ID: 1083571996

View in Genome Browser
Species Human (GRCh38)
Location 11:63765923-63765945
Sequence TGGGATGCACACCTGGGGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 412}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083571996_1083572004 6 Left 1083571996 11:63765923-63765945 CCCAGCCCCAGGTGTGCATCCCA 0: 1
1: 0
2: 1
3: 35
4: 412
Right 1083572004 11:63765952-63765974 GCTGATGACTTCCTTCTCCCGGG 0: 1
1: 0
2: 5
3: 24
4: 258
1083571996_1083572003 5 Left 1083571996 11:63765923-63765945 CCCAGCCCCAGGTGTGCATCCCA 0: 1
1: 0
2: 1
3: 35
4: 412
Right 1083572003 11:63765951-63765973 TGCTGATGACTTCCTTCTCCCGG 0: 1
1: 0
2: 2
3: 29
4: 236
1083571996_1083572005 7 Left 1083571996 11:63765923-63765945 CCCAGCCCCAGGTGTGCATCCCA 0: 1
1: 0
2: 1
3: 35
4: 412
Right 1083572005 11:63765953-63765975 CTGATGACTTCCTTCTCCCGGGG 0: 1
1: 0
2: 2
3: 9
4: 152
1083571996_1083572007 21 Left 1083571996 11:63765923-63765945 CCCAGCCCCAGGTGTGCATCCCA 0: 1
1: 0
2: 1
3: 35
4: 412
Right 1083572007 11:63765967-63765989 CTCCCGGGGACTCCAATGCAAGG 0: 1
1: 0
2: 0
3: 7
4: 95
1083571996_1083572012 29 Left 1083571996 11:63765923-63765945 CCCAGCCCCAGGTGTGCATCCCA 0: 1
1: 0
2: 1
3: 35
4: 412
Right 1083572012 11:63765975-63765997 GACTCCAATGCAAGGAGTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 126
1083571996_1083572011 28 Left 1083571996 11:63765923-63765945 CCCAGCCCCAGGTGTGCATCCCA 0: 1
1: 0
2: 1
3: 35
4: 412
Right 1083572011 11:63765974-63765996 GGACTCCAATGCAAGGAGTAGGG 0: 1
1: 0
2: 0
3: 6
4: 108
1083571996_1083572010 27 Left 1083571996 11:63765923-63765945 CCCAGCCCCAGGTGTGCATCCCA 0: 1
1: 0
2: 1
3: 35
4: 412
Right 1083572010 11:63765973-63765995 GGGACTCCAATGCAAGGAGTAGG 0: 1
1: 0
2: 0
3: 13
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083571996 Original CRISPR TGGGATGCACACCTGGGGCT GGG (reversed) Exonic
900158014 1:1211300-1211322 TGGGCTGCACACCTGTGGCATGG - Intergenic
900421537 1:2557939-2557961 TGTGATGAAGCCCTGGGGCTAGG + Intronic
900712586 1:4123749-4123771 TGAGCTGCCCCCCTGGGGCTTGG - Intergenic
901202241 1:7473337-7473359 TAGGAGGAACAGCTGGGGCTGGG + Intronic
901370674 1:8794903-8794925 TGGGATGATCACCTGAGCCTGGG - Intronic
901976854 1:12951947-12951969 AAGGATGCACACTTGGGGCCTGG - Intronic
902008316 1:13249823-13249845 AAGGATGCACACTTGGGGCCTGG + Intergenic
902027286 1:13393590-13393612 AAGGATGCACACTTGGGGCCTGG + Intergenic
903067217 1:20706794-20706816 TGGGATGATCACCTGAGCCTAGG + Intronic
904000547 1:27336182-27336204 TGAGGTCCACACCTGGGGCTGGG - Exonic
904183737 1:28686246-28686268 TGGGATGATCACCTGAGCCTAGG + Intronic
904228451 1:29045444-29045466 TGGGAGGATCACCTGGGCCTGGG - Intronic
904311977 1:29634937-29634959 TGGGATCCGTCCCTGGGGCTTGG + Intergenic
904605175 1:31694290-31694312 TGGGAAGCAGAGCAGGGGCTGGG - Intronic
904992329 1:34603096-34603118 TGGGAGGCACGTCAGGGGCTGGG + Intergenic
906308381 1:44735887-44735909 TGGGAGGATCACCTGGGCCTGGG - Intergenic
907831712 1:58070654-58070676 TGGGATGCAGGCCTGTGGCTAGG + Intronic
908004869 1:59717555-59717577 TGGGATGAACACCCAGAGCTTGG + Intronic
908097850 1:60759078-60759100 TGGTGTGCACACTGGGGGCTGGG - Intergenic
910173571 1:84403877-84403899 TGGGAGGGTCACCTGGGCCTGGG - Intronic
910440914 1:87250828-87250850 TGGGTGGAACACCTGAGGCTAGG + Intergenic
910811169 1:91238296-91238318 TGGGATGATCACCTGAGTCTGGG - Intergenic
912530612 1:110318450-110318472 TGAGATGGACACCTGTGGCAGGG - Intergenic
912770929 1:112463788-112463810 TGGGATCCGCACCTAGGGCATGG - Intergenic
912964798 1:114228140-114228162 TGGGATGTACCCCAGGAGCTGGG - Intergenic
913184438 1:116356164-116356186 TGGGAGGATCACCTGGGCCTGGG + Intergenic
913530257 1:119729018-119729040 TGGGATGCTCACCAGGCTCTAGG - Intronic
913712235 1:121496825-121496847 TGGGAAGATCACCTGAGGCTAGG - Intergenic
914892243 1:151636391-151636413 TGGGAAGAACACCTGAGCCTGGG - Intronic
915410704 1:155699704-155699726 TGGGAGGATCACCTGGGCCTGGG - Intronic
915957314 1:160232277-160232299 TGGGAGGAACACTTGAGGCTAGG + Intronic
916715450 1:167443347-167443369 GGGCAGGCACACCTGGGGCTGGG - Intronic
916743929 1:167669879-167669901 TGGGATGCAGACCGGGGGCTGGG + Intronic
