ID: 1083573248

View in Genome Browser
Species Human (GRCh38)
Location 11:63771083-63771105
Sequence TCCCCTTCCCCCAGTGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083573248_1083573258 27 Left 1083573248 11:63771083-63771105 CCAACCCCACTGGGGGAAGGGGA No data
Right 1083573258 11:63771133-63771155 TTCTCACTTTCTCAGGCCTTAGG No data
1083573248_1083573253 -2 Left 1083573248 11:63771083-63771105 CCAACCCCACTGGGGGAAGGGGA No data
Right 1083573253 11:63771104-63771126 GAAACCAATGGCAGTGAGTCAGG No data
1083573248_1083573256 20 Left 1083573248 11:63771083-63771105 CCAACCCCACTGGGGGAAGGGGA No data
Right 1083573256 11:63771126-63771148 GGCCACATTCTCACTTTCTCAGG No data
1083573248_1083573254 -1 Left 1083573248 11:63771083-63771105 CCAACCCCACTGGGGGAAGGGGA No data
Right 1083573254 11:63771105-63771127 AAACCAATGGCAGTGAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083573248 Original CRISPR TCCCCTTCCCCCAGTGGGGT TGG (reversed) Intergenic
No off target data available for this crispr