ID: 1083581272

View in Genome Browser
Species Human (GRCh38)
Location 11:63827021-63827043
Sequence CTTGGTGCCCTGGGGGTGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 358}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083581272_1083581281 7 Left 1083581272 11:63827021-63827043 CCAGGCACCCCCAGGGCACCAAG 0: 1
1: 0
2: 2
3: 39
4: 358
Right 1083581281 11:63827051-63827073 GAGCAGGTGACACCTCAGACTGG 0: 1
1: 0
2: 1
3: 14
4: 151
1083581272_1083581279 -9 Left 1083581272 11:63827021-63827043 CCAGGCACCCCCAGGGCACCAAG 0: 1
1: 0
2: 2
3: 39
4: 358
Right 1083581279 11:63827035-63827057 GGCACCAAGCGTGTGGGAGCAGG 0: 1
1: 0
2: 0
3: 16
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083581272 Original CRISPR CTTGGTGCCCTGGGGGTGCC TGG (reversed) Exonic
900192982 1:1359183-1359205 CTGGGAGGCCTGGGGGTGCTGGG + Intronic
900250223 1:1665032-1665054 CAGGGTGCCCTGGGGTTGCGGGG + Exonic
900449211 1:2697236-2697258 CTTGCTCACCTGGGGGTGCAGGG - Intronic
900577466 1:3390430-3390452 CATAGCGCCCTGGGGCTGCCTGG + Intronic
901131396 1:6963884-6963906 CTTTGTGCCCTGGGGGACACTGG + Intronic
901856498 1:12047720-12047742 ATTGGTGCTCTGGGGGTGGCGGG - Intergenic
902700669 1:18169749-18169771 CATGGAGTCCTGGGGGTGCGGGG + Intronic
902965124 1:19995583-19995605 TTTGGTACCCTAGTGGTGCCTGG - Intergenic
903369621 1:22826817-22826839 CTTGCTGTCCTGGGGGAGGCAGG - Intronic
903516847 1:23916878-23916900 CTTTTTGCCCTGGGAGGGCCAGG + Intergenic
903986606 1:27233952-27233974 CTGGGTGCCCTCGGGGTGATGGG - Intergenic
904396830 1:30227890-30227912 CTTGCTGTCCTGCAGGTGCCAGG + Intergenic
904411667 1:30328605-30328627 CTTTGTGCCATGGGGCTCCCCGG + Intergenic
904455934 1:30648043-30648065 CTTGGTGCCCTGTGGGTACTTGG - Intergenic
904865686 1:33577327-33577349 GTGGTAGCCCTGGGGGTGCCGGG + Exonic
905014966 1:34771605-34771627 CTTGGGGCCCCAGGGGTACCTGG - Intronic
905081569 1:35326620-35326642 CCTTGTGCCCTGAGGCTGCCAGG - Intronic
905169087 1:36099136-36099158 CCAGGTGCCCAAGGGGTGCCAGG - Exonic
906104423 1:43283345-43283367 ACTTGTGCCCTGGGGCTGCCTGG - Exonic
907304681 1:53506979-53507001 CTGGGCCCCCTGGGTGTGCCAGG - Intronic
909576023 1:77177373-77177395 CTTTCTGCCCTGGGTGGGCCTGG - Intronic
910125970 1:83842897-83842919 TTGAGTGCCCTCGGGGTGCCAGG - Intergenic
910991994 1:93066362-93066384 CTGGGTGAGCTGGAGGTGCCTGG + Intergenic
913197487 1:116470020-116470042 CTTGGCACCCTGAGGGTGCTAGG + Intergenic
915633251 1:157168195-157168217 CCTGGTCCCCTGGCTGTGCCTGG + Intergenic
915656278 1:157363754-157363776 CTAGGTCCCCTGGCTGTGCCAGG + Intergenic
920048013 1:203146059-203146081 CTGGGAGCCCAGGGGCTGCCTGG + Intronic
920230429 1:204466455-204466477 CTTGCTCCCCTGGGTGTGCATGG + Intronic
920527585 1:206679162-206679184 CCTGGTGACCTGGTGATGCCTGG - Intronic
922035000 1:221839558-221839580 TTTGGGCCCCTGGGGGTTCCTGG - Intergenic
922886628 1:229025346-229025368 CCTGGTCCTCTGGGGGTGACAGG + Intergenic
1062858125 10:789716-789738 CTGGGTGCCCTGGCAGTGGCTGG + Intergenic
1065828694 10:29595350-29595372 CGTGCTGCTCTGAGGGTGCCGGG - Intronic
1067444183 10:46330265-46330287 CCTGGTGCCGTCGGGATGCCAGG + Intergenic
1068259251 10:54556858-54556880 CTGTGTGCCCTGGGAGTGGCAGG + Intronic
1069874505 10:71553377-71553399 CTTGGTGCCCTGGGGCTTAGGGG - Intronic
1070649578 10:78225257-78225279 CAAGGTGGCCTGGGCGTGCCGGG + Intergenic
1071561450 10:86649452-86649474 CTAGGTGCCCTGGAGGCTCCTGG - Intergenic
1072551283 10:96479557-96479579 CCAGGTGCCCTTGGGGTGCTGGG - Intronic
1074047082 10:109849166-109849188 CTTGGGGACCTGGGGTTGCGGGG - Intergenic
1075861850 10:125683830-125683852 TTTGCAGCCCTGGGGATGCCAGG - Intergenic
