ID: 1083573437

View in Genome Browser
Species Human (GRCh38)
Location 11:63772154-63772176
Sequence GGGAAGAAGGAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083573425_1083573437 11 Left 1083573425 11:63772120-63772142 CCAGCTGAGTGAAGAGAAGGAGG No data
Right 1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083573437 Original CRISPR GGGAAGAAGGAGAAGGAGGA GGG Intergenic
No off target data available for this crispr