ID: 1083573112

View in Genome Browser
Species Human (GRCh38)
Location 11:63770254-63770276
Sequence CGTGCTTGAGACTCCACCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083573106_1083573112 -5 Left 1083573106 11:63770236-63770258 CCTCAGCCCCCATGTTGACGTGC No data
Right 1083573112 11:63770254-63770276 CGTGCTTGAGACTCCACCTTGGG No data
1083573103_1083573112 17 Left 1083573103 11:63770214-63770236 CCGCGGAGATGTCCCGTCTCTTC No data
Right 1083573112 11:63770254-63770276 CGTGCTTGAGACTCCACCTTGGG No data
1083573104_1083573112 5 Left 1083573104 11:63770226-63770248 CCCGTCTCTTCCTCAGCCCCCAT No data
Right 1083573112 11:63770254-63770276 CGTGCTTGAGACTCCACCTTGGG No data
1083573105_1083573112 4 Left 1083573105 11:63770227-63770249 CCGTCTCTTCCTCAGCCCCCATG No data
Right 1083573112 11:63770254-63770276 CGTGCTTGAGACTCCACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083573112 Original CRISPR CGTGCTTGAGACTCCACCTT GGG Intergenic