1076628302 10:131835029-131835051 CTTGATGCCCTCTGGCTGCCAGG - Intergenic
1076788133 10:132761430-132761452 CATGGAGCTCTGGGGGTGGCAGG + Intronic
1076884331 10:133254737-133254759 CTTTGTCCCCTGGGATTGCCTGG + Intergenic
1077068664 11:657113-657135 CTGGGTGCCAGGTGGGTGCCAGG - Intronic
1077246608 11:1542307-1542329 CCTGGTGCCCCTGGGGTGACCGG + Intergenic
1077501846 11:2912896-2912918 GCCGGTGCCATGGGGGTGCCAGG + Intronic
1077702141 11:4452597-4452619 CTTGATGGCCTGGGGGTGAGAGG - Intergenic
1078555296 11:12320528-12320550 CTTGGTGGGGTGGGGGTGGCAGG + Intronic
1080138672 11:28889049-28889071 CTTGGCATCCTGGGGGTGCCTGG + Intergenic
1080681202 11:34477804-34477826 CTTGGTGCCCAGGGAGTGGGAGG + Intergenic
1081851710 11:46278699-46278721 CCTGATTCCCTGGGGCTGCCAGG - Intronic
1083581272 11:63827021-63827043 CTTGGTGCCCTGGGGGTGCCTGG - Exonic
1083925412 11:65803216-65803238 CTCTGTGCCCTGGGGCAGCCTGG - Intergenic
1084221526 11:67683409-67683431 CTTGCTGCCCTGGCAATGCCAGG + Intergenic
1084901862 11:72315736-72315758 CATGGTACCCATGGGGTGCCAGG + Intronic
1086561216 11:88172073-88172095 CTTGCTGGCCTGTGAGTGCCTGG - Intronic
1087064530 11:94015042-94015064 CTTTCTGCCCTGGGTGGGCCAGG - Intergenic
1088424944 11:109692928-109692950 CTTGGGTCTCAGGGGGTGCCTGG - Intergenic
1089299138 11:117487959-117487981 TTTGGGCCCTTGGGGGTGCCCGG + Intronic
1089346409 11:117794654-117794676 CTTGGTGCCGCGGGGGTGACTGG + Intronic
1090317106 11:125803080-125803102 CTTGGTGCCGGGTTGGTGCCTGG + Intergenic
1090732402 11:129583119-129583141 CTTGCTGCCCTGTGGGTGCAGGG - Intergenic
1091764070 12:3106931-3106953 CTTGGGGCCCTGGGGATGGAGGG + Intronic
1094317626 12:29149887-29149909 CTGGGCGCCCTGGCGGTCCCAGG - Intronic
1096257243 12:50070932-50070954 CTGGTTGCCCTGGGTGTTCCTGG + Intronic
1101575638 12:105994013-105994035 CCTCGAGCCCTGGGGGCGCCAGG + Intergenic
1102046335 12:109832511-109832533 CCTGGTGCCCCCGGGGTGCTTGG - Intronic
1102140962 12:110614342-110614364 CCTGGAGCCCTGGGAGTCCCGGG - Exonic
1102455251 12:113066872-113066894 CTTGGAGCCCAGGAGCTGCCGGG + Intronic
1102830286 12:115991781-115991803 CTTGGGGTCCTGGGGGTTCGTGG + Exonic
1103327165 12:120129393-120129415 CTTGATGGCCTGGGGGTCCAGGG + Exonic
1103910553 12:124349810-124349832 CCGAGTGCCCTGGGGGTGGCGGG - Intronic
1103927837 12:124433565-124433587 CTTGGGGCCATGGAGGTGTCTGG - Intronic
1104602260 12:130162051-130162073 CTCGGCGTCCTCGGGGTGCCGGG + Intergenic
1105656887 13:22451462-22451484 CTTTGTGCCCTGAGGCTCCCTGG - Intergenic
1106413371 13:29526098-29526120 TTTGGTGCCCTGTGGCGGCCAGG + Intronic
1108510742 13:51153325-51153347 CTTGATGCCCTGGGCATGCAGGG - Intergenic
1113596922 13:111540045-111540067 AGCGGTGCCCTGGGGGTGCTGGG - Intergenic
1116659464 14:47690138-47690160 CTGGGTCACCTAGGGGTGCCAGG + Intergenic
1118753263 14:68821438-68821460 CTTGGAGGCCTCGTGGTGCCTGG - Intergenic
1119378796 14:74215604-74215626 CTCAGTGCCCAGGGGCTGCCTGG - Intergenic
1119739090 14:77002370-77002392 GTTTGTGCCCTCGGGGTCCCTGG - Intergenic
1119777173 14:77256587-77256609 CATGGTGCCATAGGTGTGCCTGG - Exonic
1121029654 14:90646992-90647014 CTTGGTGATCTGTGGGTGACAGG + Exonic
1121311661 14:92938701-92938723 CTTGGTGTCATGGAGGTGTCTGG - Exonic
1122326343 14:100882923-100882945 CTTGGGAACCTGTGGGTGCCAGG - Exonic
1122804540 14:104249925-104249947 CTTGGTGCCAGGGAGGTGCCAGG - Intergenic
1122860115 14:104578773-104578795 CTGGGAGCCCAGGGTGTGCCAGG - Intronic
1123024787 14:105419616-105419638 CCTGGTGCCCTGGGGGTAGAGGG - Intronic
1123062027 14:105598744-105598766 CTTTGTGCTCATGGGGTGCCCGG + Intergenic
