 2:74926818-74926840 CACCCACACCTACCCTTCACTGG - Intergenic
934860571 2:97760960-97760982 GCCCCACACCTCCCCGAGACAGG - Intronic
935187602 2:100748138-100748160 CACCCTCTCCTCCCCCTGCCTGG - Intergenic
936030701 2:109068093-109068115 CACCCACACCACCCCCTCACGGG + Intergenic
937301021 2:120841837-120841859 CACACACACACCCTCCAGACTGG - Intronic
938413395 2:131084193-131084215 CCCCCACCCCACCCCAAGACAGG + Intronic
940894069 2:159063533-159063555 CATCCTCCCCTCCCCCAGACTGG - Intronic
942779935 2:179629951-179629973 CAGACACCCCTCCCCCAGCCAGG - Intronic
943038452 2:182774557-182774579 CAGACACCCCTCCCCCAGCCAGG + Intronic
943350472 2:186791295-186791317 CCCCCACCCCTCCCCCTGACAGG - Intergenic
944374777 2:199028876-199028898 CAGACACCCCTCCCCCAGCCAGG - Intergenic
946076032 2:217074415-217074437 CACACACACCTGCCCCTGGCAGG + Intergenic
947605771 2:231484142-231484164 CACCCACAGCGCCCCCACGCTGG - Intergenic
947732340 2:232438389-232438411 CCTCCACCCCTCCCCCAGACAGG + Intergenic
947804813 2:232958876-232958898 CACCCACTCCTCCCCAGGCCTGG + Intronic
948489576 2:238303811-238303833 CACACACACACCCCCCACACTGG - Intergenic
948606785 2:239140970-239140992 CACCCACAGCTCCCCCAACCTGG + Intronic
948825990 2:240573662-240573684 CACCCACACCTCACCCAGCCTGG - Intronic
948915797 2:241034550-241034572 CCCCCACCCCACCCCCAGGCTGG + Exonic
949023172 2:241752761-241752783 CCCCCACACCACCCCCAGGAGGG + Intronic
1169208678 20:3753946-3753968 CCCCCACACCCACCCCAGAGAGG + Exonic
1171051352 20:21862282-21862304 CACCCACACTTACACCTGACTGG - Intergenic
1171191028 20:23159580-23159602 CACCCACCCCACCCCCAGGCTGG - Intergenic
1171358005 20:24565518-24565540 CACCCAAACATCACCCAGCCTGG - Intronic
1172602905 20:36195919-36195941 GTCCTACACCTCCCCCAGGCAGG + Intronic
1172918364 20:38461280-38461302 CCCCCACCTCTCTCCCAGACGGG + Intergenic
1173307254 20:41862360-41862382 TACCCACCCTTCCCCCAGCCTGG - Intergenic
1174338726 20:49882962-49882984 CACCAGGACCTTCCCCAGACAGG - Intronic
1174475056 20:50790701-50790723 CACCCCCACTCCCCCCAGGCTGG + Intergenic
1174695159 20:52549683-52549705 CATCCCCACCTCCCCCACCCCGG - Intergenic
1174880533 20:54274376-54274398 CCCCCACCCCACCCCCTGACAGG + Intergenic
1175117690 20:56694607-56694629 CCCCAACACCTCCCAAAGACTGG - Intergenic
1176025370 20:62982846-62982868 CACCGGCACCTCCCCCGGCCAGG - Intergenic
1177178377 21:17720319-17720341 CCCCCCCACCTCCTCCGGACGGG + Intergenic
1178821483 21:35978955-35978977 CACCCACAACTGCCCCACATAGG + Intronic
1179005846 21:37513318-37513340 CACTCAGACCTCCCCAGGACTGG - Intronic
1179930774 21:44569517-44569539 CACACACCCCTGCCCCAGCCAGG - Intronic
1180064856 21:45407078-45407100 CACACACCCCTCCCCCAGCCCGG + Intronic
1180560942 22:16613818-16613840 CAGCCACACCTCCTGCATACAGG + Intergenic
1181607023 22:23986745-23986767 CACACACACCTCACACACACAGG - Intergenic
1181620840 22:24090154-24090176 CCCCCACCCCTTCCCCATACAGG - Intronic
1182145223 22:27993273-27993295 CACCCACAGCTCACCCAGCAGGG + Exonic
1183201151 22:36386955-36386977 CCCCCGCACCCCGCCCAGACGGG + Intronic
1183247983 22:36708707-36708729 CACCCACTCCTCTCCCAGGCTGG - Intergenic
1184275109 22:43405523-43405545 CACCCTCACCCACACCAGACAGG - Intergenic
