ID: 1083572459

View in Genome Browser
Species Human (GRCh38)
Location 11:63768077-63768099
Sequence CCCGAAGGGGACCCAGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083572450_1083572459 -7 Left 1083572450 11:63768061-63768083 CCGCTGGGGAAAAGCCCCCGAAG 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1083572459 11:63768077-63768099 CCCGAAGGGGACCCAGGGTCTGG 0: 1
1: 0
2: 0
3: 16
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083572459 Original CRISPR CCCGAAGGGGACCCAGGGTC TGG Intronic
900125147 1:1065519-1065541 CCCGATGGGAGCGCAGGGTCTGG + Intergenic
900396350 1:2454681-2454703 CCCCAGGGGCCCCCAGGGTCTGG + Intronic
901261667 1:7875925-7875947 CCAGAAGGGAACCTAGGGACAGG + Intergenic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
903178908 1:21595671-21595693 CCCGATGGGGACCCAGGAGACGG - Intergenic
903325523 1:22566730-22566752 TCCCAAGGGGACCCAGGCCCAGG + Intronic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
904328103 1:29740355-29740377 CCCTGAAGGGGCCCAGGGTCGGG + Intergenic
904841364 1:33373816-33373838 CCAGAACGGGGCCCAGGGTCAGG + Intronic
905293310 1:36938226-36938248 CCTGCAGTGGACCCAGGGTATGG - Intronic
907679436 1:56550034-56550056 CCAGAAAGGGACGCTGGGTCCGG + Intronic
912386394 1:109273162-109273184 CCAGATGGGGGCCCAGGGCCTGG + Exonic
912696813 1:111848307-111848329 CCCTCTGGGGTCCCAGGGTCAGG - Intronic
920456884 1:206108305-206108327 CCCTAATGGGACCAAGGCTCAGG - Intergenic
920701014 1:208218066-208218088 CAGGATGGGGACCCTGGGTCAGG - Intronic
922881845 1:228986935-228986957 TCCGTAGGGGACACAGGGTAGGG - Intergenic
1070800905 10:79243782-79243804 CCCGGAGGGAGCCCAGGGCCCGG - Intronic
1072591790 10:96833271-96833293 CCCGAGGGCGGCCCAAGGTCCGG - Intronic
1073292513 10:102420263-102420285 CCCGAAGCGGATCCTGGGACTGG + Exonic
1076520348 10:131077199-131077221 CCCAAGGGGGACCCAAGGACAGG + Intergenic
1076543256 10:131227601-131227623 CCCATAGAGAACCCAGGGTCGGG - Intronic
1076831164 10:132995021-132995043 CCCGGAAGGGACCCAGCGTGGGG + Intergenic
1077745275 11:4896435-4896457 CCCAGAGGAGACCCTGGGTCAGG + Intronic
1081645018 11:44784182-44784204 CCAGAAGGGGACTCTGGATCTGG - Intronic
1083142039 11:60729976-60729998 CCCCAAGGAGACCCATGGTTTGG + Intronic
1083399658 11:62414899-62414921 CATGAAGGGGGCCCAGGCTCAGG - Intronic
1083572459 11:63768077-63768099 CCCGAAGGGGACCCAGGGTCTGG + Intronic
1084161037 11:67350384-67350406 TGCCCAGGGGACCCAGGGTCAGG - Intronic
1084164240 11:67367533-67367555 CGCACAGGGGACCCAGGGCCTGG - Exonic
1084225282 11:67711536-67711558 CCCGGAGGTGACCCGGGCTCTGG + Intergenic
1087779753 11:102289772-102289794 CCTGGAGGGGAACCAGGGCCTGG - Intergenic
1089381713 11:118037447-118037469 GCTGAGGGGGCCCCAGGGTCCGG + Intergenic
1089541346 11:119190754-119190776 CCCGAAGCTGAGCCAGGGCCTGG + Exonic
1090412473 11:126518738-126518760 CTGGAAGGGGACCCCTGGTCTGG - Intronic
1091284126 11:134398702-134398724 CCAGCAGTGGACCCAGGGCCAGG - Intronic
1091813891 12:3421668-3421690 CCGGGAGGGGAGCCAGGGTGAGG - Intronic
1091923060 12:4321115-4321137 CCCGAAGGCCACTCAGGGCCGGG - Intergenic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1096973453 12:55685068-55685090 CCCGATGGGCATCCAGGGCCAGG - Exonic
