ID: 1083583395

View in Genome Browser
Species Human (GRCh38)
Location 11:63839371-63839393
Sequence GCCTCCCCGCACCCCCGGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 764
Summary {0: 1, 1: 0, 2: 7, 3: 92, 4: 664}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083583383_1083583395 18 Left 1083583383 11:63839330-63839352 CCCGAGCGGCGCATCCCCGGGCT 0: 1
1: 0
2: 1
3: 8
4: 74
Right 1083583395 11:63839371-63839393 GCCTCCCCGCACCCCCGGCCGGG 0: 1
1: 0
2: 7
3: 92
4: 664
1083583389_1083583395 2 Left 1083583389 11:63839346-63839368 CCGGGCTGGCGTGAGCGGCTGCC 0: 1
1: 0
2: 1
3: 9
4: 203
Right 1083583395 11:63839371-63839393 GCCTCCCCGCACCCCCGGCCGGG 0: 1
1: 0
2: 7
3: 92
4: 664
1083583387_1083583395 4 Left 1083583387 11:63839344-63839366 CCCCGGGCTGGCGTGAGCGGCTG 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1083583395 11:63839371-63839393 GCCTCCCCGCACCCCCGGCCGGG 0: 1
1: 0
2: 7
3: 92
4: 664
1083583380_1083583395 23 Left 1083583380 11:63839325-63839347 CCTAGCCCGAGCGGCGCATCCCC 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1083583395 11:63839371-63839393 GCCTCCCCGCACCCCCGGCCGGG 0: 1
1: 0
2: 7
3: 92
4: 664
1083583388_1083583395 3 Left 1083583388 11:63839345-63839367 CCCGGGCTGGCGTGAGCGGCTGC 0: 2
1: 0
2: 0
3: 19
4: 261
Right 1083583395 11:63839371-63839393 GCCTCCCCGCACCCCCGGCCGGG 0: 1
1: 0
2: 7
3: 92
4: 664
1083583384_1083583395 17 Left 1083583384 11:63839331-63839353 CCGAGCGGCGCATCCCCGGGCTG 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1083583395 11:63839371-63839393 GCCTCCCCGCACCCCCGGCCGGG 0: 1
1: 0
2: 7
3: 92
4: 664

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083583395 Original CRISPR GCCTCCCCGCACCCCCGGCC GGG Exonic
900098817 1:952309-952331 GCCTCCCCGAAGCCCCTGTCTGG - Intronic
900177245 1:1296334-1296356 CCCAACCCCCACCCCCGGCCTGG + Intronic
900206345 1:1433452-1433474 GCCACCCCGCCCCCACGGTCTGG - Intergenic
900226517 1:1535824-1535846 CTCTCCCGCCACCCCCGGCCTGG + Intronic
900410324 1:2509730-2509752 GCCTCTCCTGACCCCAGGCCCGG - Intronic
900613315 1:3553496-3553518 GCCTCCCCACACCCCAGGCAGGG + Intronic
900652340 1:3735861-3735883 GCTTCCCAGCAGCCCAGGCCTGG - Exonic
900952335 1:5865052-5865074 GCCTCTCCCCAACCCCAGCCTGG - Intronic
901641233 1:10694178-10694200 GCCTCGCGGATCCCCCGGCCAGG - Intronic
901841810 1:11958353-11958375 GCCCCCCCGTACCCCCTGACTGG + Intronic
902400743 1:16155530-16155552 GACTCCCCACGCCCCCCGCCGGG + Intronic
902483680 1:16727264-16727286 GCCTCTACACACCCACGGCCTGG - Intergenic
903324760 1:22563526-22563548 CGCTCTCCGCACACCCGGCCGGG - Intergenic
903324780 1:22563606-22563628 GCGCCCCCGCCCGCCCGGCCCGG + Exonic
903596992 1:24502748-24502770 GCCCCCGCGCGCCCCCGCCCCGG + Intronic
903647295 1:24903022-24903044 GCCTCCCAGCAGCCCTGCCCAGG + Intronic
903907810 1:26697839-26697861 TCACCCCCTCACCCCCGGCCAGG - Intronic
904039475 1:27575744-27575766 CCCTTCCCGCGCCCCGGGCCCGG + Intronic
904618806 1:31763635-31763657 GCCCCCCCCCTCCCCCAGCCTGG - Intronic
904772097 1:32886316-32886338 TCCGCCCCCCACCCCCGCCCCGG - Intronic
904814066 1:33182081-33182103 GCCTCCCCGCCCCCGTGGGCGGG + Intergenic
905044476 1:34985117-34985139 GCCGCTCCTCGCCCCCGGCCCGG - Intronic
905212714 1:36385672-36385694 GCCTACCCGCAACCCCCACCCGG + Intronic
905214568 1:36397738-36397760 GGCTCCCTGCACCGCCGACCCGG + Intronic
905443059 1:38006545-38006567 GCCTCCCCACACCCCAGGCTGGG + Intergenic
905717166 1:40161745-40161767 GACTCGCCGCGCCCCCGGGCCGG + Intronic
905789779 1:40783933-40783955 GCCCGCCCGCGGCCCCGGCCCGG + Intergenic
905883171 1:41477519-41477541 TCCTCCCCGCTCCCTCTGCCTGG + Intergenic
906677771 1:47705668-47705690 GTCTCCCTGCACCCCCAGCTTGG - Intergenic
906720009 1:47997456-47997478 GCCCCCCCGCCCCCCGCGCCAGG - Intergenic
907287161 1:53389352-53389374 ACTTCCCCCCACCCCCAGCCTGG - Intergenic
907319251 1:53592529-53592551 GTCTCCCAGCAGCCCTGGCCTGG + Intronic
909957896 1:81801622-81801644 GCCACCGCTCAGCCCCGGCCGGG + Intronic
910251169 1:85200844-85200866 GCCTCCCCGCTCCCCGTCCCGGG + Exonic
910449046 1:87328698-87328720 AGCTCCCTGCACCTCCGGCCGGG - Exonic
910757873 1:90710621-90710643 ACCACCCCTCACCCCCCGCCAGG - Intergenic
910788020 1:91021727-91021749 GCCTCCCCGAACCCGGGGCCCGG + Intronic
910963375 1:92784798-92784820 GCCTCCCGGCCCGCCCGGCCTGG + Intronic
913009633 1:114670186-114670208 GGTTCCCCTCACCGCCGGCCGGG - Intronic
914086813 1:144461374-144461396 GACTCACCGCCCGCCCGGCCTGG + Intronic
914192714 1:145425316-145425338 GACTCACCGCCCGCCCGGCCTGG + Intergenic
914590620 1:149103264-149103286 GACTCACCGCCCGCCCGGCCTGG + Intronic
915111257 1:153565810-153565832 GCCTCCCCTCACCCCGGTCCAGG - Exonic
915643901 1:157253205-157253227 GCCTCCCCTCACCTCAAGCCTGG + Intergenic
915735342 1:158081028-158081050 GCCCCCCAGCTCCCCAGGCCAGG + Intronic
915839541 1:159203382-159203404 GCTTCCCCCCACCCTCTGCCAGG + Intronic
915914984 1:159935471-159935493 TGCTCCCTGCACCCCCGGTCTGG + Intronic
917192959 1:172437577-172437599 CCCTCCCCCCACCCCCCGGCAGG - Intronic
918018317 1:180659592-180659614 CCCACCCCCCACCCCCCGCCGGG + Intronic
918114099 1:181482549-181482571 GCGTCCCCGCCCCTCCCGCCTGG + Intronic
919084912 1:192910270-192910292 CCCTCCCCGCACCCCGTGACAGG - Intergenic
920352131 1:205344138-205344160 GCCGCCGCGCTCCCCGGGCCTGG - Exonic
920401623 1:205680051-205680073 CCCTCCCCGGAGCCCCGGGCCGG - Intronic
920418305 1:205813089-205813111 GGCTCCCCGGTCCCCCGTCCGGG - Exonic
920516961 1:206592404-206592426 GCCTCCCAGGACCCCTGGGCTGG + Intronic
921060306 1:211579253-211579275 GCCGCCCCGCCCACCAGGCCCGG + Intergenic
922416632 1:225428126-225428148 GCCTCCCCTCCCCACCGGCGAGG + Intronic
922467976 1:225857370-225857392 CCCCCCCCGCCCCGCCGGCCAGG - Intronic
922704171 1:227780275-227780297 GCCTGCCCGCACCTCCTGCCTGG - Intronic
923193886 1:231645660-231645682 CCCTCCCCGCACCCCACGACAGG + Intronic
924801361 1:247331510-247331532 TCCTCCCAGCCCGCCCGGCCGGG + Exonic
924944686 1:248838407-248838429 GCCTCCCCGCTCCCCCCACTCGG + Exonic
1063383988 10:5604490-5604512 GCCCCCACGCACTCCCTGCCCGG + Intergenic