1184945010 22:47796556-47796578 CACCCCCACCTCAGCCAAACTGG - Intergenic
1185096052 22:48806634-48806656 CACCACCACCTGCCCCAGTCAGG - Intronic
1185281731 22:49972581-49972603 CGCCCCCACCTCCTCCAGTCTGG + Intergenic
949454001 3:4219089-4219111 CCCCCATACCACCCCCACACAGG + Intronic
950098284 3:10342715-10342737 CACCCACGCCTCTCCCAGGCGGG - Intronic
950148743 3:10669763-10669785 CACCCCCACCCCCCAGAGACAGG + Intronic
950473759 3:13203234-13203256 CACACACAACTCACCCACACAGG + Intergenic
950681585 3:14588814-14588836 CCCCCACACCTCCCACACAGGGG + Intergenic
950942212 3:16904372-16904394 CACACACACATACCCCAAACCGG - Intronic
953145445 3:40270662-40270684 TGCCCACAACTCTCCCAGACTGG + Intergenic
954065146 3:48099908-48099930 CACCTACCCCTCCCTCAGGCAGG + Intergenic
954440174 3:50517423-50517445 CACCCACTCCTGCCTCAGAGAGG - Intergenic
955260017 3:57378951-57378973 CACCCACACCAGCCCCAACCAGG + Intronic
955350405 3:58189275-58189297 CACCCACCCCACCCCCAGCAGGG + Intergenic
955957444 3:64305062-64305084 CAGCCAGGCCTCACCCAGACAGG + Intronic
957289407 3:78258838-78258860 CACCCACACCCTCCCCAAAGAGG - Intergenic
958141717 3:89570914-89570936 CCCCCCCACCTCCCCGTGACTGG - Intergenic
959419295 3:106111734-106111756 CCCCCCCACCTCCTCCGGACGGG + Intergenic
959823824 3:110769256-110769278 CAGACACCCCTCCCCCAGCCTGG - Intergenic
960109678 3:113833486-113833508 CACCAACACCTGCCCAAGGCAGG + Intronic
960905182 3:122593732-122593754 CAGCCCCACCTGCCCCAAACTGG + Intronic
960970878 3:123139323-123139345 CACCCACGGCTCCCCAAGACAGG + Intronic
961077120 3:123992346-123992368 CACCCCCAACGCCCCCAGCCCGG - Intergenic
961307456 3:125968954-125968976 CACCCCCAACGCCCCCAGCCCGG + Intergenic
963296099 3:143548286-143548308 CACCCCCACCACCCCCAGACAGG - Intronic
963306865 3:143662739-143662761 CAGACACCCCTCCCCCAGCCTGG - Intronic
965770186 3:172173812-172173834 GCCCCACCCCTCCCCCAGACAGG - Intronic
966015339 3:175132440-175132462 CCCCCCCACCTCCTCCGGACGGG + Intronic
966341555 3:178930583-178930605 CACACACACCCTCCCAAGACTGG + Intergenic
966828834 3:183988533-183988555 CACCCTCATCTCCCCCATGCCGG - Intronic
966871425 3:184292476-184292498 CACCCAGACCTCTTCCAGGCAGG - Exonic
966919605 3:184603015-184603037 CTCCCACACCTCCCACACCCAGG - Intronic
967095835 3:186176538-186176560 CTCCCACACCTCCCCCATTCTGG - Intronic
968092864 3:195909259-195909281 CCCCCACACCACCCCCCGGCTGG + Intronic
968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG + Intergenic
968522723 4:1041294-1041316 CACCCTCACCACCTCAAGACTGG - Intergenic
968644492 4:1732772-1732794 CACCCACACCTGCTCCAGCATGG - Intronic
968914058 4:3489483-3489505 CACCCACACCACCCCTATCCAGG - Intronic
968981836 4:3854470-3854492 CAGCCCCACCACCCCCAGGCTGG - Intergenic
969876815 4:10141528-10141550 CCCCCACCCCTCCCCCAGGGAGG - Intergenic
971467142 4:26975957-26975979 CACACACCCCTCCCCAAGCCAGG + Intronic
972554192 4:40164491-40164513 CACCCAGACTTCCAGCAGACTGG - Intergenic
973210482 4:47609753-47609775 CACCCACCCCTACCCCCAACAGG + Intronic
973945217 4:55948686-55948708 GATCCACACCTCCCGCCGACAGG + Intergenic
975844009 4:78506458-78506480 CAGACACCCCTCCCCCAGCCAGG + Intronic