1123086770 14:105720475-105720497 CTTTGTGCTCATGGGGTGCCCGG + Intergenic
1123167728 14:106342576-106342598 CTTGGTGTCCTGAGGGAGCCTGG + Intergenic
1123170354 14:106367287-106367309 CTTGGTGTCCTGAGGGAGCCTGG + Intergenic
1123177810 14:106438297-106438319 TTTTCTGCCCTGGGGGGGCCAGG - Intergenic
1128147017 15:65337495-65337517 CTTGGGGCCCTGGGGGTGGGAGG + Intronic
1129369190 15:75077699-75077721 AGTGGTGCCCAGGAGGTGCCTGG - Intronic
1129375027 15:75124503-75124525 AGTGGTGCCCAGGAGGTGCCTGG + Intergenic
1130144247 15:81261361-81261383 CAGGGAGCCCTGGGGATGCCAGG - Intronic
1130964944 15:88690157-88690179 ATTGGTGCTCTGAGGGTGCTGGG - Intergenic
1132626633 16:894493-894515 CTGAGTGCCCTTGAGGTGCCGGG + Intronic
1132651370 16:1022760-1022782 CTGGGTGCGGTGGGGCTGCCGGG + Intergenic
1132653223 16:1030879-1030901 CATGGATCCCTGAGGGTGCCAGG - Intergenic
1132663372 16:1071236-1071258 CTGGGTGCCCCAGGGGTGCAGGG - Intergenic
1132671040 16:1102472-1102494 TTTCGAGGCCTGGGGGTGCCGGG - Intergenic
1132989336 16:2785014-2785036 CTTGTGGCCCTGGGGGTAGCCGG + Exonic
1133969982 16:10560593-10560615 CTGTGTGCCCTGGGGCTGCCGGG + Intronic
1134295926 16:12945838-12945860 CTCGTTGCTCTGGGGGAGCCAGG - Intronic
1135244766 16:20846034-20846056 CTTGGAGGCCTGGGGATGCTGGG + Intronic
1136124640 16:28169091-28169113 CGTGAGGCCCTGAGGGTGCCGGG - Intronic
1137844373 16:51672928-51672950 CTTCTTGCCCTGGTGGTTCCTGG - Intergenic
1138595614 16:58027532-58027554 CTTGGTGCCCTTGGGCTGCCCGG + Intronic
1138679647 16:58675713-58675735 CTTGGTGCCTAGGAAGTGCCAGG - Intronic
1139359013 16:66385083-66385105 CTTGGTGCCTGGGAGGTGCCAGG - Intronic
1139372818 16:66479313-66479335 ACAGATGCCCTGGGGGTGCCTGG + Intronic
1139395850 16:66638229-66638251 CTTGGTGCCTTGGGGGTAGATGG - Intronic
1140298765 16:73735989-73736011 CTTAGTACCCTGGGGGAGCTAGG - Intergenic
1141141988 16:81502458-81502480 CTGGCTCGCCTGGGGGTGCCTGG + Intronic
1142335837 16:89489699-89489721 CTTGGGGACCTGAGGCTGCCGGG - Intronic
1143099766 17:4498759-4498781 CGTGCTGCCCTGGGGGTGGGGGG - Intergenic
1143164465 17:4891040-4891062 CTGGGGGCCCTGGGGAGGCCTGG - Exonic
1143372090 17:6446784-6446806 CTTGGTGTACAGGGGGTGCTGGG + Intronic
1143950912 17:10631573-10631595 CCTGCTGCCCTCGGGCTGCCGGG - Intronic
1145265442 17:21377603-21377625 CCGGGTGCCCTGGGGGAGCGGGG + Intronic
1145303640 17:21657232-21657254 CTTGGTGCCGGAGGGGTCCCAGG - Intergenic
1145346404 17:22044617-22044639 CTTGGTGCCGGAGGGGTCCCAGG + Intergenic
1146318169 17:31825577-31825599 CTTGGGGTCCTGGGTGTGCCAGG + Intergenic
1146621474 17:34401845-34401867 CTGAGTGCCCAGTGGGTGCCAGG - Intergenic
1146968252 17:37051263-37051285 CTTGGAGGCCTGGGGGTTCCAGG + Intronic
1147326166 17:39670651-39670673 CCTGGTGCACTGCAGGTGCCCGG - Intergenic
1148128727 17:45249943-45249965 CTTGGAGCCCTGCTGGTGCCTGG + Intergenic
1148198637 17:45733120-45733142 CCTGGAGCCCTGGGAGAGCCTGG + Intergenic
1148209857 17:45801568-45801590 TTTGGAGCCTTGGGGCTGCCAGG + Intronic
1148792380 17:50180668-50180690 CTCTGTCTCCTGGGGGTGCCTGG - Intergenic
1148997495 17:51723903-51723925 CTGGGTGCCCATGGGGTACCTGG + Intronic
1150693475 17:67384297-67384319 CTGGGGACCCTGGGGGTGCCTGG - Intronic
1151314204 17:73311825-73311847 CTGGGTGCCCTGGGTGGGCTTGG - Intronic
1151349808 17:73525106-73525128 CTTGGTGCCCTGGGGAGGGGTGG - Intronic
1151466590 17:74289632-74289654 CCTGTTGCCATCGGGGTGCCAGG - Exonic
1151786657 17:76278504-76278526 CTTGGAGCCCTGTGGGTTCCAGG - Intronic
1151965137 17:77427267-77427289 CTTGGTGCCCTGGGAGTGACAGG + Intronic
1152277223 17:79364900-79364922 CCTGGTGCCCAGGGAGTGGCTGG + Intronic