1063448193 10:6133521-6133543 CCCGCCCCGCCCCCACGGCCTGG + Intergenic
1064384646 10:14879171-14879193 GCCTCTCCGCCCGCTCGGCCCGG + Intronic
1064774464 10:18760354-18760376 GCCTCCCCTCACCCCCAGATGGG - Intergenic
1064823433 10:19366231-19366253 GCCTCCCATCACCCCCGGATGGG - Intronic
1064892563 10:20194784-20194806 CCCTCCCCCCACCCCAGGACAGG + Intronic
1065100402 10:22325645-22325667 GCCGCCCCGCACGCCCGCCGAGG + Intronic
1065506430 10:26434531-26434553 GGCTCCCCTCACCCCCTACCAGG + Intergenic
1067044064 10:42974718-42974740 CCCTCACCCCACCCCAGGCCTGG + Intergenic
1068401362 10:56531777-56531799 CCCTCCCCCCACCCCAGGACAGG - Intergenic
1069988050 10:72297671-72297693 TCCTTCCCGCTCCCCCGGGCAGG + Intergenic
1070147531 10:73785801-73785823 GCCTCCCCTCAACCCCCGGCCGG + Exonic
1070591757 10:77806724-77806746 GCCCCACCCCACCCCAGGCCCGG + Intronic
1071107724 10:82117646-82117668 GCCTCACAGCACACCCTGCCAGG - Intronic
1072453170 10:95555268-95555290 GCCCCCCTGCACCCCCCACCAGG - Intronic
1072465182 10:95656486-95656508 GCGTCCCCGCTCCAGCGGCCCGG + Intronic
1072562211 10:96586835-96586857 TCCTCCGCGCCCCTCCGGCCCGG + Exonic
1072782234 10:98258929-98258951 ACCTCCCCGCACCCCCCACCAGG + Intronic
1072983007 10:100115323-100115345 GCCAACCCCCAGCCCCGGCCCGG + Intergenic
1073110690 10:101061544-101061566 GTCTCCCCGCAGCCCAGGGCTGG - Intergenic
1073135510 10:101218015-101218037 GCCTCCCAGTTCCCCCGGCTGGG - Intergenic
1073138733 10:101233980-101234002 GCCTCCCTGCTCCCCAGGCCTGG - Intergenic
1073216610 10:101840051-101840073 GCCACCCCCCCCCCCCGTCCAGG - Intronic
1073392831 10:103193295-103193317 CCCTCCCCGCCCCCGCCGCCCGG + Exonic
1074165870 10:110872642-110872664 GCCTCCCAGCGCCCCCGGCGAGG - Intronic
1074501261 10:114026956-114026978 GCCGCCCCGAATTCCCGGCCTGG - Intergenic
1074635813 10:115316099-115316121 TCTTCCCCTCACCCCCAGCCCGG + Intronic
1075606116 10:123811296-123811318 GCCTCCCCTCACCCCACGACAGG + Intronic
1076345142 10:129774494-129774516 GCTCCCCCGCCCCCCAGGCCAGG + Intergenic
1076502661 10:130949517-130949539 GGCTCCCAGCACAGCCGGCCTGG - Intergenic
1076628911 10:131841188-131841210 GCCTCACCGCACACCCCGCGTGG + Intergenic
1076722052 10:132397059-132397081 GCGGCCGCGCGCCCCCGGCCCGG + Intergenic
1076792678 10:132785511-132785533 CCCGCCCCGCACCCCCCGCGCGG + Intronic
1076796863 10:132802719-132802741 GGCTGGCCGCACACCCGGCCAGG + Intergenic
1076850059 10:133088297-133088319 CCCGCCCCGCGCGCCCGGCCCGG + Intronic
1077043525 11:534870-534892 AGCGCCCCGCACCCCCGGCGGGG + Intronic
1077192818 11:1262552-1262574 GCCTCCCCGCTGACCGGGCCTGG - Intergenic
1077306092 11:1869252-1869274 CCCTCCCAGCATCCCTGGCCAGG - Intronic
1077467073 11:2738524-2738546 ACCTCCCCCCACTCCCAGCCAGG + Intronic
1077696271 11:4395804-4395826 CCCTCCCCCCACCCCAGGACAGG + Intergenic
1077923165 11:6656014-6656036 GCCGCGCCGCGCCCCCGTCCCGG + Intergenic
1078594589 11:12674994-12675016 GCCTCCCCGCGCCCCCTCCGAGG + Intronic
1078729731 11:13963685-13963707 TCCTTCCCGCACCCCGGGACCGG - Intronic
1078845223 11:15114240-15114262 CCCACCCCCCACCCCCGTCCTGG - Intronic
1079039518 11:17049079-17049101 CCCTCCCCGCTCCCCCCACCCGG - Intergenic
1079122521 11:17695920-17695942 CCCTCACCGCAGCCCCGGCCCGG - Intergenic
1079122525 11:17695925-17695947 GCCTCCCCTCACCGCAGCCCCGG - Intergenic
1079407718 11:20160289-20160311 GCCTCCTCGCGCCCCCCGCCGGG - Exonic
1081601732 11:44500197-44500219 CCCTCCCCGCACCCCATGCCTGG - Intergenic
1082767386 11:57180421-57180443 TCCTCCCCTCACCCTCGGCCTGG - Intergenic
1083227638 11:61294890-61294912 TCCTCCCCGCTCCCCCGCCCGGG - Intronic
1083572956 11:63769571-63769593 GCAGCCCCAGACCCCCGGCCCGG + Intergenic
1083583395 11:63839371-63839393 GCCTCCCCGCACCCCCGGCCGGG + Exonic
1083644795 11:64165909-64165931 GTCCCCCCGCGCCCCCGGCCCGG - Exonic
1083779345 11:64909997-64910019 CCCTGCACCCACCCCCGGCCTGG + Intronic
1083970417 11:66070759-66070781 GCCAGGCCGCACCCCCGCCCCGG + Exonic
1084165731 11:67373889-67373911 GCCTCCCCGCCCCCTCCCCCAGG - Intronic
1084186677 11:67476324-67476346 GCCTCCCCACAGCCCCGCCGTGG + Intergenic
1084267948 11:68014601-68014623 GCCTCCCAGCACCACAGCCCCGG + Intronic
1084274616 11:68044981-68045003 GGCTCACCGCATCCCCTGCCGGG + Exonic
1084517290 11:69643769-69643791 GCTTCCCCGCGCCCCCGGGCTGG + Intronic
1085188110 11:74593281-74593303 ACCTCCCCGCACCCCATCCCAGG + Intronic
1085284440 11:75350779-75350801 GCCCCCCGCCACCCCCAGCCTGG - Intronic
1085284571 11:75351547-75351569 GCCCCCACGCGCCCCCCGCCGGG + Intronic
1085574453 11:77589822-77589844 TCCTCCCCGCCTCCCCGGCTTGG - Exonic
1086337140 11:85811188-85811210 GCCCCACCGCACCGCCCGCCGGG - Intergenic
1087854285 11:103072753-103072775 CCCTCCCCCCACCCCCCGACAGG - Intronic
1089243000 11:117098059-117098081 GCCGCCCCGACCCCCCGGCTGGG + Intronic
1089328357 11:117672980-117673002 GCCTCCCCAGACCACCTGCCTGG + Intronic
1089593540 11:119560379-119560401 GCCTCCCTGCAACACAGGCCTGG + Intergenic
1089729628 11:120512020-120512042 GCGGCCCCGCACCCCTGCCCCGG + Intronic
1090653066 11:128823970-128823992 GCCGCCTCCCACCCCCCGCCAGG + Intergenic
1091402255 12:188338-188360 GCCTGCCGGCCCCGCCGGCCCGG - Intergenic
1091498265 12:991129-991151 GCCTCCCCGGGCTCCCGGCTCGG - Intronic
1091582434 12:1797682-1797704 CCCTCCCCTCACCCCCCGCCCGG - Intronic
1092791212 12:12072353-12072375 GCCTCTCAGCACACCCGGCCAGG + Intronic
1093460581 12:19403676-19403698 GCCACCGCGCCCCGCCGGCCTGG - Intergenic
1096098998 12:48957489-48957511 GCGTACCCCCACCCCCAGCCCGG + Exonic
1096538340 12:52289382-52289404 ACCTCCACACAGCCCCGGCCTGG + Intronic
1096540437 12:52303982-52304004 ACCTCCACACAGCCCCGGCCTGG - Intronic
1096691948 12:53326797-53326819 GCATCCACGCACCCCCACCCTGG - Exonic
1096846938 12:54412556-54412578 GCCTGCCCTCACCCCGGCCCTGG + Intronic
1097246931 12:57611863-57611885 GCCCCCCCGCGCCCCCCACCCGG - Intronic
1097321077 12:58227087-58227109 CCCTCCCCCCACCCCAGGACAGG + Intergenic
1097490930 12:60269842-60269864 GCCAGCCCGCGTCCCCGGCCCGG + Intergenic
1097787823 12:63780168-63780190 GCCGCCCAGCAGCCCCAGCCAGG - Intronic