1101150289 12:101877448-101877470 GCCGGAGGGGACGCGGGGTCGGG - Exonic
1104514886 12:129415858-129415880 CCCAAAGGAGAACCAGGCTCTGG - Intronic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1113542646 13:111121189-111121211 CCCCAAAGGCACCCAGGGTAGGG + Intronic
1113635473 13:111916310-111916332 GCCCAGGGGTACCCAGGGTCTGG - Intergenic
1114791108 14:25659462-25659484 CCCCATGTGGTCCCAGGGTCAGG + Intergenic
1118348769 14:64958872-64958894 CCAGAAAGGGACACAGGGTGTGG - Intronic
1122317956 14:100836673-100836695 TCCGAAGGGGTCCCTGGGCCGGG - Intergenic
1122320947 14:100855462-100855484 CACGACTGTGACCCAGGGTCGGG + Intergenic
1123077027 14:105672574-105672596 CCCGAACGGACCCCAGGATCGGG - Intergenic
1125749526 15:42019325-42019347 ACCAAAGGGCTCCCAGGGTCAGG + Intronic
1129037100 15:72657029-72657051 ACTGAAGGGGGCCCAGGGTGTGG + Intronic
1129212787 15:74080196-74080218 ACTGAAGGGGGCCCAGGGTGTGG - Intronic
1129397612 15:75260890-75260912 ACTGAAGGGGGCCCAGGGTGTGG + Intronic
1129401224 15:75285167-75285189 ACTGAAGGGGGCCCAGGGTGTGG + Intronic
1129702086 15:77773961-77773983 TCCAAAGGGGACACTGGGTCAGG + Intronic
1129729927 15:77924516-77924538 ACTGAAGGGGGCCCAGGGTGTGG - Intergenic
1129838590 15:78729466-78729488 ACTGAAGGGGGCCCAGGGTGTGG + Intergenic
1130843775 15:87725538-87725560 CCAGAAGGGGACCCAGGACTGGG - Intergenic
1132503937 16:297495-297517 CCAGAGCGGGAGCCAGGGTCGGG + Intronic
1132559940 16:589064-589086 CTGGACGGGGACCCAGGGCCCGG - Intergenic
1132603571 16:784424-784446 CCCGGTGGGGACTCCGGGTCTGG + Intergenic
1132603593 16:784496-784518 CCCGGTGGGGACTCCGGGTCTGG + Intergenic
1132826474 16:1907928-1907950 CCCAAAGGGGACACAGGGAAGGG - Intergenic
1133111461 16:3550424-3550446 CCTGAAGGTGAACCAGGGCCTGG - Exonic
1135436239 16:22428593-22428615 CCCCAAGGGAACCCAGGCTCAGG - Intronic
1136231602 16:28888812-28888834 TCCGACGGGTACCCAGGGCCAGG - Exonic
1138252182 16:55509550-55509572 GCCCGAGGGGAGCCAGGGTCTGG + Intronic
1139965432 16:70742525-70742547 CCAGCAGGGGTCCCAGGGTCAGG + Intronic
1140287777 16:73620979-73621001 CCCCAAGGAGACCAAGGGGCAGG - Intergenic
1142045453 16:87922427-87922449 CCCCAAGGGAACCCAGGCTCAGG - Intronic
1142377154 16:89712012-89712034 CCCGCAGCGGCCCCAGGGGCGGG + Intronic
1142559880 17:803579-803601 CCTGAAAGGACCCCAGGGTCAGG - Intronic
1143623824 17:8096683-8096705 CCAGGAGCGGAACCAGGGTCTGG - Exonic
1144055511 17:11537218-11537240 CTCCAAGGGGACCCTGAGTCAGG + Intronic
1145013013 17:19380485-19380507 CCCTATGGGGTCCCAGGGTAAGG + Intronic
1147260951 17:39209683-39209705 CAAGGAGGGGACCCAAGGTCTGG + Intergenic
1147338876 17:39742356-39742378 CCAGGAGGGGTCCCAGGGGCTGG - Exonic
1149656140 17:58310531-58310553 CAAGGAGGAGACCCAGGGTCTGG - Exonic
1150507575 17:65715256-65715278 CCTGAAGAGAAGCCAGGGTCAGG + Intronic
1151362146 17:73595494-73595516 CCTGGAGGGGACCCAGCCTCGGG + Intronic
1151699826 17:75737254-75737276 GCCCCAGAGGACCCAGGGTCTGG - Intronic
1151883658 17:76910802-76910824 CCCACAGGGGACCAAGGGCCAGG - Intronic
1152068129 17:78122535-78122557 TCCTAAGTGGACCCAGGGCCAGG + Intronic
1152598771 17:81251046-81251068 CCCCAAGGGGACCCAGTTTGGGG - Intronic