1152525356 17:80885165-80885187 CTGGGTGCCCTGCTGCTGCCGGG - Intronic
1152570802 17:81120508-81120530 AGTGGGGCTCTGGGGGTGCCTGG + Exonic
1154173092 18:12064419-12064441 GTGGGTGCCCTGGGGGAGACAGG - Intergenic
1154494741 18:14947255-14947277 CTGGTGGCCCTGGGGGTGGCTGG + Intergenic
1157721798 18:49931156-49931178 GATGGTGCCCTGGAGCTGCCTGG + Intronic
1157900343 18:51508954-51508976 TTTTCTGCCCTGGGGGAGCCAGG + Intergenic
1159587010 18:70290622-70290644 CTTGGTGCCTTGGAGGAACCTGG + Intronic
1160496289 18:79377707-79377729 CTCTGTGCCCTGGGCTTGCCTGG - Exonic
1160584270 18:79903985-79904007 CTTGGTGCCAGTGGGGTGCACGG + Exonic
1160845775 19:1165393-1165415 AGTGCTGCCTTGGGGGTGCCCGG - Intronic
1160884649 19:1340074-1340096 TTTGATGCCCTTGGGGTGCCTGG + Intergenic
1160947499 19:1650564-1650586 CTTGATGCCCTGGTGTTCCCTGG - Intronic
1161135691 19:2618243-2618265 CTCAGTGCCCTGGGGTTGGCAGG - Intronic
1161245362 19:3248984-3249006 CCTGGAACCCTGGGGGTACCAGG - Intronic
1161349330 19:3783572-3783594 GATGGGGGCCTGGGGGTGCCTGG + Intronic
1161569116 19:5020584-5020606 CTTGGTGCCCAGAGGAAGCCAGG + Intronic
1161703073 19:5805337-5805359 CGCGGTGCCCGGGGGGGGCCCGG - Intergenic
1161768200 19:6218149-6218171 CTTGGGACCCTAGGGGTGTCTGG - Intronic
1162199491 19:9010320-9010342 GTCGGTGCCCTGGGTGTGCAGGG + Intergenic
1162923705 19:13919039-13919061 CAAGGTGCCCTGGGGGTTCCGGG + Exonic
1163035546 19:14566985-14567007 CTCGGTCCCCTGGGGATCCCCGG - Intronic
1163318176 19:16555644-16555666 CTTGGTGCCCTTTGGGGACCTGG - Intronic
1163368173 19:16887889-16887911 CGTCGTGCCCTGGGGGAGTCTGG - Intergenic
1163382201 19:16976547-16976569 CTTGGTGGGCAGGGGGTGCATGG - Intronic
1163432039 19:17274043-17274065 CTGGGTGCCCTGGGGTCCCCTGG + Intronic
1164147138 19:22518959-22518981 CTCAGTGCCCTGGTGGTGGCTGG + Intronic
1164159494 19:22617370-22617392 CTCAGTGCCCTGGTGGTGGCTGG - Intergenic
1164677196 19:30109509-30109531 CTTGGTGCCCACTGTGTGCCTGG + Intergenic
1165187486 19:34034541-34034563 CGTGGTTTCTTGGGGGTGCCTGG - Intergenic
1165419971 19:35717852-35717874 CGTGGTGCCCTGCGCGTGGCCGG + Intergenic
1165939591 19:39408424-39408446 CTTCGAGCCAGGGGGGTGCCAGG - Exonic
1166620658 19:44297303-44297325 CTAGGAGTCCTGGGGGTGGCTGG - Intronic
1166680477 19:44763229-44763251 CTGGGTGACCTGTGTGTGCCTGG + Intergenic
1166802622 19:45467804-45467826 CTCGGGGCCCTGGGGGTCTCGGG - Intronic
1167490740 19:49791640-49791662 CTGGGTGCCCATGGGGTACCAGG - Intronic
1167612606 19:50514640-50514662 CTCTGTGCCTTGAGGGTGCCTGG + Intronic
927131751 2:20066115-20066137 CTTGGTGGCCTGGGATTGTCCGG - Intergenic
929027184 2:37615968-37615990 GTTGGTGGCCTGGGTGTGGCTGG + Intergenic
933726356 2:85429782-85429804 GCTGGTGCCCTGGGGAAGCCGGG - Intronic
934765805 2:96879423-96879445 CCTGGCGCCCTGGGAGGGCCGGG - Intronic
937361249 2:121231581-121231603 CTGGGTGCCCGGTGGGAGCCAGG - Intronic
937979984 2:127609163-127609185 AAAGGTGCTCTGGGGGTGCCCGG - Intronic
941015078 2:160346340-160346362 CATGGGGCCCTGGGGCAGCCTGG + Intronic
945032907 2:205682149-205682171 CGGCGCGCCCTGGGGGTGCCCGG + Intronic
946050149 2:216855669-216855691 CTTTGTGCTCTGGGGGTAGCTGG - Intergenic
946830694 2:223725528-223725550 CCGGGTGCCCTTGGGGTGCCTGG + Intergenic
947632935 2:231665512-231665534 ATTGGTGCCCTGCGGGCTCCAGG - Intergenic
948382982 2:237563978-237564000 CTTGGTGCCCTGGGAGGGCAGGG - Intergenic
948429255 2:237908846-237908868 GTCTGTGCCCTGGGGGTGACAGG + Intronic
948794230 2:240393949-240393971 CTGTGAGCCCTGTGGGTGCCGGG - Intergenic
948808539 2:240463296-240463318 CCCGAGGCCCTGGGGGTGCCTGG - Intronic
948858122 2:240740134-240740156 CTGGATGCCCTGCCGGTGCCAGG + Exonic