1098028961 12:66235065-66235087 GCCTCCCCACACCACCGACCAGG - Intronic
1099514206 12:83576531-83576553 CCCTCCCCTCACCCCCAGTCAGG + Intergenic
1099721095 12:86362330-86362352 TCCTCCCCTCACCCCATGCCAGG - Intronic
1101298937 12:103457774-103457796 GACTCCCCCCACCCCCTGCCAGG - Intronic
1101874663 12:108590241-108590263 CTCTCCAAGCACCCCCGGCCTGG - Exonic
1102043523 12:109815703-109815725 GCCTCCTGGCACCCACAGCCTGG - Intronic
1102236201 12:111296177-111296199 TCCACCCCCCAACCCCGGCCTGG + Intronic
1102466845 12:113135167-113135189 GCCCCGCCTCACCCCCGGGCAGG - Intronic
1102853913 12:116277348-116277370 GCCGGCCCGCAGCGCCGGCCCGG - Intergenic
1103749767 12:123150835-123150857 CCCGCCCCGCGGCCCCGGCCCGG + Intergenic
1103761368 12:123252636-123252658 GCCACCCCCCACCCCCACCCAGG - Intronic
1103856321 12:123973097-123973119 CCCGCCCCCCAGCCCCGGCCCGG - Intronic
1103949640 12:124543777-124543799 GCCTCCGCGGCCTCCCGGCCTGG - Intronic
1104692671 12:130838862-130838884 GACTCCCGGGACCCCCGCCCTGG + Intronic
1104910838 12:132240291-132240313 CCCTCCCTGTAGCCCCGGCCCGG + Intronic
1105012015 12:132762102-132762124 GCCTCCCCGGGCCCCAGCCCCGG - Intergenic
1105034483 12:132908839-132908861 GCCTCGCCACACCCCCGCCTCGG + Intronic
1105659525 13:22478176-22478198 CCCTCCCCCCACCCCCCGACAGG - Intergenic
1105706711 13:22971747-22971769 CCTTCCCCGCACACCCAGCCAGG + Intergenic
1106101687 13:26698748-26698770 GCCTCCCTGCATCCCCGTCTCGG - Intergenic
1108594397 13:51937437-51937459 CCCTCCCAGCACCCACAGCCTGG + Intronic
1108668208 13:52653178-52653200 TTCTCCCCGCACCGCCGGACAGG + Intronic
1109284789 13:60397430-60397452 CCCGGCCCGCACCCGCGGCCCGG - Intronic
1110188657 13:72704418-72704440 CCCTCCCCCCACCCCAGGACAGG + Intergenic
1110318637 13:74135692-74135714 CCTGCCCCGCGCCCCCGGCCCGG + Intergenic
1110860512 13:80341031-80341053 GCCCCCGCGCCCGCCCGGCCCGG - Intergenic
1111103357 13:83614175-83614197 CCCTCCCCTCACCCCATGCCAGG + Intergenic
1111672385 13:91347844-91347866 GGCCGGCCGCACCCCCGGCCTGG + Intergenic
1112344125 13:98576608-98576630 GGCTCCCCGCGCGCCCGGCTCGG - Intronic
1112611989 13:100964352-100964374 GCCTCCCCGCACCCCACGACAGG + Intergenic
1113566991 13:111325212-111325234 GCCTCCCCGTTCCCCTAGCCTGG + Intronic
1113748896 13:112765143-112765165 GCCCCCCCTCCCCCCCGCCCCGG + Intronic
1113788569 13:113015628-113015650 GCCAGCCTGCACCCCAGGCCGGG + Intronic
1113848474 13:113405090-113405112 TCTTCCCCGCATCCCCGGGCTGG + Intergenic
1113928305 13:113953113-113953135 CCTTCCCCAGACCCCCGGCCTGG + Intergenic
1114155534 14:20099295-20099317 GCCAGCCCGCACCGCCGCCCCGG + Intergenic
1114269406 14:21091927-21091949 GCTTCCCTGCACCCGCGCCCGGG - Exonic
1114647650 14:24264420-24264442 ACCTGCCCCCACCCCCGGGCAGG - Intronic
1115916947 14:38325925-38325947 CCATCCCCGCACCCCAGGACAGG - Intergenic
1116689078 14:48081461-48081483 CCCTCCCCCCACCCCCCGGCAGG - Intergenic
1117183666 14:53217774-53217796 GCCCGCCGGCACCGCCGGCCCGG - Intergenic
1117882718 14:60327985-60328007 GCCTCCCCGCAAACCCGGCCCGG + Intergenic
1118137584 14:63045919-63045941 GCCTGCCCGCACCTCCGCCCCGG - Intronic
1119027792 14:71167722-71167744 GCCTCCCCGCAGGCCGGGCTCGG + Intergenic
1120135912 14:80868059-80868081 GTCTCCCCCCACCCCCTGCCAGG - Intronic
1120167875 14:81220303-81220325 GCCCCCCCGCGCCCGCCGCCCGG + Intronic
1122550168 14:102545073-102545095 GACCCCCCCCACCCCCCGCCCGG - Intergenic
1122646420 14:103197301-103197323 TACTCCCCTCACCCCCGCCCCGG - Intergenic
1122719862 14:103716013-103716035 CCCGCCCCGCCGCCCCGGCCCGG + Intronic
1122830269 14:104392532-104392554 GCCTCCCCGCAAACATGGCCTGG - Intergenic
1122960833 14:105093043-105093065 GCCTCCTCGCACCCCTGTCTGGG - Intergenic
1123018038 14:105384788-105384810 GCCTCCCCGGTGCCCCGCCCAGG - Intronic
1123052167 14:105549794-105549816 GCCCCGCCGCCCCCCAGGCCTGG + Intergenic
1123499271 15:20865845-20865867 GCCTCCTCCCATCCCAGGCCCGG + Intronic
1123556506 15:21439464-21439486 GCCTCCTCCCATCCCAGGCCCGG + Intronic
1123592745 15:21876810-21876832 GCCTCCTCCCATCCCAGGCCCGG + Intergenic
1123717072 15:23040707-23040729 GCCCCCCAGCACCTCCGGCCAGG - Intergenic
1123717299 15:23041457-23041479 GCCCCCCAGCACCTCCGGCCAGG - Intergenic
1123717412 15:23041866-23041888 GCCGCCCAGCACCTCTGGCCAGG - Intergenic
1123717460 15:23042020-23042042 TCCTCCCGGCACCTCTGGCCAGG - Intergenic
1123717651 15:23042646-23042668 TCCTCCCGGCACCTCTGGCCAGG - Intergenic
1123717861 15:23043346-23043368 GCCCCCCAGCACCTCCGGCCAGG - Intergenic
1123718066 15:23044055-23044077 TCCCCCCAGCACCCCTGGCCAGG - Intergenic
1123718432 15:23045345-23045367 TCCTCCCGGCACCTCTGGCCGGG - Intergenic
1123718477 15:23045488-23045510 GCCCCCCAGCACCTCTGGCCAGG - Intergenic
1123718543 15:23045714-23045736 GCCCCCCAGCACCTCCGGCCAGG - Intergenic
1123718634 15:23046051-23046073 TCCTCCCGGCACCTCTGGCCAGG - Intergenic
1123718705 15:23046307-23046329 TCCTCCCGGCACCTCTGGCCAGG - Intergenic
1123718844 15:23046783-23046805 GCCCCTCGGCACCTCCGGCCAGG - Intergenic
1123718944 15:23047120-23047142 TCCCCCCAGCACCCCTGGCCAGG - Intergenic
1123719049 15:23047489-23047511 GCCTCCCAGCACCTCCGGCCAGG - Intergenic
1123719158 15:23047863-23047885 TCCCCCCAGCACCCCTGGCCAGG - Intergenic
1123719340 15:23048494-23048516 GCCTCCCAGCACCTCCGGCCAGG - Intergenic
1123719439 15:23048831-23048853 GCCCCCCAGCACCTCTGGCCAGG - Intergenic
1123719507 15:23049057-23049079 GCCCCCCAGCACCTCCGGCCGGG - Intergenic
1123719542 15:23049175-23049197 TCCTCCCGGCACCTCTGGCCAGG - Intergenic
1123719679 15:23049650-23049672 CCCTCCCAGCACCTCTGGCCAGG - Intergenic
1123719828 15:23050188-23050210 CCCCCCCGGCACCTCCGGCCAGG - Intergenic
1124208639 15:27744188-27744210 GCCCCTCCGCACCCTCAGCCTGG + Intergenic
1125759998 15:42089752-42089774 GCTCCCCTGCTCCCCCGGCCAGG + Intronic
1127433292 15:58933204-58933226 CCCGCCCCGCGCCCCGGGCCGGG - Intronic
1127970216 15:63952934-63952956 CCTTCCCCCCACCCCTGGCCTGG + Intronic
1127988795 15:64096055-64096077 GCCTCCGCCCTTCCCCGGCCTGG + Exonic
1128681394 15:69654540-69654562 GCCTACCCCCAACCCTGGCCAGG - Intergenic