976078391 4:81325155-81325177 CCCCCACCCCACCCCCTGACAGG - Intergenic
976741084 4:88358287-88358309 CACCCACCCCTGCCCCAGTGGGG + Intergenic
977582157 4:98737207-98737229 CCCCCACCCCGCCCCCTGACAGG + Intergenic
977656996 4:99534134-99534156 CTCCCCCAACTCCCCCTGACAGG + Intronic
979335298 4:119455145-119455167 CCACAACACCTCCCCCAGGCAGG + Intergenic
979785737 4:124712941-124712963 CCCCCACGCCGCCCCGAGACAGG - Intergenic
980990403 4:139734633-139734655 CACCCTTACCTCCCCCAAACAGG + Intronic
981410176 4:144420681-144420703 CACCCCCACCTTCCCCTGACAGG + Intergenic
983019420 4:162656455-162656477 CCCCCACCCCACCCCCCGACAGG - Intergenic
984552878 4:181181785-181181807 CACATACTCCTCACCCAGACTGG + Intergenic
984866262 4:184283287-184283309 CACTCACACTGCCCCCAGATGGG - Intergenic
984941164 4:184933386-184933408 CAGCCACACATCCTGCAGACAGG - Intergenic
986346150 5:6837206-6837228 CACCTCCATCTCCCCCAGATTGG + Intergenic
988121165 5:26964782-26964804 CACCCCCACCACCCCCCAACAGG + Intronic
989387300 5:40866525-40866547 CACCCAGACCTCACCCAGACTGG - Intergenic
990581835 5:57173588-57173610 CTCCCGCACCTCCCCCCGTCCGG - Intergenic
991422401 5:66454593-66454615 CAGCCCCGCCTCCCCCAAACTGG - Intergenic
992173605 5:74127830-74127852 CACGCACACATGCCCCAGCCTGG + Intergenic
992841371 5:80698534-80698556 CTCTCACACCTCCACCTGACTGG - Intronic
993280642 5:85920880-85920902 AACCCACAGCCCCACCAGACTGG + Intergenic
993938993 5:94035849-94035871 TACCCCCTCCTCCCCCCGACAGG - Intronic
995039019 5:107567559-107567581 CACCCACCCCTGCCCCAGGTTGG + Intronic
995545704 5:113228336-113228358 CACACACACCACCCCCCGAATGG + Intronic
995670613 5:114598445-114598467 CAGACACCCCTCCCCCAGCCAGG - Intergenic
996426611 5:123320163-123320185 CAGACACCCCTCCCCCAGCCAGG + Intergenic
997513199 5:134466812-134466834 CACCGGCACCTCCCACAGGCGGG - Intergenic
999155920 5:149457552-149457574 CAGACACACATCCCCCAGGCTGG + Intergenic
999559758 5:152788010-152788032 CAGACACCCCTCCCCCAGCCAGG - Intergenic
1000003530 5:157162743-157162765 CACCCACAGCTCCACCAAAAAGG - Exonic
1001383344 5:171318218-171318240 CGCCCCCACCACCCCCAGTCAGG + Intergenic
1001588367 5:172848914-172848936 CACCCACCCCTCCTTCAGGCAGG - Intronic
1001717149 5:173825507-173825529 CAACCAGTCCTCCCCCAGGCTGG - Intergenic
1001848056 5:174938953-174938975 CCTCAACACCACCCCCAGACGGG - Intergenic
1002301568 5:178260105-178260127 CACCCACACCCTCCCCAAAGAGG + Intronic
1002594923 5:180315859-180315881 CCCCCACACCTCCCCCTGCTGGG + Intronic
1002702132 5:181131564-181131586 CTCCCACTCCTCTCCCACACCGG + Intergenic
1005371395 6:25137358-25137380 CACACACACATACCCCAGAGAGG + Intergenic
1006162955 6:32048598-32048620 CACCGCCAGCTCCCCCAGGCGGG + Intronic
1006166857 6:32070359-32070381 CACCCACAGCTCCCCAAGGCGGG + Intronic
1006374101 6:33662438-33662460 CAGCCCCACCTGCCTCAGACAGG - Intronic
1006460049 6:34152909-34152931 CACCTACTCCACCCCCAGCCTGG - Intronic
1007113257 6:39325827-39325849 CCATCACACCACCCCCAGACAGG - Intergenic
1007302226 6:40876034-40876056 CCCCCAGCCCTCCCCCAGGCAGG - Intergenic
1007363886 6:41376420-41376442 CAGCCCCACCTCCCCCACCCCGG + Intergenic
1010017046 6:71116966-71116988 CCCCCACACCTCCCCCACTCTGG - Intergenic