948858296 2:240740828-240740850 CCTGGTGCCCTGGGGGCAGCTGG - Intronic
948912391 2:241011083-241011105 CTGGGTCTCCTGGGGGTGGCAGG + Intronic
948912401 2:241011110-241011132 CTGGGTCTCCTGGGGGTGGCAGG + Intronic
948912413 2:241011146-241011168 CTGGGTCTCCTGGGGGTGGCAGG + Intronic
948912426 2:241011182-241011204 CTGGGTCTCCTGGGGGTGGCAGG + Intronic
948912448 2:241011245-241011267 CTGGGTCTCCTGGGGGTGGCAGG + Intronic
948912461 2:241011281-241011303 CTGGGTTTCCTGGGGGTGGCAGG + Intronic
1168806447 20:675007-675029 GTTGGTTCCCTGGGGGTGGCTGG - Intronic
1168995657 20:2130948-2130970 CTAGGTCCCCAGGGGGTTCCAGG - Intronic
1169194205 20:3674627-3674649 CTTGGAGCCCCGGGGTGGCCAGG + Exonic
1169262795 20:4149865-4149887 GTAGGTGCCCTGGGGTTACCGGG + Intronic
1170226397 20:13995744-13995766 CATGTTGCCGTGGGGGTGGCTGG - Exonic
1171304252 20:24091765-24091787 CTTGGAGCCCTGCAGGTGTCAGG + Intergenic
1172447760 20:35002063-35002085 CTTGGGGCCCAGGGCGTCCCGGG - Exonic
1173867631 20:46322715-46322737 CTTGGTGGTTTGGGGTTGCCTGG + Intergenic
1174290606 20:49505837-49505859 CTGGGAATCCTGGGGGTGCCTGG + Exonic
1174390716 20:50216831-50216853 CTGGGGGCCATGAGGGTGCCTGG + Intergenic
1175186464 20:57182342-57182364 TCTGGTGGCCTGGGGGTGCTGGG - Intronic
1175487191 20:59354852-59354874 CTTGGCCCCTTGGAGGTGCCAGG - Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1175944900 20:62554110-62554132 CCTGGGCCCCTGGGGGTGGCTGG + Intronic
1176008050 20:62876842-62876864 CTTGTGGGCCTGTGGGTGCCAGG + Intergenic
1176189814 20:63803100-63803122 TGAGGTGCCCTGGGGGAGCCGGG - Intronic
1176372237 21:6069036-6069058 TTTGCTGTCTTGGGGGTGCCAGG - Intergenic
1176382155 21:6118954-6118976 CCTGGTGCCCCCGGTGTGCCCGG + Intronic
1176408927 21:6437248-6437270 CTTGGTGTTCTCAGGGTGCCCGG - Intergenic
1178390297 21:32192476-32192498 TTTGGTGGCCTGGGGGTCCTGGG - Intergenic
1179684420 21:43045570-43045592 CTTGGTGTTCTCAGGGTGCCCGG - Intergenic
1179741317 21:43419285-43419307 CCTGGTGCCCCCGGTGTGCCCGG - Intronic
1179751282 21:43469503-43469525 TTTGCTGTCTTGGGGGTGCCAGG + Intergenic
1179960162 21:44763650-44763672 CTGGGTGTCCTGGGTGTGCTGGG - Intergenic
1179960239 21:44763910-44763932 CTGGGTGTCCTGGGTGTGCAGGG - Intergenic
1179960278 21:44764031-44764053 CTGGGTGTCCTGGGTGTGCAGGG - Intergenic
1180065093 21:45408488-45408510 CTTTGGGCCCCGGGAGTGCCAGG + Intronic
1180091368 21:45535236-45535258 CTGGGTGCACTGAGGTTGCCTGG - Intronic
1181485294 22:23226978-23227000 ATTGGTGACCTGGAGGTGTCTGG + Intronic
1181575575 22:23792375-23792397 CCTGGTGGCCTGCGTGTGCCTGG + Intronic
1182472123 22:30555112-30555134 CTTGGTGCCCAGCGGCTGCCAGG + Exonic
1183032612 22:35117089-35117111 CTTGGTGCCCTGGCAGGGTCTGG - Intergenic
1183348480 22:37320720-37320742 CTTCGTGGTCTGGGGTTGCCAGG + Intergenic
1184067950 22:42130828-42130850 CCTGGTGGGGTGGGGGTGCCAGG - Exonic
1184070687 22:42144501-42144523 CCTGGTGGGGTGGGGGTGCCAGG - Intergenic
1184252689 22:43269706-43269728 CCTGGAGCCTTGGGGGTGGCAGG + Intronic
1184321099 22:43742770-43742792 CGGGGTGCAGTGGGGGTGCCGGG - Intronic
1185281981 22:49976088-49976110 CTTGGGGCCATGGGGCTGCCAGG + Intergenic
1185311730 22:50159826-50159848 CTTGCTGCCCTGGGGGTTCTGGG + Intronic
949160186 3:872787-872809 CGGGGTTCCCTGGAGGTGCCTGG - Intergenic
950096818 3:10335459-10335481 CTAGGTGGCCTGGGGATCCCTGG + Intronic
950560492 3:13718673-13718695 CCTGGTTCCCAGCGGGTGCCCGG - Intergenic
951907771 3:27721510-27721532 CTGGGGGGCCTGGGGGTTCCAGG - Exonic
952517434 3:34120005-34120027 CTTTATGCCCTGGGTGGGCCAGG - Intergenic
954406503 3:50348233-50348255 TCTTGTGCCCTGTGGGTGCCAGG + Exonic