1128742752 15:70095512-70095534 TCCACGCCGCGCCCCCGGCCGGG + Intronic
1129273873 15:74433212-74433234 GCCTGCCCCCGCCCCCGCCCCGG - Intronic
1129559623 15:76552738-76552760 GCCTGCCCCCACCCCCAGCCAGG + Intronic
1129795971 15:78376110-78376132 GCCTCCCCCCACCCCACGACAGG + Intergenic
1129933909 15:79433247-79433269 CGCTCCCCGCACCGCCGGCGAGG - Intronic
1130224404 15:82046258-82046280 GCCTCCTCCCGCCCCCGGCCTGG - Intergenic
1130908694 15:88256833-88256855 TCCTCCCCCCGCCCCCCGCCCGG + Intergenic
1131025530 15:89138109-89138131 GCCTCCCTGCTCCACAGGCCTGG - Intronic
1131076249 15:89496615-89496637 GCCGCCCCGCCCCCCTGCCCGGG - Intergenic
1131144455 15:90002109-90002131 CGCTCCCCCCACACCCGGCCCGG + Intronic
1131831982 15:96360236-96360258 GGCTTCCCGCACCCCAGGCTGGG + Intergenic
1131977468 15:97960853-97960875 GCCTCCCCGCCCATCCCGCCGGG - Exonic
1132112519 15:99112620-99112642 AGCTCCCCTCACCCCTGGCCGGG - Intronic
1132147781 15:99438497-99438519 GCCTCCCCCGACCCCCGTCCTGG - Intergenic
1132251954 15:100341259-100341281 GCCGCCCCGCGCGCCCGGCCCGG - Exonic
1132281258 15:100617959-100617981 GCCTCCCCCCACCCCCCACGGGG + Intronic
1132355383 15:101167871-101167893 GCCTCCCCCAACCCTCAGCCCGG - Intergenic
1132482227 16:172490-172512 GTCAGCCCGCACCCCCGCCCCGG - Intergenic
1132483075 16:176294-176316 GTCAGCCCGCACCCCCGCCCCGG - Intergenic
1132575240 16:661000-661022 GCCCCCCCCCCCCCCCGGCCCGG + Intronic
1132583087 16:694213-694235 GGCGCCCCGCGCCCCCGCCCAGG + Exonic
1132618427 16:853305-853327 CCCTCCCCTCTCCCCCAGCCTGG - Intergenic
1132691123 16:1182420-1182442 GGCTCCCCGCACCCCTGCGCTGG + Intronic
1132719742 16:1309791-1309813 CCCGCCCCGCGGCCCCGGCCCGG - Intronic
1132760722 16:1507393-1507415 GTCTGCCTGCACCCCTGGCCTGG - Intronic
1132805146 16:1771801-1771823 CCCCCCGCGCCCCCCCGGCCAGG + Intergenic
1132851657 16:2027386-2027408 GCCCCCCCCCACCCCCGTGCAGG - Intronic
1132987812 16:2777184-2777206 GCCCCCCGCCGCCCCCGGCCCGG + Intronic
1134537814 16:15040743-15040765 TCCCCCCAGCACCCCAGGCCCGG - Intronic
1134849748 16:17470497-17470519 GCCTCCCCGCGCCCGCGCCTGGG + Exonic
1135206999 16:20492453-20492475 GCCTCCTCGCAGCCTGGGCCGGG - Intergenic
1135211886 16:20531179-20531201 GCCTCCTCGCAGCCTGGGCCGGG + Intergenic
1135258525 16:20961338-20961360 CCCTCCCCGCACCCCACGACAGG - Intronic
1135517754 16:23149484-23149506 GCCTCCCGGCGCCGCCCGCCCGG + Intergenic
1136382085 16:29900432-29900454 GCCTCCCCACCCCCCCCGCCCGG - Intronic
1136403551 16:30030880-30030902 GCCTCCCCTCCCCACCTGCCTGG - Exonic
1137683090 16:50368443-50368465 GCGCCGCCGCACCCCCGGGCCGG - Intronic
1139286308 16:65817480-65817502 GCCTCTCCGCACCCAAGACCTGG + Intergenic
1139292087 16:65868205-65868227 GGCTCCCTGCACTCCCTGCCTGG - Intergenic
1139785046 16:69385865-69385887 CCCTCCCCGCCCTCCCGGCCGGG + Exonic
1140471679 16:75218910-75218932 CCCCCCCCGCTCCCCCAGCCAGG - Intergenic
1141054784 16:80804628-80804650 GCCTCCCCGCCCCGGGGGCCGGG - Intergenic
1141160268 16:81625145-81625167 TCCTCCCAGCCCTCCCGGCCTGG + Intronic
1141538628 16:84700438-84700460 CCCTCCCCGCCGCGCCGGCCGGG + Intronic
1141599938 16:85119498-85119520 GCCTCCGCCCAGCCCCTGCCAGG - Intergenic
1141622218 16:85242356-85242378 CCCTCCCCGCACCCCCATGCAGG + Intergenic
1141681532 16:85547052-85547074 GCCTCACCACACCCCTGTCCAGG + Intergenic
1141846319 16:86611328-86611350 GCCTCCCAGCACCCTGAGCCTGG + Intergenic
1141999333 16:87655192-87655214 GCCTTCCCGCCACCCCCGCCAGG + Intronic
1142395128 16:89827962-89827984 GCCTCCCCGAGCCCCGGGCAAGG - Intronic
1142614244 17:1125564-1125586 GCCTCCCAGCAGCCCCGGAGCGG - Intronic
1142699332 17:1649752-1649774 GCCTCCCGAGACCCCCAGCCAGG + Exonic
1143188332 17:5023813-5023835 GCCTCCCCGCTCCCCATCCCTGG - Exonic
1143369458 17:6429398-6429420 CCCTGCCCGCCCCACCGGCCGGG + Intronic
1143390512 17:6556675-6556697 GCGGGCCCGCACCCCCGCCCCGG + Intergenic
1143402391 17:6655041-6655063 GGCTCCGCTCATCCCCGGCCAGG + Intergenic
1143446438 17:7012806-7012828 GCCTCCCAGCCCTCCCAGCCCGG - Intronic
1143492859 17:7294255-7294277 GAACCCCCGCCCCCCCGGCCCGG - Exonic
1143519741 17:7438428-7438450 GCTTCCCCCCACGCCCGGCTAGG - Intronic
1143537312 17:7549111-7549133 GCCTCACCGCCCCCCCATCCCGG - Exonic
1143585283 17:7847721-7847743 GCCCCCCACCACCCCCTGCCTGG + Exonic
1144018571 17:11220416-11220438 GCCTCCCAGCACACAGGGCCAGG - Intergenic
1144507942 17:15849268-15849290 GCCTCCCCGGAGCCTGGGCCAGG - Intergenic
1144656925 17:17042721-17042743 GCCCCGCCGCAGGCCCGGCCCGG - Intronic
1144724942 17:17496997-17497019 GCCTCCCCGAGCCGCCGGCCGGG - Intergenic
1144971175 17:19110885-19110907 GCCCCCCCACACTCACGGCCGGG - Intergenic
1144991477 17:19237048-19237070 GCCCCCCCACACTCACGGCCGGG - Intronic
1145172066 17:20666900-20666922 GCCTCCCCGGAGCCTGGGCCAGG - Intergenic
1146052911 17:29567144-29567166 CCCGCCCCCCACCCCCGCCCCGG + Intronic
1146142413 17:30379268-30379290 GCTTCGCCTCACCGCCGGCCTGG + Exonic
1146787355 17:35731782-35731804 GCCCCCCGGCTCCCCCGCCCGGG - Exonic
1146941485 17:36846858-36846880 GGCTCCCCCCACGCCAGGCCCGG + Intergenic
1147110270 17:38256801-38256823 GCCCGCCCGCCCTCCCGGCCGGG + Intergenic
1147184257 17:38705196-38705218 GCCCCCCCGGCCCCCCTGCCCGG - Intergenic
1147264229 17:39225371-39225393 GCCTGTCCGCGCCCCGGGCCCGG - Intronic
1147423108 17:40332235-40332257 TCCTCCCCCCAGCCCTGGCCTGG - Intronic
1147833746 17:43315384-43315406 GCCGCCCCCCACCCCCTTCCCGG - Intergenic
1147883716 17:43670399-43670421 GCCTCTCCCCATCCCAGGCCAGG + Intergenic
1147947189 17:44086777-44086799 GCCTGCCCTCACCCCTGTCCTGG - Intronic
1148080690 17:44966537-44966559 GCCTCCACCCAGCCCCGCCCTGG - Intronic
1148262121 17:46193127-46193149 GCCCGCCCGCCCTCCCGGCCGGG - Intronic
1148419240 17:47531630-47531652 GCCCGCCCGCCCTCCCGGCCGGG - Intronic
1148754037 17:49963205-49963227 CCCTCCCCCCACACCAGGCCTGG + Intergenic
1149347285 17:55751300-55751322 GCCGCCCCGCACTCCCTGCGGGG - Intronic
1149772372 17:59331909-59331931 GCCTCCGGACTCCCCCGGCCGGG + Intronic
1150124591 17:62627954-62627976 GCCTCGGCGCTCCCCCCGCCCGG - Intronic
1150388544 17:64778367-64778389 GCCTCCCCGCCTCCGCGCCCGGG + Intergenic