917787551 1:178475044-178475066 TGGAATGCAAGCCTGGGACTTGG - Intronic
919225021 1:194686614-194686636 TGGGAGGATCACCTGAGGCTGGG - Intergenic
919395064 1:197035825-197035847 TGGGCTTCACACCTGGGGAAGGG + Intergenic
920596051 1:207271169-207271191 TGGGATTCTCACCTGGGCCCTGG - Intergenic
922744267 1:228035555-228035577 AGGGATGCACACATGGGGACCGG - Intronic
922770995 1:228182815-228182837 TTGGATGCCCAGCTGGGGGTAGG + Intergenic
923097947 1:230790271-230790293 TGGGAAGCAGATCTGCGGCTCGG - Intronic
923570411 1:235108317-235108339 TGGGAGGATCACCTGAGGCTAGG - Intergenic
1063499671 10:6542060-6542082 TGGGATGCACACATGGACCCCGG + Intronic
1065312680 10:24431476-24431498 GGGGTAGCTCACCTGGGGCTGGG + Intronic
1065688623 10:28310227-28310249 TGGGCTGCTCACCTGAGGCCAGG - Intronic
1066063358 10:31744046-31744068 TGGGAGGATCACCTGGGCCTGGG - Intergenic
1067465021 10:46491329-46491351 AGGGTTGCACAGCTGGGACTGGG + Intergenic
1067622167 10:47893272-47893294 AGGGTTGCACAGCTGGGACTGGG - Intergenic
1067789599 10:49277757-49277779 AGAGATGCACAGCTGGGTCTGGG - Intergenic
1068386139 10:56330281-56330303 TCTGAGTCACACCTGGGGCTGGG + Intergenic
1069557363 10:69407015-69407037 AGGGGAGCCCACCTGGGGCTGGG + Intronic
1070025585 10:72628334-72628356 TGGGATGATCACGTGAGGCTAGG + Intergenic
1072742099 10:97915605-97915627 TGGGGTCCATTCCTGGGGCTCGG + Intronic
1072895366 10:99362041-99362063 TGAGATGCACACTTGGGATTAGG + Intronic
1072966544 10:99978669-99978691 TGGGATGATCACCTGAGTCTGGG - Intronic
1075444887 10:122506266-122506288 TGGGATCCTTCCCTGGGGCTTGG + Intronic
1076127395 10:127985861-127985883 TGGGAGGATCACCTGGGGCCAGG + Intronic
1076324909 10:129613688-129613710 TGGGATGCACACAGGAGTCTTGG + Intronic
1077057683 11:603146-603168 TGGGAGGATCACCTGGGCCTGGG - Intronic
1077107496 11:848428-848450 TGGGGTGCTGCCCTGGGGCTTGG + Intronic
1077435271 11:2535922-2535944 TGGGATGCACAGCTGGGGGCAGG + Intronic
1078085656 11:8231770-8231792 TGGGAGGGACACCAGGGGATGGG - Intronic
1078389991 11:10929091-10929113 TGGGAAGGAGACCTGGGCCTTGG + Intergenic
1078428317 11:11268845-11268867 TGGGGTGCACACGTGGATCTGGG + Intergenic
1083171758 11:60927498-60927520 TGGGGAGCACAGCCGGGGCTGGG - Intronic
1083571996 11:63765923-63765945 TGGGATGCACACCTGGGGCTGGG - Exonic
1083857967 11:65403009-65403031 GGTGGTGCACACCTGTGGCTTGG - Intronic
1083994692 11:66266207-66266229 TGGGGGGCTCACCTGGGGTTAGG - Exonic
1084289197 11:68151009-68151031 GGGGCTGCGCAGCTGGGGCTGGG + Intergenic
1084391918 11:68882936-68882958 AGAGAAGCACACCTGGGGCTGGG - Intergenic
1086093806 11:83030568-83030590 TGGGCAGAACACCTGAGGCTAGG + Intronic
1086529295 11:87764706-87764728 TGGGATGATCACCTGAGCCTAGG - Intergenic
1088901742 11:114123272-114123294 TGGGATCCACTCTTGGGCCTTGG + Intronic
1089305794 11:117525292-117525314 TGGGATTCCCAGCAGGGGCTGGG + Intronic
1089655570 11:119944462-119944484 TGAGAAGCAGACCTGGGGGTTGG + Intergenic
1091171029 11:133519907-133519929 TGTGAGACAGACCTGGGGCTGGG + Intronic
1091998194 12:5011676-5011698 TGGGAGGGTCACCTGGGCCTGGG + Intergenic
1092467695 12:8748215-8748237 TGGGAAGCAAAACTGTGGCTAGG - Intronic
1092989395 12:13880386-13880408 GGGGATGCTCAGCTGGCGCTCGG + Intronic
1093400103 12:18735465-18735487 TGGGAGGATCACTTGGGGCTAGG - Intronic
1094467249 12:30766517-30766539 TGGGATGAATACCTGGAGGTGGG - Intergenic
1094864950 12:34521622-34521644 GAGAATGCACACCTGGGGGTGGG + Intergenic
1094865941 12:34530197-34530219 GAGAATGCACACCTGGGGGTGGG + Intergenic
1097194607 12:57236556-57236578 TGGGATGCTCACGGGGGCCTGGG - Intronic
1098994702 12:77105611-77105633 TGGGAGGATCACCTGAGGCTGGG + Intergenic
1100192969 12:92212553-92212575 TGGGATGATCACTTGGGCCTAGG + Intergenic
1100562189 12:95758655-95758677 TGGGAGGTACACCTGGGCCCAGG - Intronic
1100823222 12:98451263-98451285 TGGGAGGATCACCTGGGCCTAGG + Intergenic
1102397283 12:112597502-112597524 TGGGATGATCACCTGCGTCTGGG + Intronic
1104319339 12:127735710-127735732 TGTTATGCACACCTGAGACTGGG + Intergenic
1104714154 12:131005556-131005578 CGGGATGCACTCGTGGGGCAAGG + Intronic
1104960594 12:132486888-132486910 TGGGTGGCACAGCTGAGGCTGGG + Intergenic
1105280224 13:18958950-18958972 TGGGCTGGACCCCTGGGGATGGG - Intergenic
1105359200 13:19691428-19691450 TGGGATGATCACTTGGGCCTAGG + Intronic
1107079036 13:36354507-36354529 AGGGATGCTCACCTGAGCCTTGG - Intronic
1108182636 13:47855881-47855903 TGGGAGGATCACCTGGGCCTGGG - Intergenic
1111661705 13:91220406-91220428 TGGGAGGATCACCTGGGCCTGGG + Intergenic
1112008734 13:95276558-95276580 TGGGTTCCACAGCTGGGGATTGG - Intronic
1112225474 13:97535454-97535476 TGGGAGGCCCAGCTGGGGCCAGG + Intergenic
1112933956 13:104776374-104776396 TGGGAGGAACACCTGAGTCTAGG - Intergenic
1115267002 14:31510820-31510842 TGGGATGATCACTTGAGGCTGGG + Intronic
1115563280 14:34602196-34602218 TGGGAGGATCACCTGAGGCTGGG + Intronic
1117285613 14:54283115-54283137 GGGGAGGCACAGCTGGGGCTGGG - Intergenic
1117979667 14:61329977-61329999 CTGGATGCTCACCTAGGGCTTGG - Intronic
1118274632 14:64374819-64374841 TGGGAGGATCACCTGGGCCTGGG - Intergenic
1118871682 14:69748332-69748354 TGGGAGGCTCACCTGAGCCTGGG - Intronic
1120969167 14:90192972-90192994 TGGGAGGCTCACCTGAGGCCGGG + Intergenic
1122323104 14:100867212-100867234 GAGGGTGCACACCTAGGGCTGGG - Intergenic
1122746273 14:103898928-103898950 GAGGCTGCATACCTGGGGCTGGG - Intergenic
1122816706 14:104317488-104317510 TGGGATTGACTTCTGGGGCTTGG + Intergenic
1123989886 15:25675562-25675584 TGAGATGAACCCCAGGGGCTGGG + Intergenic
1124957436 15:34368435-34368457 TGGGAGGCTCACTTGAGGCTAGG - Intergenic
1125614418 15:40997182-40997204 TGGGAGGATCACCTGAGGCTGGG + Intronic
1125660369 15:41389678-41389700 TGGGAGGATCACCTGAGGCTGGG + Intronic
1127497234 15:59524631-59524653 GGGGCTGAACACCTGGGGATGGG + Intergenic
1128072178 15:64804644-64804666 TGGGACACACCCGTGGGGCTTGG - Intergenic
1128139085 15:65286408-65286430 TGGGATGCAGCCCTCAGGCTGGG - Exonic
1129342815 15:74897283-74897305 TGTGGAGGACACCTGGGGCTGGG + Intronic
1129769571 15:78194454-78194476 TGGGAGGCACATCTGGGGAGGGG + Intronic
1129794732 15:78367466-78367488 TGGGAGGATCACCTGGGCCTGGG + Intergenic
1130996250 15:88905987-88906009 TGGGAGGCAGAGGTGGGGCTGGG + Intronic
1131307149 15:91255056-91255078 TGTGTTGCACACCTGTGGTTTGG - Intronic
1131465441 15:92651274-92651296 TGGGGTGTACACCTGGGAGTGGG - Intronic
1132599058 16:765826-765848 TGGGCAGCACCCCTGGGGGTGGG + Intronic
1133164322 16:3935987-3936009 TGTGATGTGCACCAGGGGCTTGG + Intergenic
1133863664 16:9620851-9620873 TGGGAGGATCACCTGGGCCTGGG + Intergenic
1134659580 16:15973890-15973912 TGGGATGATCACCTGGGCCTGGG + Intronic
1135356594 16:21774085-21774107 GAGGATTCACACCTGGGGCAAGG - Intergenic
1135455094 16:22590228-22590250 GAGGATTCACACCTGGGGCAAGG - Intergenic
1135715549 16:24762549-24762571 TGGGATCCAGAGCAGGGGCTGGG + Intronic
1135999787 16:27283420-27283442 TGGGAGGCGCACTTGAGGCTAGG + Intronic
1136543439 16:30942025-30942047 TGGGGTGCACCCTTGGAGCTGGG + Intronic
1137531218 16:49280251-49280273 TGGGACGCACAGCTGGGGAGAGG - Intronic
1138220319 16:55244878-55244900 TGGGAGGATCACCTGGGCCTGGG - Intergenic
1139891066 16:70253546-70253568 TGGGAGGCATACCTGGGCCAGGG - Intronic
1139912971 16:70409568-70409590 TGGGCGGAACACCTGAGGCTGGG - Intronic
1140843141 16:78860906-78860928 TGGGAGGATCACCTGGGCCTGGG - Intronic
1141627373 16:85268439-85268461 TAGGACCCACACCTGGGGCAGGG - Intergenic
1141874121 16:86809668-86809690 TCGGATGTGCAGCTGGGGCTGGG + Intergenic
1142172238 16:88628844-88628866 TGGGAGGCTCACCTCGGTCTGGG - Exonic
1142592393 17:1012087-1012109 TGGGATGGAGAGCTGGGGCGGGG + Intronic
1144776390 17:17787119-17787141 GGGCAGGCACTCCTGGGGCTTGG + Intronic
1144889335 17:18484972-18484994 TGGGAAGCCCTCCTGGTGCTGGG - Intronic
1145142874 17:20459324-20459346 TGGGAAGCCCTCCTGGTGCTGGG + Intronic
1145741560 17:27279271-27279293 TGGGAGGATCACCTGAGGCTAGG + Intergenic
1145793006 17:27639362-27639384 TGGGAAGCCCTCCTGGTGCTGGG - Intronic
1145964691 17:28908411-28908433 TGGGAAGATCACCTGAGGCTGGG - Intronic
1146411447 17:32589195-32589217 GGGGAGGCAGACCTGGGGCTTGG + Intronic
1146622229 17:34407861-34407883 TGTGATGCACACCAGGGACCTGG - Intergenic
1147008144 17:37421281-37421303 TGGGAGGAACACCTGAGCCTGGG + Intronic
1147114443 17:38288495-38288517 TGGGATGCTCTCCTGTGGCTGGG - Intergenic
1147570249 17:41566089-41566111 GGGGATGCTCAGCTGGGGCTGGG + Exonic