954539846 3:51386000-51386022 TTTGATGCCCTGGGTGTACCAGG + Intronic
954692740 3:52404317-52404339 TTTGGGGCCCTGGGGGAGGCTGG - Intronic
959003144 3:100988446-100988468 CTTTGGCCCCTGGGGTTGCCTGG + Intronic
959378477 3:105613488-105613510 CTTTGAGCCCAGTGGGTGCCAGG + Intergenic
959933001 3:112002974-112002996 CTTGTTGCCCTGGAGCTGACTGG - Intronic
960946609 3:122971110-122971132 CATAGTGCCCTGGAAGTGCCAGG + Intronic
961937372 3:130599772-130599794 CCTGGTGTCCCGGGGGGGCCTGG - Exonic
962199621 3:133390626-133390648 CATAGTGCCCTGGGAGTGCTCGG - Intronic
963208102 3:142657197-142657219 CTTGCTGCCCTAGGAGTGGCAGG - Intronic
963870836 3:150411037-150411059 GTTGGTGCGCTGTGTGTGCCTGG - Exonic
964979464 3:162661435-162661457 CTTGGGGCCTTGGGCATGCCAGG + Intergenic
966852891 3:184175424-184175446 GATGGTGCCATGGGGGTGCGGGG - Intronic
966881877 3:184355110-184355132 CTGGGAGGCCTGGGGGTCCCAGG - Intronic
967857888 3:194132092-194132114 TTTGGTGCCCTGAAGGTGCATGG - Intergenic
968487531 4:871090-871112 GCTGGTGCCCTGTGGGTTCCTGG - Intronic
969526171 4:7705221-7705243 CTGGGGGCCCTGGGTGTTCCTGG - Intronic
970477084 4:16434746-16434768 CTTTGTGCACTAGGTGTGCCTGG + Intergenic
970535578 4:17026887-17026909 CTGGGTGCCCGCTGGGTGCCAGG + Intergenic
971456053 4:26845157-26845179 CCTGATGTCCTGGGGCTGCCAGG + Intergenic
980762653 4:137255931-137255953 CTTTCTGCCCTGGGTGGGCCAGG + Intergenic
983519139 4:168688503-168688525 CTGGGGGCCCTGGGGGTTTCAGG - Intronic
984558941 4:181245572-181245594 CTTGCTGCCCTGGGGTTATCAGG - Intergenic
985630859 5:1013342-1013364 TTTGGTGCCCTCTGTGTGCCTGG + Intronic
985685173 5:1278054-1278076 ACTGGGGTCCTGGGGGTGCCAGG + Intronic
985994992 5:3592809-3592831 CTGGTGGCCCTAGGGGTGCCAGG - Intergenic
986333655 5:6736687-6736709 CTTGGAGCCCATGGGGTGACAGG + Intronic
990267441 5:54092678-54092700 CTTGGTGCCCTGGTGATTTCAGG - Intronic
990468029 5:56087802-56087824 CTCAGTGCCCTGCAGGTGCCAGG - Intergenic
991967813 5:72108792-72108814 TTTGTTGCCCTGGGAGTCCCTGG + Intronic
994197637 5:96936711-96936733 CTCGGTGCCGCGGAGGTGCCTGG + Intronic
997425358 5:133799217-133799239 CCTGGTGCCCACGGGGTGCTGGG - Intergenic
997513149 5:134466612-134466634 CCGGCTGCCCCGGGGGTGCCCGG + Intergenic
998156882 5:139792154-139792176 CTTGGGGTCGTGGGGGTGCTGGG + Intergenic
998903218 5:146877846-146877868 CGAGGTGCACTGGGGCTGCCGGG + Intronic
999504024 5:152176900-152176922 CTTAGTGCCCTCGGCCTGCCTGG - Intergenic
1000007479 5:157200517-157200539 GTTGGTCCCCGGGGGGTGGCTGG - Intronic
1000725789 5:164769257-164769279 CGTTCTGCCCTGGGTGTGCCAGG + Intergenic
1001289875 5:170449441-170449463 CTTGGAGCCCTGGAAGTGCCAGG - Intronic
1001978472 5:176020795-176020817 CTTGGTGCCCTGTGAGGGCAGGG - Intronic
1002059191 5:176616494-176616516 CATGGTGCCCTTGAGGAGCCAGG + Intergenic
1002059994 5:176620432-176620454 CGGGGTGCTCTGGGGCTGCCCGG + Exonic
1002100480 5:176855269-176855291 CATGGAGCCCTGGAGTTGCCGGG - Intronic
1002176232 5:177403004-177403026 CTTGGTTCCCTCTGGGCGCCGGG - Intronic
1002180348 5:177428026-177428048 CTTGGTGGGCACGGGGTGCCAGG - Intronic
1002238945 5:177822967-177822989 CTTGGTGCCCTGTGAGGGCAGGG + Intergenic
1002261556 5:177996816-177996838 CATGGTGTCCTGGGGGTTCTGGG - Intergenic
1002425995 5:179176305-179176327 CTTGCTGCCTAGGGGGAGCCTGG - Intronic
1002471472 5:179438477-179438499 CTGGGGGTCCTGGGGGTCCCAGG - Intergenic
1002563977 5:180099893-180099915 CATGTTGCCCAAGGGGTGCCAGG + Intergenic
1002789190 6:425150-425172 CTTGGAGCTCTGGAGCTGCCTGG - Intergenic
1003320810 6:5049429-5049451 CATGGTTTCCTGGGGGTGGCAGG - Intergenic
1006068946 6:31483149-31483171 CTTGCTGCCCTGGGGCGGCCAGG - Intergenic