1150488835 17:65561080-65561102 GCCTCCGCCCCCGCCCGGCCCGG + Intronic
1150626376 17:66843795-66843817 GCCTCCCCCCACCCAGGACCAGG - Intronic
1150830138 17:68511905-68511927 TCCTCCCCGCAGCCCCTGCAAGG - Intronic
1151477983 17:74354549-74354571 GCCTCGCCTCACCCCTTGCCCGG - Exonic
1151938935 17:77281141-77281163 GGCGGCCCCCACCCCCGGCCTGG + Intronic
1152188034 17:78870797-78870819 GCCTCCCCACCCCCCGAGCCTGG + Intronic
1152406626 17:80101631-80101653 GAAGCCCCGCAGCCCCGGCCCGG - Intergenic
1152579707 17:81160475-81160497 GCCTCCCCGCCCCCCCGCAGAGG - Intronic
1152618017 17:81346560-81346582 CGCTCCCCGCACCCCCGACGCGG - Intergenic
1152626462 17:81390093-81390115 GCCTTCCCACACCCCCAACCTGG + Intergenic
1152648882 17:81482814-81482836 GCCTCCCAGCACCCCACCCCTGG - Intergenic
1152729035 17:81960971-81960993 CCGGCCCGGCACCCCCGGCCCGG - Exonic
1152758203 17:82095936-82095958 GGCCCCCCGCACCCCCTGCATGG + Intronic
1154171663 18:12056984-12057006 GCCTCCCCGCTCCCCATCCCTGG + Intergenic
1154196640 18:12271867-12271889 GCGGCCCCGCAGCCCCCGCCCGG + Intronic
1156171745 18:34493995-34494017 GCGGCCCCGCGCCCCCGGGCCGG - Intronic
1156417204 18:36909280-36909302 GCCTCCCCCCACCCCACGACAGG + Intronic
1156482445 18:37444802-37444824 GCCTCCCCGTACCTCCCTCCCGG + Intronic
1157232018 18:45926307-45926329 CACTCACCCCACCCCCGGCCTGG - Intronic
1157298214 18:46461128-46461150 GCCTCCCGGCTCCCCAGTCCAGG - Exonic
1157324316 18:46657782-46657804 CTCTCCCCGCTCCCCCTGCCAGG + Intergenic
1157610492 18:48952133-48952155 GCCCCCCCGCACCCCCCCTCCGG + Intergenic
1157755255 18:50211736-50211758 GCCTCCCCACACTCCCAGGCTGG - Intergenic
1157833504 18:50878789-50878811 GCCCCCCAGCACTCCTGGCCCGG - Intergenic
1157845869 18:51003536-51003558 GCCTCCCCTCACCCCATGACAGG - Intronic
1158427456 18:57352680-57352702 GCCTCCCCCCACCCCCGCCCGGG + Exonic
1158643118 18:59220100-59220122 GCCCCCCAGCCCCCCCGCCCGGG + Intergenic
1159179672 18:64886288-64886310 CCCTCCCCGCACCCCCCCACCGG + Intergenic
1160506541 18:79430251-79430273 GCCTCCCCCCACCGCTGGTCTGG - Intronic
1160580955 18:79884408-79884430 GCCTCTGCTCAACCCCGGCCTGG + Intronic
1160592394 18:79951705-79951727 GCCTCCGCGCAGCTCCGGCGTGG - Intergenic
1160688647 19:450003-450025 GCCGCCCTCCACCCCTGGCCAGG + Intronic
1160762388 19:792004-792026 GCCTCTCCCCACCCCCACCCTGG - Intergenic
1160763937 19:798746-798768 CCCTCCCTTCAGCCCCGGCCAGG - Intronic
1160771815 19:835408-835430 GCCACCCCGCAGCCCCGTCCAGG + Intergenic
1160771830 19:835448-835470 CCCACCCCGCAGCCCCGTCCAGG + Intergenic
1160771845 19:835492-835514 CCCACCCCGCAGCCCCGTCCAGG + Intergenic
1160830812 19:1104254-1104276 CCCCCTCCCCACCCCCGGCCGGG + Intronic
1160887131 19:1355192-1355214 GCCCCCCCTCCCCCCAGGCCCGG - Intronic
1160896974 19:1407673-1407695 CCCTCCCCACAGCCGCGGCCCGG - Exonic
1161017772 19:1991706-1991728 GCCACCCTCCACCCCCGACCAGG + Intronic
1161030510 19:2055993-2056015 GCCATCCCGCGCCCCCAGCCTGG - Intergenic
1161062980 19:2224275-2224297 GCCACCCAGCACCTCCGCCCAGG - Intronic
1161083187 19:2321657-2321679 CACCCCCCGCGCCCCCGGCCAGG + Exonic
1161114211 19:2487944-2487966 GCCTCCCCGGAGCCCTGGCTGGG - Intergenic
1161120329 19:2522127-2522149 GCCTCCACCCACTCCCTGCCAGG - Intronic
1161138111 19:2632672-2632694 GCCTCCACCCACTCCCTGCCAGG + Intronic
1161142000 19:2653665-2653687 GCCTCCACCCACCCCATGCCAGG + Intronic
1161156514 19:2734650-2734672 GCCTCCACCCACTCCAGGCCAGG + Intronic
1161322470 19:3647532-3647554 GCCTCCACCCACTCCCTGCCAGG - Intronic
1161323166 19:3650499-3650521 GCCTCCACCCACTCCGGGCCAGG - Intronic
1161392376 19:4028238-4028260 CCCTCCCCGCCCCCCAGTCCTGG + Intronic
1161395636 19:4043658-4043680 GCCTCCAGGCAGCCCCGGCGAGG + Intergenic
1161406797 19:4095352-4095374 GGCTGCCCACACCCCTGGCCGGG - Intronic
1161408278 19:4102513-4102535 GCGTCCCCCCACTCCCGGCGAGG + Intronic
1161416480 19:4150039-4150061 GCCTCCACCCACCCCGCGCCAGG + Intergenic
1161461313 19:4399563-4399585 GCCTCCACCCACTCCGGGCCAGG - Intronic
1161478369 19:4498580-4498602 GCCTCCACACACCACCTGCCGGG - Intronic
1161543172 19:4864680-4864702 TCCTCCCCACACCCCTGACCTGG - Intronic
1161560392 19:4969506-4969528 GCCCCCGCGCGCCCCCGGCCCGG - Intronic
1161735530 19:5990148-5990170 GCCTCCACCCACTCCCTGCCAGG - Intergenic
1161767609 19:6216071-6216093 CCCTCCCCCCACCTCCAGCCTGG + Intronic
1161770555 19:6228646-6228668 GTCTCCCAGCACCCACGGCGGGG + Intronic
1161808751 19:6459633-6459655 GCCTCCCCTCCCCCCCGGGCGGG - Exonic
1161848014 19:6723326-6723348 GCCTCCCCCTACCCCTGGCACGG - Intronic
1162013186 19:7830284-7830306 TTCGCCCCGCAGCCCCGGCCCGG - Intronic
1162027869 19:7904460-7904482 GGCGCCCCCCTCCCCCGGCCTGG + Intronic
1162315591 19:9936440-9936462 GCGACCCCGCCCGCCCGGCCGGG + Exonic
1162405186 19:10468908-10468930 TCCTCCCCTCGCCCTCGGCCTGG + Exonic
1162523483 19:11194916-11194938 CCCTCCCCTCAGCCCAGGCCCGG + Intronic
1162909120 19:13840029-13840051 GCCTCCCCCCACCCCAGCCCTGG - Intergenic
1162959621 19:14118091-14118113 GCCGCCCCGCCCCGCCGGCCCGG - Intergenic
1163085884 19:14979598-14979620 GGGTCCCCGCGGCCCCGGCCGGG - Intronic
1163304822 19:16471612-16471634 GCCTCCGCGGGTCCCCGGCCTGG + Intronic
1163370378 19:16897858-16897880 GCGCGCCCGCACCCCCGGCCCGG - Intronic
1163371934 19:16905991-16906013 GTCTCCCAGCACCCCTGTCCTGG + Intronic
1163655506 19:18543117-18543139 GACGCCCCACAGCCCCGGCCGGG + Intronic
1163663943 19:18594469-18594491 GCCCGCGCGCACCCCCTGCCGGG - Intronic
1163754081 19:19096251-19096273 GCCTCCCCACCCCCCCTCCCAGG + Intronic
1164837787 19:31369120-31369142 GCCTCCCCGAACCCCCTTACTGG + Intergenic
1165096571 19:33412982-33413004 GCCTCCAAGCACACCCAGCCAGG + Intronic
1165427863 19:35755705-35755727 GCGGCCCCGCCCCTCCGGCCCGG + Intronic
1166305158 19:41933107-41933129 GCCACCTCGCGCCCTCGGCCTGG - Intergenic
1166371292 19:42302600-42302622 CCCTCCCCCCACCCCGTGCCGGG - Exonic
1166567554 19:43774447-43774469 ACCTCCCCGCAGCCCTGGCCGGG - Exonic
1166705656 19:44906542-44906564 GACTCCTCCCACCCCCAGCCCGG - Intronic
1166774173 19:45302545-45302567 GCCCGCCCGCACCCCCGTGCAGG - Exonic