1148140690 17:45325850-45325872 TGGAATGCACACCCAGTGCTTGG + Intergenic
1148415166 17:47500704-47500726 TGGGATGCTCTCCTGTGGCTGGG + Intergenic
1148734192 17:49855568-49855590 TCGAAGGCAGACCTGGGGCTTGG + Intergenic
1148766072 17:50039044-50039066 TGAGAAACACACCTGGAGCTTGG - Intergenic
1149028600 17:52058794-52058816 TGGGATCCACACATGTGGATTGG - Intronic
1149610690 17:57955857-57955879 GAGGACGCACAGCTGGGGCTTGG + Intergenic
1149715009 17:58780405-58780427 TGGGAGGATCACCTGAGGCTGGG + Intronic
1150068844 17:62135354-62135376 TGGGCTGATCACCTGGGGTTGGG + Intergenic
1150141134 17:62729799-62729821 TGGGAGGATCACCTGGGGCCAGG - Intronic
1150216926 17:63476457-63476479 CGGCCGGCACACCTGGGGCTTGG - Intergenic
1150435471 17:65150855-65150877 TGGCAAGCACATCTGGGGCAGGG + Intronic
1151365899 17:73616337-73616359 TGGGATGCTGAGCTGGGGCTGGG - Intronic
1151736377 17:75943299-75943321 TGGGAGGGTCACCTGAGGCTAGG + Exonic
1151772079 17:76170319-76170341 TGGGAGGATCACCTGGGCCTAGG - Intronic
1151800321 17:76375703-76375725 TGGGCTGGACAGCTGGGGCTGGG - Intronic
1152210792 17:79001970-79001992 TGGGTGGGACACGTGGGGCTGGG - Intronic
1152266076 17:79295709-79295731 TGGGATGGACACAGGGTGCTGGG - Intronic
1152366620 17:79860212-79860234 TGGCAGGCGCAGCTGGGGCTTGG + Intergenic
1152494580 17:80661878-80661900 TGCGCTGCACACCAGGGCCTCGG + Intronic
1153623798 18:7004577-7004599 TGGGCGGATCACCTGGGGCTGGG - Intronic
1153747789 18:8198237-8198259 TGGGAGGATCACCTGGGCCTGGG - Intronic
1154277273 18:12973113-12973135 TGGGATGATCACCTGAGCCTGGG + Intronic
1154989347 18:21585683-21585705 TGGGATGATCACTTGGGGCCAGG - Intronic
1155131360 18:22937916-22937938 TGGGAGGAACACCTGAGCCTGGG - Intronic
1157602296 18:48901764-48901786 TGAGATGCAGACCTGGAGCCTGG + Intergenic
1158026737 18:52907507-52907529 TGGGAGGAACACCTGAGACTGGG - Intronic
1158863686 18:61617354-61617376 TGGGAGGATCACCTGGGCCTTGG - Intergenic
1160534799 18:79586092-79586114 AGGGAGGCACCCCCGGGGCTTGG - Intergenic
1161068038 19:2248018-2248040 GGGGATGCACCACTGGGGCCGGG - Exonic
1162440168 19:10687747-10687769 TGGGCTGCACTGCTGGGGCCTGG - Intronic
1162811822 19:13168746-13168768 TGGGATGATCACTTGAGGCTAGG + Intergenic
1162895249 19:13761558-13761580 TGGGATACCCACCTTGTGCTAGG - Intronic
1162985427 19:14266316-14266338 TGGGAGGCTCACCTGAGCCTAGG - Intergenic
1163179434 19:15588424-15588446 TGGAATGCACCCTTGGGGCTTGG + Intergenic
1163186525 19:15642672-15642694 TGGGATGCGCTCTTGGGACTTGG + Intronic
1163218217 19:15896343-15896365 TGGGATGCACCCTTGGGACTTGG - Intronic
1163417184 19:17193783-17193805 TGGGAGGATCACCTGGGCCTGGG + Intronic
1163419203 19:17204739-17204761 TGGGAGGATCACCTGGGCCTGGG + Intronic
1163510626 19:17733146-17733168 AGGGATGAGCTCCTGGGGCTGGG - Intronic
1164275285 19:23711903-23711925 TGGGAGGATCACCTGAGGCTGGG - Intergenic
1164455135 19:28400455-28400477 TGGGATTCACACCAGGGCCAAGG + Intergenic
1164713197 19:30373917-30373939 TGGGCTGCGGCCCTGGGGCTGGG - Intronic
1165139649 19:33691020-33691042 TGTGATGCCCACCTGGGACCAGG + Intronic
1165665400 19:37623233-37623255 GAGAATGCACACCTGGGGGTGGG + Intronic
1165736782 19:38182046-38182068 TGGGATGATCACTTGAGGCTGGG + Intronic
1165921746 19:39303245-39303267 TGGGATGATCACTTGAGGCTAGG - Intergenic
1165922482 19:39307694-39307716 GAGGATGGAGACCTGGGGCTGGG - Exonic
1165974072 19:39658782-39658804 TGTGATGAAAACCTGGGGCAGGG - Intronic
1166087401 19:40486196-40486218 TGGGAGGATCACCTGAGGCTGGG + Intronic
1166128874 19:40733465-40733487 TGGGATGAAAGGCTGGGGCTGGG + Intronic
1166993647 19:46708408-46708430 TGGGAGGATCACCTGGGCCTGGG - Intronic
1167065377 19:47181704-47181726 TGGGAGGATCACCTGAGGCTAGG - Intronic
1167485347 19:49759540-49759562 TGGGAGGATCACCTGGGCCTGGG + Intronic
1167569869 19:50280373-50280395 AGGGCTGCTCACCTGGGCCTGGG - Exonic
1167620637 19:50558321-50558343 TGGGAGGATCACCTGGGCCTGGG - Intronic
1168084422 19:54034867-54034889 TCGGATCCACAGCTGGGGTTTGG - Intergenic
925292765 2:2758733-2758755 AGGGATGCACACCTGGGTGCAGG + Intergenic
925584821 2:5454007-5454029 GGGGATGCAGAGCTGAGGCTGGG + Intergenic
925769931 2:7272015-7272037 TGGGAGGGTCACCTGAGGCTGGG + Intergenic
926186419 2:10694462-10694484 TGGGAGGCAGACTTGAGGCTGGG - Intergenic
926220287 2:10931715-10931737 TGGGAATGACATCTGGGGCTGGG + Intergenic
926767046 2:16330755-16330777 TGGGATGCAGAGATGGGGGTGGG - Intergenic
927148228 2:20180643-20180665 TGGGATGTACATCTGGGGTTCGG + Intergenic
928097195 2:28412070-28412092 TGGGCTGCAGCCCAGGGGCTGGG - Exonic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929946757 2:46377772-46377794 TGGAAGGCATGCCTGGGGCTAGG - Intronic
930161963 2:48167459-48167481 GAGAATGCACACCTGGGGGTGGG - Intergenic
931440454 2:62286808-62286830 TCACATGCACACCTTGGGCTGGG - Intergenic
932200471 2:69822266-69822288 TGGGATGATCACCTGAGGCTGGG + Intronic
933606285 2:84387840-84387862 TGTGATGGACACCTTGGGCTGGG + Intergenic
934676097 2:96250660-96250682 CGTGATGCACACTCGGGGCTGGG + Exonic
937313999 2:120919645-120919667 TGGGATTCACACCTGCAGCATGG + Intronic
937342582 2:121100798-121100820 TGAGATGCACGGCTGGAGCTGGG - Intergenic
937456449 2:122045497-122045519 TGGGATGATCACCTGAGGTTAGG + Intergenic
937686071 2:124698776-124698798 TGGGAGGCTCCCCAGGGGCTAGG - Intronic
938499571 2:131823356-131823378 TGGGCTGCGCACCTGGGGTCTGG - Intergenic
938772107 2:134509485-134509507 TGGCATGTAGACCTGGGGCTTGG - Intronic
939032377 2:137092318-137092340 TGGGAGGATCACCTGGGCCTGGG + Intronic
939792368 2:146593808-146593830 TGGGTTGTACACTTGGGGATGGG - Intergenic
942680375 2:178472300-178472322 TGGGTGGCTCACCTGAGGCTAGG - Intronic
945331833 2:208548750-208548772 TGGGTGGATCACCTGGGGCTGGG - Intronic
945580984 2:211594025-211594047 TGGGATTAACAGCTGTGGCTGGG - Intronic
946352960 2:219167647-219167669 TGGGAGGATCACCTGGGCCTGGG + Intronic
947589316 2:231376383-231376405 GAGAATGCACACCTGGGGGTGGG + Intergenic
947835199 2:233170168-233170190 AGGGCTGCCCGCCTGGGGCTGGG + Intronic
947919056 2:233854113-233854135 GGGGAAGCAGGCCTGGGGCTCGG - Intronic
948143301 2:235690315-235690337 TGGGGTGGACTCCTGGGGCTGGG + Intronic
948758707 2:240176375-240176397 TGGAATGGTCACCTGGGCCTGGG - Intergenic
1169060095 20:2654802-2654824 TGTAAAGCACAGCTGGGGCTGGG + Exonic
1169280722 20:4264667-4264689 GAGAATGCACACCTGGGGGTGGG - Intergenic
1172165701 20:32897725-32897747 TGGGAAGCTCATCTTGGGCTTGG + Intronic
1172487816 20:35309337-35309359 TGGGATGATCACCTGGGCCTGGG + Intronic
1172649227 20:36491340-36491362 TGGGCTAGATACCTGGGGCTGGG + Intronic
1172893646 20:38284468-38284490 TGGGATGATCACCTGGGCCTGGG + Intronic
1173252217 20:41370040-41370062 TGGGCCCCACATCTGGGGCTGGG - Intergenic
1173396886 20:42688438-42688460 TGGTGACCACACCTGGGGCTGGG - Intronic
1173502423 20:43563982-43564004 GGGGAGGGACACATGGGGCTAGG - Intronic
1173687273 20:44932393-44932415 TGGGATGTCCACCTGGGGGCAGG - Exonic
1174344468 20:49919786-49919808 TGGGAGGATCACCTGAGGCTAGG - Intergenic
1174432028 20:50477296-50477318 TGGGAGGGAGACCTGGGGATTGG - Intergenic
1175419045 20:58819946-58819968 TGGGAGGGTCACCTGGGGCGGGG - Intergenic
1176693309 21:9944173-9944195 TGGTATAAACACCTGGGGGTGGG + Intergenic
1177971723 21:27798474-27798496 TGGGAGGATCACTTGGGGCTAGG - Intergenic
1178389855 21:32189369-32189391 TGGGAGGATCACCTGAGGCTGGG - Intergenic
1179629907 21:42669926-42669948 TGGCATGCCCACCTGGTGCCAGG - Intronic
1180883583 22:19223995-19224017 TCAGATGCACATCTGGGTCTTGG + Exonic
1180976795 22:19853202-19853224 TGGGATGCTCTGCTGTGGCTGGG - Intronic
1181099943 22:20532279-20532301 TGGGATGGGCACTTGGTGCTGGG + Intronic
1181161952 22:20964890-20964912 AGGGATGCCCAGCTGGGGCGCGG - Intergenic
1181265094 22:21626427-21626449 TGGGATGATCACCTGAGCCTGGG + Intergenic
1181711674 22:24695387-24695409 TGGGGTGAACACCTGGGCCTGGG + Intergenic
1184011016 22:41748454-41748476 TGGGAGGATCACCTGAGGCTAGG + Intronic
1184425920 22:44409275-44409297 TGGGGTGGACACCTGGCCCTGGG + Intergenic
1184718206 22:46294022-46294044 TGTGGTGCAGGCCTGGGGCTGGG + Intergenic
1184894226 22:47397774-47397796 TGGAAGGCAGCCCTGGGGCTAGG - Intergenic
1184896916 22:47414236-47414258 TGGGAGGCTCACCTGGGCCTGGG + Intergenic
1184918523 22:47589642-47589664 TGAGAAGCAAACCTGGGGGTCGG + Intergenic
1185292616 22:50034781-50034803 TGGGATGCACGGGTGGGGGTGGG + Intronic
1185312422 22:50163433-50163455 TGGGAGGATCACCTGAGGCTGGG - Intergenic
1185347274 22:50316076-50316098 TGGGATGCGCACCTGGGAGAAGG + Exonic
950354915 3:12399098-12399120 TGTGCTGCACAGATGGGGCTGGG - Intronic
951798318 3:26566746-26566768 TCGGATCCACACCTGCAGCTTGG + Intergenic
951910862 3:27749034-27749056 TTGGTTCCACACCTTGGGCTTGG - Intergenic
952007705 3:28861232-28861254 TGGGAGTGACAGCTGGGGCTGGG - Intergenic
953741857 3:45545291-45545313 TGGGAGGAACACCTGTGGCCTGG + Intronic
954105793 3:48409295-48409317 TGGGATGGACACGGGGGGATGGG - Intronic
954287119 3:49626855-49626877 TGGGATGCCCACCAGGAGCCTGG - Intronic
954299685 3:49693582-49693604 TGGGAGGATCACCTGAGGCTAGG - Intronic
955439336 3:58939040-58939062 TGGGATGAACACATGGGGAGGGG + Intronic
955788263 3:62562560-62562582 TGGGACGATCACCTGAGGCTAGG - Intronic
956150071 3:66231862-66231884 TGGGATGCTCACTTGGGCCCAGG - Intronic
956838150 3:73112665-73112687 TGGGAGGCAGATCTGGGGGTGGG - Intergenic
958183360 3:90086990-90087012 TGGCATGAACACCTGGTTCTTGG - Intergenic
958758180 3:98275029-98275051 TGGCCTGCAGCCCTGGGGCTGGG - Intergenic
961364029 3:126388222-126388244 TGGGGTGGACACCTTGGGTTAGG + Intergenic
961438728 3:126937900-126937922 TGGGATCCTCACCTGGGCCTGGG - Intronic
961851727 3:129826412-129826434 TGGGATGATCACCTGAGTCTGGG + Intronic
961895893 3:130167509-130167531 TGGGATGCTCACTTGAGGCCAGG + Intergenic
962904517 3:139789698-139789720 TGGGCTCCACACCTGAGGATGGG + Intergenic
966163182 3:176989239-176989261 TGGGAGGCTCACCTGAGCCTGGG + Intergenic
967051773 3:185791589-185791611 TGTGATGCACACCTGGAGGAAGG - Intronic
968482953 4:844885-844907 TGCCCGGCACACCTGGGGCTGGG + Intergenic
969410702 4:7026097-7026119 TGGGATGGTCACCTGAGCCTGGG - Intronic
969470658 4:7385627-7385649 TGGGAAGCAAAGCTGGGCCTGGG + Intronic
969839450 4:9870004-9870026 TGGGATGCACACATAGGGGAAGG + Intronic
970277057 4:14412537-14412559 TGGGAGGATCACCTGGGGTTAGG + Intergenic
970617535 4:17781737-17781759 TGGGATCCCCACCTCGGGCAGGG - Intergenic
971329052 4:25667282-25667304 TGGGAGGCTCACCTGAGGTTGGG + Intronic
972542503 4:40051795-40051817 TGGGAGGATCACCTGGGTCTGGG - Intergenic
972726269 4:41748532-41748554 TGGGATGGACACCTCGAGCCTGG - Exonic
975208185 4:71668365-71668387 TGGGAAGATCACCTGAGGCTGGG - Intergenic
975700370 4:77060548-77060570 TGGGAGGATCACTTGGGGCTGGG - Intronic
976863476 4:89694860-89694882 TGGGAGGAACACTTGAGGCTAGG - Intergenic
978711694 4:111790107-111790129 AGGCATGCACAGCAGGGGCTGGG + Intergenic
981073583 4:140569246-140569268 TTGGCTGCACACCTTCGGCTGGG + Intergenic
982140510 4:152313119-152313141 TGGGAAGAACACCTGAGCCTGGG + Intergenic
982218827 4:153107393-153107415 TGGTGTGCAGACCTGGGGATGGG - Intergenic
983606011 4:169584956-169584978 TGGGATGATCACCTGAGGCCAGG + Intronic
983878877 4:172910785-172910807 TGGGATCCACACCTGTGGAAGGG - Intronic
984399458 4:179243562-179243584 TGGGAGGATCACCTGAGGCTGGG - Intergenic
985705143 5:1396142-1396164 TGGGCTGCAGACCAGGGGCAGGG + Intronic
985955634 5:3263427-3263449 TGGGAGGATCACCTGGGTCTAGG + Intergenic
986015785 5:3755574-3755596 TGGGAGGCTCACCTGAGCCTGGG - Intergenic
987334190 5:16884300-16884322 TGGGAGGATCACCTGAGGCTGGG + Intronic
987973530 5:24981312-24981334 TGGGAGGAACACCTGAGCCTGGG - Intergenic
990589423 5:57247589-57247611 TGGGAGGAACACCTGAGCCTGGG + Intronic
990866235 5:60383500-60383522 TGGGAAGCACACCTTTTGCTTGG - Intronic
991034262 5:62112468-62112490 TGGGAGGATCACCTGGGCCTGGG - Intergenic
991670224 5:69039733-69039755 TGGGATGATCACTTGAGGCTGGG + Intergenic
992396029 5:76370523-76370545 TGGGAGGATCACCTGAGGCTGGG - Intergenic
992793764 5:80237424-80237446 TGGGAGGATCACCTGAGGCTGGG - Intronic
992856409 5:80866229-80866251 TGGGAGGATCACCTGGGCCTGGG - Intronic
993030529 5:82700416-82700438 GGGGTTGCATACCTGGGGATGGG - Intergenic
994927236 5:106132498-106132520 TGGGAGGAACACCTGAGCCTGGG - Intergenic
995728815 5:115213676-115213698 TGGGAGGCTCACCTGAGCCTAGG + Intronic
995839028 5:116425644-116425666 TGAGATGCACACCTGGGTTCTGG + Intergenic
996002516 5:118381664-118381686 AGGGAAGCTCACCTGAGGCTTGG + Intergenic
998259844 5:140621756-140621778 GAGAATGCACACCTGGGGGTGGG + Intergenic
1000632663 5:163608393-163608415 TGGGTTGCAAGCCTGGGGTTTGG - Intergenic
1000689077 5:164292143-164292165 TGGGAGGAACACCTGAGCCTTGG + Intergenic
1002072795 5:176690355-176690377 AGGGATGCACACCTGAGCTTTGG + Intergenic
1002983884 6:2169377-2169399 TGGGAGGAACACCTGAGGCCAGG + Intronic
1003332186 6:5138389-5138411 TGGGAGGATCACCTGAGGCTGGG + Intronic
1003640310 6:7870175-7870197 TGAAAGACACACCTGGGGCTTGG + Intronic
1003857652 6:10292623-10292645 TAAGTTGCAGACCTGGGGCTTGG - Intergenic
1004010909 6:11686373-11686395 GAGGAGGCACACCTGGGGCCAGG + Intergenic
1004678162 6:17864722-17864744 TGGGAGGCTCACTTGAGGCTAGG - Intronic
1004742666 6:18476963-18476985 TGGGATGACCACCTGAGCCTTGG + Intergenic
1006026344 6:31149533-31149555 TGGGAGGATCACCTGAGGCTGGG - Intronic
1006442833 6:34062793-34062815 TGAGAGGCACATCTGGGGCTGGG - Intronic
1007831610 6:44643216-44643238 AGGGATGCAGACCTGGGTCTGGG + Intergenic
1008628013 6:53336566-53336588 TAGGAGGGACACCTGGGCCTGGG + Intronic
1008965242 6:57308213-57308235 TGGGAGGATCACCTGAGGCTGGG - Intergenic
1010921844 6:81692085-81692107 TGGGAGGAACACCTGAGCCTGGG - Intronic
1011019626 6:82797628-82797650 TGTTATGGACACCAGGGGCTGGG + Intergenic
1011573237 6:88763015-88763037 TGGGAGGAACACCTGAGCCTGGG - Intronic
1014401524 6:120996272-120996294 TGGGAGGATCACCTGGGCCTGGG + Intergenic
1015753249 6:136582320-136582342 TGGGTTGTACTCCTGGGCCTTGG - Intronic
1016938714 6:149467479-149467501 TGGGAGGATCACCTGGGGCCAGG - Intronic
1017013235 6:150079187-150079209 TGGGAGGATCACCTGGGCCTGGG + Intergenic
1017195433 6:151695176-151695198 TTGAATGCATACCTGGAGCTTGG + Intronic
1017896822 6:158687201-158687223 TGGAAGGCTCGCCTGGGGCTGGG + Intronic
1018919244 6:168159960-168159982 TGGGGTGAACTCCTGGGGTTGGG + Intergenic
1019215855 6:170443449-170443471 AGGGAGGCACACCTGGGACGGGG - Intergenic
1019466995 7:1195405-1195427 TGGGCTGGACACCTTGGGCAAGG - Intergenic
1019647160 7:2137091-2137113 TGGGCTGCTCTCCTGGGGTTAGG + Intronic
1019718682 7:2555146-2555168 ACGGATGCACACCTGGTCCTGGG - Intronic
1019740673 7:2671425-2671447 GGGGCTGCACCCCTGGGCCTGGG + Intergenic
1021838737 7:24705679-24705701 TGGGAGGCAGAGCTGTGGCTGGG - Intronic
1022198417 7:28092765-28092787 TGGGAGGATCACCTGGGCCTGGG + Intronic
1024035641 7:45505711-45505733 TGGGTGGCACAGCGGGGGCTTGG + Intergenic
1024479400 7:49848412-49848434 TGGGATGCACAGCTGGTCCGGGG - Intronic
1025211089 7:57019921-57019943 TGGGATGCAGGGCAGGGGCTGGG + Intergenic
1025660866 7:63556926-63556948 TGGGATGCAGGGCAGGGGCTGGG - Intergenic
1025927464 7:65971215-65971237 TGGGAGGCAGGCATGGGGCTAGG + Intronic
1025995055 7:66522702-66522724 CAGGATGCAGACCTGGGCCTTGG - Intergenic
1026477616 7:70750415-70750437 TGGGAGGAACACCTGAGCCTGGG - Intronic
1026477627 7:70750453-70750475 TGGGAGGAACACCTGAGCCTGGG - Intronic
1026477639 7:70750491-70750513 TGGGAGGAACACCTGAGCCTGGG - Intronic
1026589260 7:71681292-71681314 TGGAAGGCTCACCTGGGGGTGGG + Intronic
1026849934 7:73718229-73718251 TGGGGTTTACACCAGGGGCTGGG + Intronic
1029050195 7:97678719-97678741 TGGGAGGAACACTTGGGCCTAGG - Intergenic
1029230591 7:99065185-99065207 TGGGAGGCTCACCTGAGCCTGGG - Intronic
1029230786 7:99066683-99066705 TGGGAGGCTCACCTGAGCCTGGG + Intronic
1029277070 7:99412519-99412541 TGGGAGGAACACCTGAGCCTGGG - Intronic
1029471346 7:100756483-100756505 TGGGAAGAACACCTGCAGCTGGG - Intronic
1029712342 7:102306725-102306747 TGGGATGCTGACCTTGGGCCTGG - Exonic
1030228540 7:107180041-107180063 TGTGATGAACACATGGAGCTTGG + Exonic
1030315293 7:108108031-108108053 TGGGAGGATCACCTGGGCCTGGG - Intronic
1032239187 7:130148077-130148099 TGGAAACCACAGCTGGGGCTTGG - Intergenic
1032408203 7:131673178-131673200 TGGAATGCACACTTGGAGCCTGG + Intergenic
1033217044 7:139500677-139500699 TGGGATGCCCAGGTGGGCCTCGG + Intergenic
1033835994 7:145312911-145312933 AGGGAGGCTCACCTGGGCCTTGG - Intergenic
1034652504 7:152702562-152702584 TGGGAGGATCACCTGAGGCTGGG - Intergenic
1035056402 7:156039410-156039432 TGGGATGCTGATTTGGGGCTTGG + Intergenic
1035247465 7:157573133-157573155 TGGGGTGCACCCCTGAGGCCTGG - Intronic
1035275083 7:157743504-157743526 TGGGACCCACACTTGTGGCTGGG + Intronic
1036165723 8:6431011-6431033 TTGGTTGCACACCTGGGCCTTGG + Intronic
1036552147 8:9825313-9825335 TGGGAGGCTCACCTGAGTCTGGG + Intergenic