1152736344 17:81999193-81999215 CCCTCAGGGGACACAGGGGCTGG - Intronic
1155341414 18:24818001-24818023 CCTGAAGGGGACACAGTTTCAGG + Intergenic
1160735880 19:662334-662356 ACCGAAGAGGACCCTGGGCCTGG - Intronic
1161961843 19:7527643-7527665 CTCGAGGGGGGCCCAGGGTGGGG + Intronic
1165154228 19:33777604-33777626 GCAGAGGGGGACCCGGGGTCTGG + Intergenic
1165886790 19:39084394-39084416 CCCGAGGGTGAGCCGGGGTCCGG + Exonic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
1168073124 19:53963503-53963525 CCCAAGGGGGCCCCAGGATCAGG - Intronic
1168159630 19:54501097-54501119 CCCGAAGGGGTTGAAGGGTCAGG - Intronic
1168693788 19:58393648-58393670 CCCGAAGAGGACCCAGAGCCTGG - Intronic
926120685 2:10239807-10239829 CCCGAAGGGCTCCCAAGGACAGG - Intergenic
931178347 2:59875566-59875588 CCTGAAGAGGAGCCAAGGTCTGG - Intergenic
932422034 2:71606839-71606861 CCTGGGGAGGACCCAGGGTCAGG + Intronic
932439274 2:71721562-71721584 CCCTCAGGGAACCCAAGGTCAGG + Intergenic
935310551 2:101778659-101778681 CCTGAAGGGCACCCAGGGAAGGG + Intronic
935891372 2:107682241-107682263 CCCGTCTGTGACCCAGGGTCTGG + Intergenic
936284867 2:111174047-111174069 CCCGAAGGGGTTCCAGGCTCAGG - Intergenic
936936959 2:117847986-117848008 CCAGAAAGGGACCCAGGGGGAGG + Intergenic
938570808 2:132560374-132560396 GTGGAAGGGGACCCAGGTTCAGG - Intronic
947469600 2:230388830-230388852 CCCCCTGGGGCCCCAGGGTCTGG - Intronic
948569000 2:238905523-238905545 GCCCGAGGGGACCCAGGCTCAGG - Intronic
948641795 2:239379693-239379715 CCCCAAGGAGCCCCAGGGTGGGG + Intronic
1171033979 20:21702206-21702228 CCCGCAGGGGCCGCAGGGCCGGG - Intergenic
1171463061 20:25309642-25309664 CCCCAAGGGGGCCCAGGGCCAGG + Intronic
1178413314 21:32383502-32383524 CGCCATGGTGACCCAGGGTCCGG - Exonic
1178678043 21:34647510-34647532 CCCAACTGGGACCCAGGGCCAGG - Intergenic
1179876706 21:44272431-44272453 CCAGGAGGGGACCAAGGGTGCGG + Intergenic
1180844103 22:18972170-18972192 CACCAAGGGTGCCCAGGGTCTGG - Intergenic
1181057367 22:20266541-20266563 CACCAAGGGTGCCCAGGGTCTGG + Intronic
1181919968 22:26312901-26312923 CCAGCAGGAGACCCAGGCTCAGG - Intronic
1183257775 22:36773735-36773757 TCAGATTGGGACCCAGGGTCTGG + Intronic
1183302280 22:37064228-37064250 GCAGAAGGGGAACCAGGGACGGG - Intergenic
1183586433 22:38755694-38755716 CCCGACGGTGACCCGGGGTCAGG + Intronic
1184250996 22:43260229-43260251 CTCGAAGGGGATCCAGGCTCAGG + Intronic
1185092577 22:48784335-48784357 CCCGACTGGGACCCAGGCCCTGG - Intronic
1185182336 22:49370506-49370528 CCTGGAGGAGACCCAGGGACTGG + Intergenic
1185211615 22:49573652-49573674 CTGGGAGGGGACCCAGGGCCTGG + Intronic
1185273098 22:49937579-49937601 CCCCAAGGGGACCCTGGGCGTGG - Intergenic
950282404 3:11719459-11719481 CCTGCGGGGGACCCAGGGGCGGG + Intronic
955449202 3:59049633-59049655 CCCGCAGGGGGCCCAGGGCTTGG + Intronic
957078534 3:75619320-75619342 CCCAGAGGTGACCCAGGCTCTGG + Intergenic
959933039 3:112003184-112003206 CCCCAAGAGGCCCCAGGGTCTGG + Intronic
962313754 3:134345146-134345168 CCTGAAGAGGCCACAGGGTCTGG - Intergenic
963774123 3:149421234-149421256 CTTGAAGGTGACCCAGGGTCTGG + Intergenic
968090115 3:195894160-195894182 CTGGAAGGAGACCCAGGGACCGG + Intronic