1166790684 19:45396766-45396788 CCCTCCCCGCGGCCCGGGCCAGG - Exonic
1167158978 19:47755531-47755553 CTCTCCCAGAACCCCCGGCCTGG - Intronic
1167703673 19:51065792-51065814 GTCTCCAGGCACCCCCGACCTGG + Intergenic
1168104538 19:54158605-54158627 GCCTACCCTCACCCCCAGCTAGG - Intronic
1168231148 19:55032422-55032444 GCCTCCCCGCAGACCCCGCCTGG + Intronic
1168239549 19:55082258-55082280 CCCTCCCCACGCCCCAGGCCCGG + Exonic
1168287639 19:55342418-55342440 TCCTCCCCGCTCACCGGGCCTGG + Intronic
925201266 2:1969208-1969230 ACCTGCCCGCATCCCCCGCCGGG - Intronic
925218906 2:2121980-2122002 TGCTCCCCGCACCCCTGACCAGG + Intronic
925230127 2:2225681-2225703 ACCTGCCCCCACCCCCGCCCCGG - Intronic
925408551 2:3625413-3625435 GCCTTCCCTAACCCCCGCCCTGG - Intronic
926151284 2:10427001-10427023 TCCTCCCCTCACGCCTGGCCCGG + Exonic
927363592 2:22267231-22267253 GCCTCCCCCCACCCCATGACAGG - Intergenic
928100953 2:28437103-28437125 GCCTCCCCCCACCCCCACCCTGG - Intergenic
929761982 2:44814517-44814539 GCCTTCCCCCACCCCCTGCATGG - Intergenic
931253325 2:60551568-60551590 GCCTCCCCTCCCCTCCGCCCTGG - Intronic
931587285 2:63841734-63841756 CCCTCCCCGCGCCGCCGTCCAGG - Exonic
931699287 2:64896924-64896946 CCCTCCCCCCACCCCAGGACAGG - Intergenic
931859414 2:66338819-66338841 GCCTCCCCCCACCCCACGACAGG + Intergenic
932329497 2:70889621-70889643 GCCTGCCCGCCTCGCCGGCCTGG - Intergenic
932574342 2:72954591-72954613 CCCTGCCCGCAGCCCCAGCCAGG + Intronic
932610038 2:73192009-73192031 ACCTCCCCCTACCCCCTGCCTGG - Intergenic
933324758 2:80821187-80821209 GCCCCCCCCCACCCCCTGACAGG + Intergenic
933751168 2:85602734-85602756 GCCTCGCCGCGCCGCCCGCCGGG + Intronic
933953470 2:87349637-87349659 ACCACCCCCCACCCCCCGCCCGG - Intergenic
934718427 2:96556515-96556537 GGCTCCCCCCGCCCCCAGCCAGG + Intergenic
934770857 2:96906966-96906988 TGCTCCCCTCACCCCCGGGCCGG - Intronic
935820253 2:106886770-106886792 CCCTCCCCGCGCCCCCGGCCCGG + Intronic
936410546 2:112254645-112254667 TCCACCCCGCTCCCCCGCCCAGG + Intronic
938082226 2:128376351-128376373 CCCTCCCAGCACCCCAGCCCAGG - Intergenic
938416136 2:131105249-131105271 GACACCCCGCCCCACCGGCCGGG + Exonic
941016827 2:160367238-160367260 GCCTCCCCACACCACCGACCAGG - Exonic
942044875 2:172094565-172094587 GCCCCCCCGCCCCCTGGGCCCGG - Intergenic
942284051 2:174395944-174395966 TCCACCCCGCACCCCGGCCCTGG - Intronic
942944384 2:181657027-181657049 GCCTCCCCGGACCCCTGGCTCGG - Intronic
945006774 2:205417077-205417099 CCCTCCCCCCACCCCCCGGCAGG + Intronic
945694268 2:213083214-213083236 GCATCCCCAAACCCCAGGCCAGG + Intronic
946161246 2:217837339-217837361 GCCCCCCAGCACCCCCAGTCTGG + Intronic
946397900 2:219452501-219452523 ACCTCCCCGAACCCCAGGCCCGG - Intronic
948072602 2:235140025-235140047 GCCTCCCCGAACTCCAGGTCTGG - Intergenic
948204230 2:236154000-236154022 GCCCCACTGCACCCCCAGCCTGG - Intergenic
948963277 2:241356475-241356497 GCCTCAGCGCCCCCCCCGCCTGG - Intronic
949018185 2:241725320-241725342 CCCCGCCCGCACGCCCGGCCGGG - Exonic
949060482 2:241953742-241953764 GCGGCCGAGCACCCCCGGCCGGG - Intergenic
1169680189 20:8203551-8203573 CCCCCACCCCACCCCCGGCCTGG - Intronic
1170524770 20:17226855-17226877 GCCCCCGCCCACCCCCGGCCCGG - Intronic
1171456085 20:25273163-25273185 GCCTCCCTGCCCCCTTGGCCAGG - Intronic
1172020064 20:31907926-31907948 TCCTCCCCGCACCCCAGCTCTGG + Intronic
1172021000 20:31913912-31913934 GCCTCCCCGCACCACGAGGCGGG - Intronic
1172118598 20:32585138-32585160 GCCTCCTCCTCCCCCCGGCCGGG + Intronic
1172277077 20:33685823-33685845 GTCACCCCGCACCCCAGGGCGGG + Intronic
1172455727 20:35071429-35071451 CCCTCCCCCCACCCCATGCCAGG + Intronic
1172613218 20:36266818-36266840 GCCTCCCCCCATCCTTGGCCTGG + Intronic
1173664563 20:44755150-44755172 GCCTCCCCAGCCCCCTGGCCTGG + Intronic
1174377047 20:50133209-50133231 GCTGCCCCTCACCCCAGGCCTGG - Intronic
1175394731 20:58650492-58650514 GCCCCCCCGTGCCCCGGGCCGGG - Intergenic
1175847881 20:62068072-62068094 GCCTCCCCTCCCCCCCCCCCCGG - Intergenic
1176119754 20:63448943-63448965 GCATCCCTGCACCCCCAGACTGG - Intronic
1176132164 20:63500731-63500753 GCATCCCCGGGACCCCGGCCTGG - Intergenic
1176178687 20:63739924-63739946 CCCGCCCCGCGCCGCCGGCCGGG + Exonic
1176194400 20:63830835-63830857 CCCGCCCCGCGCCGCCGGCCTGG + Intronic
1176207197 20:63895441-63895463 GCGCCCGCGCAGCCCCGGCCCGG - Intronic
1176207219 20:63895499-63895521 ACCTTCCCGCGCCCCCGCCCCGG - Intronic
1176285432 21:5016693-5016715 GCCTCCCGCCTCCCCCGGCCGGG - Intergenic
1176549488 21:8214992-8215014 TCCTCCCCGCGCCCCCGCCCCGG + Intergenic
1176557383 21:8259221-8259243 TCCTCCCCGCGCCCCCGCCCCGG + Intergenic
1176568413 21:8398026-8398048 TCCTCCCCGCGCCCCCGCCCCGG + Intergenic
1176576325 21:8442256-8442278 TCCTCCCCGCGCCCCCGCCCCGG + Intergenic
1176816846 21:13610754-13610776 GCCTCCTCCCATCCCAGGCCCGG - Intronic
1178074165 21:29000277-29000299 GCCTGCCCGCCCCGCCGGCCCGG + Intergenic
1178533823 21:33396553-33396575 CCCGCCCCCCACCCCCCGCCTGG + Intergenic
1179419889 21:41227019-41227041 GCCTCCCCACAACCCCACCCAGG - Intronic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1179495114 21:41766662-41766684 GCCCCCGCGCCCCTCCGGCCCGG + Intronic
1179871749 21:44246782-44246804 GCCTCCCGCCTCCCCCGGCCGGG + Intronic
1179916297 21:44480373-44480395 GCCTCCCCACAGGCCCGGCCAGG + Intergenic
1179973147 21:44847415-44847437 GGCTCCCCTGACCCCCAGCCTGG - Intergenic
1180037278 21:45256405-45256427 GCCTCCCCTCACCCCGCGCTTGG + Intergenic
1180065245 21:45409069-45409091 CCCTCACCCCACCCCCGGCATGG + Intronic
1180154826 21:45972732-45972754 GAGACCCCGCACCCCGGGCCGGG - Intergenic
1180163112 21:46006814-46006836 GCCTCCTCCCAGCCCCTGCCAGG - Intergenic
1180474621 22:15690768-15690790 GGCTCCCCTCCTCCCCGGCCAGG - Intronic
1181031034 22:20149013-20149035 GGCTCCCCGCACCGCAGCCCTGG + Intronic
1181033069 22:20157503-20157525 GCCTTCGGGCAGCCCCGGCCTGG + Intergenic
1181311956 22:21949743-21949765 GCATCCCAGCACCGCCTGCCTGG + Intronic
1181510240 22:23385734-23385756 GCCTTCGGGCAGCCCCGGCCTGG - Intergenic
1181512292 22:23394389-23394411 GGCTCCCCGCACCGCAGCCCTGG - Intergenic