1036957347 8:13202764-13202786 TGGGAGGATCACCTGGGGCTGGG - Intronic
1037694704 8:21213461-21213483 TGTGCTTCACACCTGGTGCTGGG - Intergenic
1038004227 8:23416458-23416480 TGTGGTGCAGACCTGGGTCTGGG - Intronic
1038848126 8:31248647-31248669 TGGGATGCACACCTTTTGCTAGG - Intergenic
1039597722 8:38805935-38805957 AGAGATGCACACTTGGGGCTTGG + Intronic
1039948020 8:42146597-42146619 TGGGATGCACACCTGCTTCCAGG - Intergenic
1040449597 8:47531122-47531144 TGGGAAGAACACTTGTGGCTAGG - Intronic
1040598766 8:48864265-48864287 TGGGAAATGCACCTGGGGCTGGG + Intergenic
1041740437 8:61151629-61151651 TGAAAGGCACACCTGGGGCCCGG - Intronic
1042601136 8:70500980-70501002 TGGGATGCTCATCTGAGCCTGGG - Intergenic
1042913318 8:73848597-73848619 TGGGAGGAACACCTGAGCCTAGG + Intronic
1043441837 8:80283159-80283181 AGGGATGCACATCTGGAGCCAGG + Intergenic
1044727986 8:95208407-95208429 TGTGATTCTCACCTGGGGATGGG + Intergenic
1044966239 8:97576436-97576458 TGGGAGGCTCACCTGAGCCTGGG + Intergenic
1045947928 8:107817733-107817755 TGAGATGCACACTTGGTACTTGG - Intergenic
1046788639 8:118295870-118295892 TGAGATGCACACTTGAGGCCAGG - Intronic
1048957144 8:139546559-139546581 TGGGATGCATACCTTGTGCTGGG + Intergenic
1049167673 8:141136768-141136790 TGGGAAGCACAGCTGCGGCAGGG - Exonic
1049594219 8:143476042-143476064 TGAGAAGCACACCTGGCCCTTGG + Intronic
1049715240 8:144086695-144086717 TGAGATGCCCACGAGGGGCTGGG + Intergenic
1052929992 9:34048542-34048564 GGGGAGGCACCCCTGGGGCTGGG + Intronic
1053258390 9:36639069-36639091 TGGTAGGAAAACCTGGGGCTAGG + Intronic
1053644677 9:40113375-40113397 TGTGATACCCACCTGGGGCCTGG + Intergenic
1053715809 9:40885927-40885949 TGGGTTGATCACTTGGGGCTAGG - Intergenic
1053796749 9:41733614-41733636 TGGGAGGAACACCTGAGCCTGGG - Intergenic
1054148441 9:61581258-61581280 TGGGAGGAACACCTGAGCCTGGG + Intergenic
1054185162 9:61945689-61945711 TGGGAGGAACACCTGAGCCTGGG - Intergenic
1054468186 9:65512349-65512371 TGGGAGGAACACCTGAGCCTGGG + Intergenic
1054539899 9:66262594-66262616 TGTGATACCCACCTGGGGCCTGG - Intergenic
1054653347 9:67642807-67642829 TGGGAGGAACACCTGAGCCTGGG + Intergenic
1056397303 9:86193567-86193589 TGGGATCCACCCCTGTGGCAGGG - Intergenic
1056443605 9:86643809-86643831 TGGCATGCCTACCTGGGGCCGGG - Intergenic
1057272674 9:93659621-93659643 TGGGCTGGACCCCTGGGGATTGG + Intronic
1058194223 9:101954004-101954026 TGGGATGATCACCTGAGCCTGGG + Intergenic
1058964576 9:110024689-110024711 TGGGAGGCTCACCTGAGTCTAGG + Intronic
1059116767 9:111606882-111606904 TGGGAGGCTCACCTGAAGCTTGG + Intergenic
1059382054 9:113934352-113934374 TGGGTGGCAGACCTGAGGCTGGG - Intronic
1060501182 9:124157065-124157087 TGGGAGGTTCACCTGAGGCTGGG - Intergenic
1060506979 9:124205208-124205230 TGGGATGGCTACTTGGGGCTTGG - Intergenic
1060943350 9:127556006-127556028 TGGGGTGGACACCTGGGCCCTGG - Intronic
1061883333 9:133578799-133578821 GGGGAGGCACAGCTGGGGCCTGG - Exonic
1062334101 9:136057371-136057393 GGGGAGGGACAGCTGGGGCTGGG + Intronic
1062483623 9:136763615-136763637 TGGGATGGACAGCTTGGGCCCGG + Intronic
1062522470 9:136963988-136964010 TGGGCTGCAGGGCTGGGGCTGGG + Intergenic
1062559506 9:137134552-137134574 TGGGAGGCTCACCTGAGCCTGGG + Intergenic
1186909277 X:14144133-14144155 TGCTTTGCACACCTGAGGCTGGG - Intergenic
1187343487 X:18442157-18442179 TGTGATGCAAACCTGGGGGTGGG - Intronic
1192077623 X:68016566-68016588 GAGAATGCACACCTGGGGGTGGG + Intergenic
1192578290 X:72260193-72260215 TAGGATGAAGACTTGGGGCTGGG - Intronic
1193086659 X:77452982-77453004 TGGGATGACCACCTGAGCCTGGG + Intronic
1193919455 X:87407248-87407270 TGGGATGCACAGCTGCAGTTTGG + Intergenic
1195232292 X:102861771-102861793 TGGGAAGCAAATCTGGGGCAAGG - Intergenic
1195880940 X:109591909-109591931 AGGGATACTCACCTAGGGCTAGG - Intergenic
1196834042 X:119798505-119798527 TGGGAGGCTCACCTGAGCCTGGG + Intergenic
1197014541 X:121607615-121607637 TGGGAGGATCACCTGGGCCTGGG + Intergenic
1197719491 X:129735482-129735504 TGGGACTCAAACCTGGGTCTGGG - Intergenic
1199447264 X:147939803-147939825 TGGGAGGAACACCTAGGGCCTGG + Intronic
1200820345 Y:7576172-7576194 TGGGATGATCACCTGAGCCTGGG - Intergenic
1201230686 Y:11861193-11861215 TGGGATGATCACCTGAGCCTGGG - Intergenic