968636517 4:1683914-1683936 CCCGAAGGGGACCCAGACGCGGG - Intronic
969689800 4:8698223-8698245 CCCAAAGGGGAGACAGGGGCAGG - Intergenic
969791844 4:9498207-9498229 CCCGGAGGTGACCCGGGCTCTGG - Intergenic
973829935 4:54748329-54748351 CCCCAAGGTGCCCCAGGGACTGG - Intergenic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
985478545 5:92716-92738 CCTGAAGGGGAGCCAGGGGAGGG + Intergenic
985666211 5:1182713-1182735 GCTGAAGGGGTGCCAGGGTCGGG + Intergenic
995064441 5:107844149-107844171 CACTAAGGAGACCCAGGGTCAGG + Intergenic
996159478 5:120145186-120145208 CCCAAAGGGGACTCAGTGTGGGG + Intergenic
998161442 5:139814878-139814900 CCCAAAGGGGACCAGGGGACAGG + Intronic
999712622 5:154332028-154332050 GCAGAAGAGGACCCAGGGTCTGG - Intronic
1001106762 5:168861029-168861051 GACCAAGGGAACCCAGGGTCTGG + Intronic
1001710166 5:173772064-173772086 TCCAAAGAGAACCCAGGGTCAGG - Intergenic
1002169232 5:177366187-177366209 CACGACGGGGCCCCAGGGCCAGG + Exonic
1004428375 6:15522151-15522173 GCTGAAGGGGACCCAGTGGCAGG - Intergenic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1009850419 6:69190318-69190340 CCCTAAGCCTACCCAGGGTCGGG - Intronic
1010203095 6:73299713-73299735 CCCGTAGGAGCCGCAGGGTCGGG - Intronic
1016551437 6:145284467-145284489 CCTGAAAGTGACCCAGGGTCTGG - Intergenic
1019784824 7:2968704-2968726 CCCCAAGGGCTCCCAGGGGCAGG - Intronic
1020309035 7:6855323-6855345 CCCGGAGGTGACCCGGGCTCTGG + Intergenic
1022098074 7:27153056-27153078 GGCGAGGGGGCCCCAGGGTCCGG - Intergenic
1024216648 7:47254358-47254380 CCAGCAAGGGACCCAGGGGCGGG - Intergenic
1026953060 7:74360301-74360323 CCTTAAGGGGACTCAGGGCCAGG - Intronic
1029110616 7:98211532-98211554 CGGGGAGGGGACCCAGGGGCAGG + Intronic
1029390231 7:100270071-100270093 CCCAAAGGGGACCCTGAGTTGGG + Intronic
1034283273 7:149868180-149868202 CCTGAAGGGAACCCTGGGACGGG - Intergenic
1035202013 7:157273686-157273708 CACGAAGCCGACCCGGGGTCTGG - Intergenic
1035221664 7:157409969-157409991 CGCGAGGGGGTCCCAGGGCCCGG - Exonic
1049241630 8:141540335-141540357 CCCGGAGGAGACTCAGGGGCTGG - Intergenic
1049772812 8:144391582-144391604 CCTGAAGGGGACCCTGGCCCAGG + Exonic
1050207752 9:3215001-3215023 CCCCAAGGGGACCAAGTGGCAGG + Intergenic
1053292282 9:36889127-36889149 CACCAAGGGGGCCCAGGTTCAGG - Intronic
1055785114 9:79863374-79863396 CCCGAAGGAGACTGAGGGTAGGG + Intergenic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1056753580 9:89368482-89368504 CCAGAAGGGTCCCCAGAGTCTGG - Intronic
1056852275 9:90094628-90094650 CCCTGAGCCGACCCAGGGTCAGG - Intergenic
1059692289 9:116697766-116697788 CCCGGAGGGCATCCAGGTTCAGG - Exonic
1061045600 9:128163395-128163417 CCCCAAGGAGACACAGGATCTGG + Intronic
1061514245 9:131079348-131079370 CCTGAAGGTGATCCAGGGTCAGG + Intronic
1062009850 9:134261080-134261102 CCCGAAGGGCTCCGGGGGTCAGG + Intergenic
1062213596 9:135377519-135377541 GGCGGAGGGGACTCAGGGTCAGG + Intergenic
1188973944 X:36651164-36651186 CCCAAGGGGCATCCAGGGTCTGG - Intergenic
1190117882 X:47637818-47637840 CCCGAACGGACCCCAGGATCGGG - Exonic
1190276804 X:48904395-48904417 CCAGAAGAGGGCACAGGGTCGGG + Exonic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic