ID: 1083574372

View in Genome Browser
Species Human (GRCh38)
Location 11:63779081-63779103
Sequence TTTCTTCTTCCTTGGAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083574372_1083574380 27 Left 1083574372 11:63779081-63779103 CCAGCATTCCAAGGAAGAAGAAA No data
Right 1083574380 11:63779131-63779153 AGAGGCTCTGTCTTTTATCTGGG No data
1083574372_1083574376 9 Left 1083574372 11:63779081-63779103 CCAGCATTCCAAGGAAGAAGAAA No data
Right 1083574376 11:63779113-63779135 GCAAAAGTTCTTTCCTCCAGAGG No data
1083574372_1083574379 26 Left 1083574372 11:63779081-63779103 CCAGCATTCCAAGGAAGAAGAAA No data
Right 1083574379 11:63779130-63779152 CAGAGGCTCTGTCTTTTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083574372 Original CRISPR TTTCTTCTTCCTTGGAATGC TGG (reversed) Intergenic
No off target data available for this crispr