1181570657 22:23766356-23766378 CCCTCCCCACATCCCCAGCCTGG + Intronic
1181643095 22:24215094-24215116 GCCTCCCAGCACCCCGGCCCAGG + Intergenic
1181670590 22:24423999-24424021 GGCACCCCGCACCCCGGACCCGG - Intronic
1181762358 22:25067204-25067226 CCCTCCCCACACCCCCCACCTGG + Intronic
1183148878 22:36021239-36021261 CCCTCCCCCCACCCCAGGACAGG - Intronic
1183279165 22:36922952-36922974 CCCTCCCCCCACCCCAGGACAGG - Intronic
1183302027 22:37063200-37063222 CTCTCCCCGCCCCCCAGGCCAGG - Exonic
1183365179 22:37403181-37403203 CCCTCCCCCCACCCCCAGGCAGG + Intronic
1183535706 22:38399174-38399196 CCCCCCCCGCCCCCCCCGCCGGG - Intergenic
1183743648 22:39681343-39681365 GCCTCACAGCCCCGCCGGCCAGG - Intronic
1184265458 22:43343598-43343620 GCCTCCAAGCAGCCCCAGCCTGG - Intergenic
1184458859 22:44626043-44626065 GCCCCCACACACCCCCGGCCGGG + Intergenic
1184508135 22:44916580-44916602 GCCTCCCCGTTGCCCCGGGCCGG - Exonic
1184523108 22:45007438-45007460 GCCCCCGCGCGCCCCCGCCCGGG - Intronic
1184583669 22:45433720-45433742 GCCTCCCCACACCTCCTGCCTGG - Intergenic
1184593726 22:45502464-45502486 CCAACCCCGCACCCTCGGCCGGG - Intronic
1184648661 22:45909607-45909629 CCCTCCTCCCACCCCAGGCCTGG - Intergenic
1184796929 22:46738170-46738192 GCGTCCGCGCGCCCCCAGCCTGG - Exonic
1185236255 22:49715101-49715123 GCCTCCCCACACCCCTCCCCAGG - Intergenic
1185331252 22:50252965-50252987 ACCTTCCTGCACCCCCAGCCTGG - Exonic
1185384377 22:50525165-50525187 GACTCACTGCACCCCCGCCCGGG + Intronic
1203254375 22_KI270733v1_random:131314-131336 TCCTCCCCGCGCCCCCGCCCCGG + Intergenic
1203262431 22_KI270733v1_random:176393-176415 TCCTCCCCGCGCCCCCGCCCCGG + Intergenic
949574702 3:5327680-5327702 CCCTCCCCCCACCCCAGGACAGG + Intergenic
950249211 3:11449985-11450007 GACTCCTCCCACCCCCTGCCAGG - Intronic
950283044 3:11723181-11723203 GCCTGCCCCCACCCCCACCCAGG - Intergenic
950441461 3:13013243-13013265 GCCTGACCACACCCCAGGCCCGG + Intronic
950563340 3:13748832-13748854 CCCTCCCTGCACCCCGGCCCAGG - Intergenic
950939933 3:16883361-16883383 GCCACCCCACGCCCCAGGCCTGG - Intronic
953027559 3:39153684-39153706 GCCGCCCGGCAGCCCCGCCCCGG + Intronic
954456279 3:50601384-50601406 GGCACCCCCCACCCCCAGCCTGG - Intergenic
954592242 3:51792743-51792765 GGCTCCCCAAACCCCAGGCCAGG - Intergenic
954697336 3:52434849-52434871 GCATCCCAGCAACCCTGGCCTGG + Exonic
956179100 3:66501027-66501049 GCCTCCCCGCGGCCCAGCCCCGG + Intronic
960586247 3:119323331-119323353 GCCGCCCAGCACCTCGGGCCCGG + Intronic
960925923 3:122795024-122795046 GCCTCCCCGCCGGCCCGGCTCGG + Exonic
961013473 3:123450032-123450054 GTCTTCCCCCGCCCCCGGCCAGG + Intergenic
961446418 3:126983606-126983628 GCCTCCCCCGCCCCCCGGCCGGG + Intergenic
961506089 3:127371433-127371455 GCGTACCCACACCCCCCGCCTGG + Intergenic
962056340 3:131875674-131875696 CCCTCCCCCCACCCCAGGACAGG - Intronic
962226464 3:133614820-133614842 CCCTCCCCCCACCCCAGGACAGG - Intronic
962301791 3:134250299-134250321 CCCTCCCCGCCCCCCGCGCCCGG - Intronic
962676875 3:137764305-137764327 GCCTCCCCGCATTCTCAGCCAGG + Exonic
962737326 3:138337594-138337616 GCCGCCTCCCACCCCCAGCCAGG + Intergenic
962919312 3:139936160-139936182 ACCTCCCCGCGCCTCCCGCCCGG + Intronic
963939915 3:151087156-151087178 GTCGCCCAGCACCCCCAGCCTGG - Intronic
964720826 3:159765613-159765635 GCCTGCCCACACCACCGGTCTGG + Intronic
965074050 3:163953750-163953772 GCCTCTCCCCACCCCCAGCACGG - Intergenic
965811193 3:172592885-172592907 GTCTCCACCCACCCCCTGCCAGG - Intergenic
965966306 3:174494467-174494489 CCCTCCCCCCACCCCAGGACAGG - Intronic
966711917 3:182980418-182980440 GCTGCCGCGCACCCCCGCCCCGG - Intronic
966868526 3:184275957-184275979 CCCTCCCCCCACCCCGGGCGGGG + Intronic
967857805 3:194131445-194131467 GCGTCCCCCCACCCCCGCCCCGG - Intergenic
968047354 3:195631728-195631750 GCCCCCCCGCCACCCCGGGCAGG + Intergenic
968104259 3:195990072-195990094 GGGTCCCCGCGCCCCCTGCCCGG - Intergenic
968302560 3:197627662-197627684 GGGTCCCCGCGCCCCCTGCCCGG - Intergenic
968307259 3:197658196-197658218 GCCCCCCCGCCACCCCGGGCAGG - Intergenic
968576474 4:1368599-1368621 GCGTCCCAGCACACCCGGCAGGG - Intronic
968921057 4:3522562-3522584 GCCACCCCACACTCCCTGCCTGG + Intronic
968921068 4:3522596-3522618 GCCGCCCCACACCCCCTGCCTGG + Intronic
968921081 4:3522630-3522652 GCCGCCCCACACCCCCTGCCTGG + Intronic
968921095 4:3522664-3522686 GCCGCCCCACACCCCCTGCCTGG + Intronic
968921108 4:3522698-3522720 GCCGCCCCACACCCCCTGCCTGG + Intronic
968921122 4:3522732-3522754 GCCGCCCCACACTCCCTGCCTGG + Intronic
969253084 4:5982779-5982801 GCTTCCCCCCACCCCCAGGCTGG - Intronic
970195538 4:13547427-13547449 GCCTCACCGGCCGCCCGGCCGGG - Intergenic
970333314 4:15004751-15004773 GCCGCCCCGGACCCCCGACGCGG + Intronic
970897133 4:21117285-21117307 CCCCCCCGGCAACCCCGGCCAGG - Intronic
971207472 4:24584295-24584317 GCCGCCTCGCGCCCCCGGCCTGG + Intronic
973107317 4:46356368-46356390 GTCTCTCCACACCCCTGGCCAGG + Intronic
973551239 4:52038129-52038151 CGCCCCCCGCACCCCCGGCCAGG + Intronic
975444305 4:74445045-74445067 GCCTGCCTCCACCCACGGCCGGG + Intergenic
976235374 4:82891157-82891179 GCCGCCCCTCCTCCCCGGCCAGG + Exonic
978370020 4:108020539-108020561 GCCTCCCCGCTCCACCTTCCAGG - Intronic
978514595 4:109557502-109557524 GGCGGCCGGCACCCCCGGCCCGG + Intergenic
978777052 4:112515278-112515300 GCCGCCCCGCGCCCCCTGCCCGG + Exonic
978885439 4:113761821-113761843 GCCTGCCAGCACCCCCTCCCTGG + Intronic
979728684 4:123995563-123995585 GCCTCACCAAACCCCCTGCCTGG + Intergenic
979821301 4:125175589-125175611 CCCTCCCCGCACCCCACGACAGG + Intergenic
982157294 4:152535478-152535500 GGGTCCCCGCCCCCCCGGCCGGG + Exonic
982172842 4:152678519-152678541 CCCTCCCCCCACCGCCGCCCCGG - Intronic
983457365 4:167982170-167982192 CCCTCCCCCCACCCCCTGACAGG + Intergenic
983940194 4:173529331-173529353 GCCCCGCCGCGCCCTCGGCCCGG + Exonic
985513045 5:322605-322627 GCCTCACAGCCGCCCCGGCCTGG + Intronic
985628495 5:1002646-1002668 TCCTCCCCCCACCCCCGTCTCGG - Intergenic
985824733 5:2183820-2183842 GCCTCCCCGCAGGCCCATCCAGG - Intergenic