1006359479 6:33579434-33579456 CCTACTGTCCTGGGGGTGCCGGG - Intronic
1007492827 6:42237277-42237299 GTGGGTGCCCTGGGTGTGCTGGG + Intronic
1007701440 6:43768713-43768735 CTTTGTTCCCTGGGGCAGCCTGG + Intergenic
1007785803 6:44278536-44278558 CTTGGAGCCCTGAGGTGGCCAGG - Exonic
1008449684 6:51635943-51635965 CTTGGTGCCGTGGGGTTCTCAGG - Intronic
1008598978 6:53070700-53070722 TTTGGTGTCCTGGGGGCTCCTGG + Intronic
1008760465 6:54846898-54846920 CTTGGGGTACTGGGGGGGCCCGG + Intronic
1009930478 6:70171970-70171992 CCTGGTGCAATGGGGTTGCCAGG + Exonic
1010971163 6:82264663-82264685 CTTGGTACCCTGGAGGTCCAAGG - Intergenic
1011698253 6:89932583-89932605 CTGGGTGCCCAGGGGGGTCCGGG + Exonic
1014002879 6:116384485-116384507 CTTTGTGCCTTGGGGGAGGCTGG + Intronic
1015514600 6:134071575-134071597 CATGGGGCCCTGGAGGTGCCAGG + Intergenic
1017533503 6:155321737-155321759 CTTGGTGCCCCTTGTGTGCCAGG - Intergenic
1018264525 6:162008321-162008343 CTTCGTGCCCCGGGGGCCCCAGG + Intronic
1018804624 6:167249182-167249204 CTGTGTGCCCTGGGGGTGCTGGG - Intergenic
1018825917 6:167407864-167407886 CTGTGTGCCCTGGGGGTGCTGGG - Intergenic
1018908608 6:168089185-168089207 AGTGGTTCCCTGGGGGTCCCTGG + Intergenic
1019335686 7:481525-481547 CTTGGTGCCTCTGGGGGGCCAGG + Intergenic
1019351482 7:556114-556136 CAGGGTGGCCTGGGGGTGCCTGG - Intronic
1019434075 7:1012763-1012785 CCAGGGGCCTTGGGGGTGCCCGG + Intronic
1019501468 7:1366954-1366976 CTTGGTTCCCCGGGGATGCCTGG - Intergenic
1019517935 7:1447855-1447877 CTTGGTGCCCGGGGGGGACCTGG + Intronic
1019730092 7:2624744-2624766 ATTCCTGCTCTGGGGGTGCCGGG - Intergenic
1020049580 7:5072760-5072782 GCAGGTGCCCTGGGGGTTCCAGG - Intronic
1020098436 7:5381129-5381151 CTTGAGGCCCTGAGGGTGGCAGG - Intronic
1024548290 7:50540094-50540116 CTGGGAGCCATGGGGGTACCTGG - Intronic
1025234274 7:57223314-57223336 CTGGGTGCCCCCCGGGTGCCTGG + Intergenic
1026562058 7:71458553-71458575 CTCAGTGCCCTGTTGGTGCCTGG + Intronic
1026899755 7:74030257-74030279 CTGGCTGTCCTGGGGGAGCCTGG + Intronic
1029115251 7:98233361-98233383 CCAGGTGCCCTGGGGGTGTGGGG - Intronic
1029159305 7:98540553-98540575 CCTGGGGCCCTGGGGCTGCCTGG + Intergenic
1029437846 7:100572829-100572851 CTTGGTCCCCCGGGGGCGCAAGG - Intronic
1030097629 7:105914948-105914970 CTTTGTACCCTAGTGGTGCCTGG + Intronic
1032480092 7:132239265-132239287 CTTGCAGCCCTGGGGGTGGGAGG + Intronic
1034435115 7:151059726-151059748 CTTCGTGCCCCGGGGGTCTCGGG - Intronic
1035459018 7:159028021-159028043 CCTGGTGCCCTGTGGCTGGCAGG + Intergenic
1036606465 8:10309762-10309784 CTTGGTGTCCTTGGGCTGCATGG + Intronic
1036802402 8:11802477-11802499 ATTGGTGCCCTGATGGAGCCGGG - Exonic
1037879673 8:22566538-22566560 GTTGGTGCCCCAGGGGTGGCAGG + Intronic
1038407903 8:27335669-27335691 GTTCATGCCCTGGGGGTCCCTGG + Intronic
1038600979 8:28942123-28942145 CAGGGTGCCCCGGAGGTGCCAGG + Intronic
1039373884 8:37013918-37013940 GTTGGTGTCCTGGTTGTGCCTGG + Intergenic
1039916639 8:41865118-41865140 CTTGGAGCCCTTGGGTGGCCAGG - Intronic
1041447531 8:57969258-57969280 CTCGGAGCCCTGTGGGTGGCGGG + Intergenic
1045000109 8:97871021-97871043 CTTGGTGGCCCTGGGTTGCCTGG - Intronic
1045476628 8:102558087-102558109 TTTCTTGCCCTGGGTGTGCCAGG - Intronic
1045991436 8:108313559-108313581 CTTGGTGTCTTGAGGGTGCTGGG + Intronic
1047181976 8:122597264-122597286 CTTGGGGCCCTGGAGAGGCCAGG - Intergenic
1047786653 8:128159855-128159877 ATTGGTGCCTTGGGGGTGAGGGG - Intergenic
1048297193 8:133223141-133223163 CTTGCTGCCCTGGGGCTGCTGGG - Intronic
1048470270 8:134698694-134698716 CCTGGATCCCTGGGGGTGTCCGG - Intronic
