ID: 1083574001

View in Genome Browser
Species Human (GRCh38)
Location 11:63776121-63776143
Sequence TGGGACTGTCCCTCTTTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083574001_1083574007 13 Left 1083574001 11:63776121-63776143 CCCACTAAAGAGGGACAGTCCCA No data
Right 1083574007 11:63776157-63776179 CTTTGACAAGACCATGAGCAAGG No data
1083574001_1083574009 26 Left 1083574001 11:63776121-63776143 CCCACTAAAGAGGGACAGTCCCA No data
Right 1083574009 11:63776170-63776192 ATGAGCAAGGATGAAGAACAAGG No data
1083574001_1083574011 28 Left 1083574001 11:63776121-63776143 CCCACTAAAGAGGGACAGTCCCA No data
Right 1083574011 11:63776172-63776194 GAGCAAGGATGAAGAACAAGGGG No data
1083574001_1083574010 27 Left 1083574001 11:63776121-63776143 CCCACTAAAGAGGGACAGTCCCA No data
Right 1083574010 11:63776171-63776193 TGAGCAAGGATGAAGAACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083574001 Original CRISPR TGGGACTGTCCCTCTTTAGT GGG (reversed) Intergenic
No off target data available for this crispr