1010661212 6:78572617-78572639 CACCCCCACCCCCCACAGACAGG - Intergenic
1011291540 6:85781982-85782004 CACCCATACTTCTACCAGACTGG + Intergenic
1011530493 6:88315729-88315751 CACCCTGACCTCGCCCAGCCAGG - Intergenic
1011610640 6:89146710-89146732 CACACACACCTGCCCCGGGCGGG - Intronic
1012202993 6:96429089-96429111 CACCCACCCCACCCCCCAACAGG + Intergenic
1014085369 6:117336320-117336342 CCCCCACCCCTCCCCCTGACAGG + Intronic
1014489223 6:122041913-122041935 GGACCACACCTCCCCAAGACAGG + Intergenic
1014698863 6:124658268-124658290 CAGTGACACCTGCCCCAGACTGG + Exonic
1015533459 6:134244120-134244142 CTCCCACCCCACCCCCTGACAGG + Intronic
1017234810 6:152108311-152108333 CACCCTTACCTCCCCCAGTTTGG - Intronic
1017810711 6:157981762-157981784 CGCCCTCACCTGCCCCAGGCTGG + Intergenic
1019259492 7:72899-72921 CACCCACACCTCCCCTGGGCCGG - Intergenic
1019365395 7:630166-630188 CACCCCCACCTCCCCCTTCCAGG + Intronic
1019509692 7:1411652-1411674 CGCCCACACCGCCCGCACACAGG - Intergenic
1019559927 7:1650927-1650949 TGCCCACCCCTCCCCCAGGCTGG + Intergenic
1019736772 7:2653964-2653986 CACACACACCGCCCCAGGACTGG + Intronic
1020276538 7:6628143-6628165 CCCCCACACCTCCCCCATGAAGG + Intergenic
1021639940 7:22727330-22727352 CACACACCCCTCCCTCACACAGG - Intronic
1021783548 7:24130265-24130287 CACCCACACCTCTCCCACCATGG + Intergenic
1022296686 7:29062214-29062236 CACCCATACCACCACCAGCCTGG - Intronic
1022690622 7:32648912-32648934 CAGCCACCCCTCCCCCAACCTGG + Intergenic
1022918179 7:34982754-34982776 CAGCCACCCCTCCCCCAACCTGG + Intronic
1023238654 7:38118020-38118042 CACACACACCCTCCCAAGACTGG - Intergenic
1023865203 7:44235107-44235129 CACCCACCCCTACCCCAGGAAGG - Intronic
1024260254 7:47568984-47569006 CACCCACTCCTCCTCCAGGCAGG + Intronic
1025990612 7:66494033-66494055 CCCCAACTCCTCCCCCAGCCAGG + Intergenic
1026038137 7:66844556-66844578 CCCCAACACCTCCTCCAGCCAGG - Intergenic
1027213270 7:76167026-76167048 CCCCAACTCCTCCCCCAGCCAGG + Intergenic
1029017590 7:97330154-97330176 CAGACACCCCTCCCCCAGCCAGG - Intergenic
1029346193 7:99980494-99980516 CACACACACCTCCCACACACTGG + Intergenic
1029503761 7:100949833-100949855 CACCGCCCCCTCCCCCAGTCAGG - Intronic
1029558984 7:101290021-101290043 CACACACACCTCCCACACACTGG - Intergenic
1030708915 7:112726262-112726284 AACACAGACCTCCCACAGACGGG + Intergenic
1032500308 7:132394995-132395017 CAGCCACACCTGCCCCGGAAAGG - Intronic
1033216133 7:139495046-139495068 CACTCACACCCTCCCCAGTCTGG + Intergenic
1035357400 7:158284701-158284723 TACCCACACCTCCCGCAGGAAGG + Intronic
1036029510 8:4952160-4952182 CACACACACCTCTCCTACACAGG + Intronic
1036660482 8:10705186-10705208 CACCCACCACACCCCCAGCCAGG + Intronic
1037620998 8:20563361-20563383 CAAACACACCTGCCCCAGATTGG + Intergenic
1037812656 8:22096218-22096240 TTCCCCCACCTCTCCCAGACAGG + Intronic
1038451347 8:27641278-27641300 TCCCCATCCCTCCCCCAGACTGG + Intronic
1041714308 8:60920381-60920403 CACTCACACATCCACCACACCGG + Intergenic
1043568279 8:81571490-81571512 CGCCCACACCTCCCCCACTGTGG + Intergenic
1047847917 8:128826115-128826137 CCCCCCCACCTCCTCCGGACGGG + Intergenic
1048093145 8:131262521-131262543 CAGGCACCCCTCCCCCAGCCTGG - Intergenic