1049216081 8:141409072-141409094 CATGGTTCCCTGGGGATCCCTGG + Intronic
1049308602 8:141921204-141921226 CTCGGTGCCCTGATGGTGGCTGG - Intergenic
1049615409 8:143573726-143573748 GCGGGTGCCCTGGGGGTGCCTGG + Intergenic
1049751077 8:144284455-144284477 CTTGGTGCCCGTAGAGTGCCTGG - Intronic
1049774357 8:144397690-144397712 CTTGGGTCCCTGGGGCTGGCAGG - Intronic
1052192718 9:25677849-25677871 CTCAGGGCCCTGGGGCTGCCCGG + Exonic
1057146041 9:92760194-92760216 CCTGGGCCCCTGGGGGTGCCTGG - Intronic
1057215285 9:93224458-93224480 CCAGGTGTCCTGGGGGTGCTGGG + Intronic
1057726727 9:97573238-97573260 CCTGGTGCCCTGGGGGTCCTGGG - Intronic
1058239624 9:102540709-102540731 TTTTGTGTCCTGGGGGTGGCAGG + Intergenic
1059415515 9:114159948-114159970 CAAGCTGCCCTGGGGTTGCCTGG - Intronic
1060204869 9:121676543-121676565 CCTGGTGCGTGGGGGGTGCCTGG - Intronic
1060252184 9:121995318-121995340 CTGGGTGCCCTGGTGATGCGTGG - Intronic
1060481500 9:124018917-124018939 CTTGGGCCCATGGGGGCGCCGGG + Intronic
1060551223 9:124486298-124486320 CAAGGTGCCTGGGGGGTGCCCGG - Intronic
1060939423 9:127535146-127535168 CTGGGTGCACTGGGGCTGGCTGG - Intronic
1060998868 9:127890978-127891000 CTTGGTGCCCAGCAGGTGGCTGG + Exonic
1061011044 9:127954890-127954912 CTTTGTGCCCTGGGAGTGAGTGG + Intronic
1061118476 9:128628994-128629016 CCTGGTGCCCGGCGGGTACCTGG - Intronic
1061297041 9:129682414-129682436 CTTGGGGGCCTGCGGTTGCCAGG - Intronic
1061444824 9:130631860-130631882 CTCAGTGCCCTGGGGCTGCGGGG + Intronic
1061451666 9:130670299-130670321 CTAAGACCCCTGGGGGTGCCAGG + Intronic
1061824967 9:133252369-133252391 CTTGGTGAGCTGGGGGTGTGGGG - Intronic
1061916887 9:133760056-133760078 CCTGGCCCCCTGGGGGTGGCAGG - Intergenic
1062137904 9:134939311-134939333 CTAGGAGGCCTGGGGGTGGCAGG - Intergenic
1062148450 9:135004493-135004515 CTAGGAGCCCTGGGGCTTCCTGG - Intergenic
1062266194 9:135687566-135687588 GTGGGTCCCCTGGGGGTGCCAGG + Intergenic
1062312743 9:135948033-135948055 CTTGATGAGCTGGGGGAGCCTGG + Intronic
1062340761 9:136093035-136093057 CTCGGTGCCCTGTGCGTTCCAGG + Intronic
1062437572 9:136553394-136553416 CTTGGTGACATGGGGCTGGCTGG + Intergenic
1062551582 9:137089910-137089932 CTTGGTGGGCAGGTGGTGCCAGG + Intronic
1062558299 9:137127270-137127292 CTTGGTGGGCAGGTGGTGCCGGG - Intergenic
1062612900 9:137382971-137382993 CTGGGTGCTCTGGCGGTGGCAGG + Intronic
1062613101 9:137383767-137383789 CTTGGGGTCCTCGTGGTGCCAGG - Intronic
1062693311 9:137856912-137856934 CTTGGGTCCCTGGGAGTGCAAGG + Intronic
1186220696 X:7346036-7346058 CTGGGTTCCCTGGGATTGCCTGG - Intronic
1189670317 X:43401197-43401219 TTTTGTGCCCTGGGTGGGCCAGG - Intergenic
1191823581 X:65339671-65339693 CTTGGTGTGCTGGGGTTTCCTGG + Intergenic
1192183272 X:68929527-68929549 CCAGGTGCCCTGAGGCTGCCTGG + Intergenic
1195218325 X:102721926-102721948 CTTGGTACCCAGTGGGTGCATGG - Intronic
1195230128 X:102838654-102838676 CTTTGTGCCCTGAGGCTGCCAGG - Intergenic
1198036059 X:132802658-132802680 CCTGGTGCCCTGCGGTTCCCAGG - Intronic
1198466224 X:136907081-136907103 CTTGGTGCCCAGCAGGTGGCTGG + Intergenic
1199503572 X:148536350-148536372 CCTGGAGGGCTGGGGGTGCCTGG + Intronic
1200683133 Y:6236237-6236259 CATGGGCCCCTGGTGGTGCCAGG - Intergenic
1201049499 Y:9918149-9918171 CATGGGCCCCTGGTGGTGCCAGG + Intergenic
1202021519 Y:20469413-20469435 CTTAGTGCCCTCAGGGTGCTGGG - Intergenic
1202169792 Y:22031287-22031309 TTTTCTGCCCTGGGTGTGCCAGG - Intergenic
1202221574 Y:22555086-22555108 TTTTCTGCCCTGGGTGTGCCAGG + Intergenic
1202321544 Y:23640586-23640608 TTTTCTGCCCTGGGTGTGCCAGG - Intergenic
1202549223 Y:26029470-26029492 TTTTCTGCCCTGGGTGTGCCAGG + Intergenic