1048969323 8:139635750-139635772 CACCCACAACCCCCCCACTCAGG + Intronic
1048973440 8:139657864-139657886 CACCCACATCACCCCCATCCAGG + Intronic
1049828420 8:144685146-144685168 CACTCACACCTCCCTCGGGCAGG + Intergenic
1049830687 8:144699389-144699411 CACCCACAGCACCCCCACACCGG - Intergenic
1051122505 9:13766557-13766579 CACCCATCCCTCCCAGAGACTGG + Intergenic
1051170442 9:14314990-14315012 CACCCAGGCCGCCCCCAGGCCGG + Intronic
1052991678 9:34522383-34522405 CACACACACCTGACCCAGAGAGG - Intronic
1054158711 9:61658960-61658982 CCGCCTCACCTCCCCCAGCCTGG + Intergenic
1054478485 9:65589965-65589987 CCGCCTCACCTCCCCCAGCCTGG + Intergenic
1056539483 9:87558967-87558989 TACCCTCCCCTCCCCCAGAGTGG - Intronic
1057008849 9:91583974-91583996 CACCCACTCCCCTCCCTGACAGG + Intronic
1057035814 9:91811144-91811166 TTCCCACACCTCCCCTAGGCCGG + Intronic
1057037848 9:91824748-91824770 CACACACAGCTCTCCCAGGCGGG + Intronic
1059108816 9:111535223-111535245 CACTCACACCTCCCCCTGCGGGG - Intronic
1059194149 9:112354980-112355002 CACCCACATCTCCCAAAGACAGG - Intergenic
1059418235 9:114175205-114175227 CTCCTCCACCTCCCCCAGGCAGG + Intronic
1059526981 9:115001101-115001123 CCCCCACCCCACCCCCCGACAGG + Intergenic
1060226188 9:121792505-121792527 CAGCCACACCTCCTGCATACAGG + Intergenic
1060404474 9:123366389-123366411 CACCTACCCCTCCCCCCGCCAGG - Intronic
1061452390 9:130675349-130675371 CAGCCCCATCTCCCCCAGAAGGG - Intronic
1062020454 9:134316918-134316940 CAGCCACCCCTCCCCCAGGCAGG - Intergenic
1062236912 9:135514796-135514818 CACCCACTCCCACCCCAGAGAGG + Intergenic
1062352965 9:136148167-136148189 CACCCACACTGCCCCCTGCCTGG + Intergenic
1062610744 9:137372351-137372373 CTCCCACAGCACCCCCAGAGTGG - Intronic
1062745210 9:138207564-138207586 CACCCACACCTCCCCTGGGCCGG + Intergenic
1203562679 Un_KI270744v1:71706-71728 CCCCCACATCCCTCCCAGACGGG - Intergenic
1203654512 Un_KI270752v1:10068-10090 CGCCCCCCCCACCCCCAGACAGG - Intergenic
1185480197 X:440447-440469 CAGACACACCCCCCCCACACAGG + Intergenic
1186344312 X:8675856-8675878 CCCCCACCCCACCCCCCGACAGG + Intronic
1186349287 X:8727228-8727250 CACCCTCACCTCTCCAGGACAGG + Intronic
1186714428 X:12235220-12235242 CAGCCACATCTCCCCCAGAAGGG - Intronic
1189017671 X:37301285-37301307 CAGACACCCCTCCCCCAGCCAGG + Intergenic
1189210500 X:39278369-39278391 CCCCCACCTCTCTCCCAGACGGG - Intergenic
1190942145 X:55052509-55052531 CAGGCACCCCTCCCCCAGCCTGG + Intergenic
1192162295 X:68797527-68797549 CACCCACACCTCAGCTAGAATGG + Intergenic
1194278167 X:91913205-91913227 CTCCCTCCCATCCCCCAGACTGG - Intronic
1194772409 X:97921453-97921475 CAGACACCCCTCCCCCAGCCAGG - Intergenic
1196502355 X:116400276-116400298 CAACCACCCCACCCCCCGACAGG + Intergenic
1198506252 X:137303935-137303957 CACCCACACCTACCCTCGCCTGG - Intergenic
1199758728 X:150889188-150889210 CACCCACAGTGCCCCCACACGGG + Intronic
1199925747 X:152461825-152461847 CACCCCCACCCTCCCCTGACAGG - Intergenic
1200413784 Y:2887404-2887426 CACCACCACCACCCCCACACTGG - Intronic
1200595505 Y:5135280-5135302 CTCCCTCCCGTCCCCCAGACTGG - Intronic
1202014503 Y:20386262-20386284 CAGGCACCCCTCCCCCAGCCTGG + Intergenic