987703672 5:21434956-21434978 CCCTCCCCGCACCCCACGACAGG + Intergenic
989672214 5:43932071-43932093 ACCTCCCCCCACCCCCTGACAGG + Intergenic
990436994 5:55803096-55803118 GCCTCCCCCCACCCCACGACAGG + Intronic
991657782 5:68920966-68920988 GCCGGCCGGCACCCGCGGCCAGG + Intergenic
992561599 5:77958035-77958057 GCCTCCCCGTGCGCCCGGCCTGG - Intergenic
994670372 5:102755495-102755517 CCATCCCCCCACCCCCGACCCGG - Intronic
995402396 5:111757622-111757644 GACACCCCGCACCCGCGCCCCGG + Intronic
995650141 5:114361255-114361277 GCCCCCACCCACCCCCGGCCGGG + Intronic
997470169 5:134113250-134113272 GCCACCCCCCAGCCCCAGCCTGG + Intergenic
997963047 5:138337458-138337480 ACCTCCCCGCACCTCCCCCCAGG + Intronic
998148928 5:139746215-139746237 GCCTTCCCCCACCCCCAGCGGGG + Intergenic
998375298 5:141686719-141686741 GCCTCCCAGACCCCCAGGCCAGG - Intergenic
998458021 5:142288779-142288801 GCCTTCCCACACCCTGGGCCAGG - Intergenic
999132446 5:149294812-149294834 ACCTCCCCCCAGCCCCAGCCTGG + Intronic
999166239 5:149551592-149551614 GCCTGTCCTCACCCCCGTCCCGG + Intergenic
1000363534 5:160469759-160469781 TCCTCCCCGCATCCCAGGCCTGG - Intergenic
1000757585 5:165181086-165181108 GCCTCCCCCCACCCCATGACAGG + Intergenic
1001617779 5:173056683-173056705 CCCCTCCCCCACCCCCGGCCCGG + Intronic
1002184295 5:177447068-177447090 GCCGCCCCGGTCCCCCGCCCGGG + Intronic
1002359995 5:178662672-178662694 GCATCCCAGCAGCCCCGGGCTGG - Intergenic
1002605578 5:180381063-180381085 GCCTCCACCCACCCTGGGCCAGG + Intergenic
1003175520 6:3750678-3750700 GCCCCCCCGCACCCCCGCCAGGG - Intronic
1004908509 6:20259669-20259691 GCCGGCCCGCCCCGCCGGCCCGG + Intergenic
1005288770 6:24357816-24357838 GCCTCACCGCACCCAGGGCGCGG + Exonic
1005504541 6:26458291-26458313 TCCTCCCCGCGACCCAGGCCGGG - Intronic
1006089651 6:31620837-31620859 GGATCCCCGCGCACCCGGCCAGG + Exonic
1006338647 6:33433689-33433711 CCCCCCCCGCCCCCGCGGCCAGG - Intronic
1006422711 6:33945282-33945304 GCTTGCCCACACCCCCGGTCTGG + Intergenic
1006860845 6:37170677-37170699 GCCGCCCCGCATCCCCGGGCCGG - Intronic
1006932763 6:37697609-37697631 CCCGCGCCGCAGCCCCGGCCTGG - Exonic
1007420198 6:41714687-41714709 GTCTCCCCGCACCCTCGGGATGG - Intronic
1007444511 6:41895019-41895041 GCCTCCCGCCGCCCCCGCCCCGG + Intronic
1007793305 6:44326539-44326561 GCCACCCCACACCCCTGGCCAGG - Intronic
1007902265 6:45422970-45422992 ACCGCCCCCCGCCCCCGGCCGGG + Intronic
1010422213 6:75688531-75688553 GCCACCCCACCCCCCCGTCCAGG + Intronic
1011649370 6:89491631-89491653 GCCTCCCCCCACCCCATGACAGG - Intronic
1012012286 6:93804827-93804849 CCCTCCCCCCACCCCAGGACAGG + Intergenic
1012162051 6:95898330-95898352 GCCTCCCCCCACCCCACGACAGG + Intergenic
1012648217 6:101716593-101716615 CCCTCCCCCCACCCCAGGACAGG - Intronic
1012912901 6:105137233-105137255 GCCGCCCCGCGCCCCCCGGCGGG + Intergenic
1013388495 6:109657697-109657719 GCCTCCCCCTACCCCCTGACAGG + Intronic
1014798329 6:125749680-125749702 GCCTCCTCCCTCCCCGGGCCTGG - Exonic
1014888241 6:126808830-126808852 GCCACCCCCCACCCCCCTCCAGG + Intergenic
1015910188 6:138161873-138161895 GCCGCCCCGCCCCGCCCGCCTGG - Intergenic
1017422401 6:154286184-154286206 GCCACCCCCCACCCCCAGACAGG - Intronic
1017671940 6:156777637-156777659 GTCTCCCCCCGCCCCCCGCCCGG + Intergenic
1018023949 6:159789624-159789646 GCTTCCCGGCTGCCCCGGCCCGG + Exonic
1018150289 6:160931187-160931209 GCCCACCCGCGCCCCCGCCCCGG - Intergenic
1018429817 6:163713808-163713830 GCCTCCCTGCAGGCCTGGCCTGG - Intergenic
1019163198 6:170082510-170082532 GCCTCCCTGAACCCCCACCCAGG + Intergenic
1019288455 7:235448-235470 ACCTCCCCCAACCCCCGGGCAGG + Intronic
1019351689 7:557037-557059 GGCCCCTCCCACCCCCGGCCTGG + Intronic
1019537723 7:1537797-1537819 CCCTCCCCACACCCTGGGCCAGG - Intronic
1019571426 7:1714300-1714322 CCCTGCCCGCTCCCCCTGCCCGG + Intronic
1019576759 7:1741323-1741345 TCCTCCCCCCACCCCCAGCCTGG - Intronic
1019595826 7:1857872-1857894 GCCTCCCTGGGCCCCCAGCCTGG - Intronic
1019607509 7:1917488-1917510 GCTTCCCCTGAGCCCCGGCCAGG - Intronic
1019633626 7:2063928-2063950 GCCTCCTCAAACCCCAGGCCTGG + Intronic
1019659723 7:2217397-2217419 GCTGCCCGGCACCCCCAGCCTGG - Intronic
1020771708 7:12403755-12403777 TCCTCCTGGCACCCGCGGCCCGG - Exonic
1021085926 7:16421147-16421169 CTCTCCCCGCACCCCCCGGCAGG + Exonic
1021210947 7:17851714-17851736 GACTCCCCGCCCCCCCCGCCCGG - Intronic
1021221075 7:17975810-17975832 ACCTCCCCCCACCCCCACCCCGG - Intergenic
1021841634 7:24726010-24726032 GCCTCCCAGCAGCTCCTGCCTGG - Intronic
1022008844 7:26291830-26291852 GCCTCCGCGCAGCCCAGCCCAGG - Intergenic
1022046790 7:26628051-26628073 GCCTCCCTCCCTCCCCGGCCTGG - Intergenic
1022315418 7:29240926-29240948 GCCTCACCGCACTCCAGGCTGGG - Intronic
1022505218 7:30905477-30905499 CCCACCCCGCACCTCCAGCCAGG - Intergenic
1022600859 7:31758140-31758162 GCCTCCCCCCACCCCATGACAGG - Intronic
1023064785 7:36366872-36366894 TCCGCCCCGCACCCCCGCCGCGG + Intronic
1023983070 7:45080831-45080853 GCCTCCCACCACCCCCTGCGAGG + Intronic
1024045443 7:45582564-45582586 ACCACCCCCCACCCCCCGCCAGG - Intronic
1025600644 7:62993354-62993376 CCCTCCCCGCACCCCATGACAGG + Intergenic
1025752635 7:64306855-64306877 ACGTCCCCGCACGCCCGGCGAGG + Intergenic
1026800321 7:73396263-73396285 GCATCCCTGCACCCCCAACCAGG + Intergenic
1027982981 7:85250279-85250301 GGCGCCCCCCCCCCCCGGCCTGG - Intergenic
1028099820 7:86805896-86805918 CCCTCCCCGCACCCCACGACAGG + Intronic
1029423502 7:100483646-100483668 GCCGCCCCTCGCCCCCTGCCCGG - Intergenic
1029687388 7:102158109-102158131 TCCTCCTCTCACCCCCAGCCTGG + Intronic
1029730329 7:102434221-102434243 GCCCCACCCCACCCCCTGCCTGG + Intronic
1030779019 7:113574124-113574146 CCCTCCCCGCACCCCATGACAGG - Intergenic
1031361902 7:120857664-120857686 GCGTCCGCGCGCCCCCGGCAGGG + Intronic
1031467819 7:122135117-122135139 CCCTCCCCGCACCCCATGACAGG - Intronic
1031644739 7:124210663-124210685 CCCACCCCGCACCCCCTGACAGG + Intergenic
1032016213 7:128381815-128381837 AACTCCCCCCACCCCCCGCCAGG + Intergenic
1032023279 7:128421812-128421834 CCCTCCCCCCACCCCCGCTCAGG + Intergenic
1032081863 7:128863134-128863156 TCGTCCCCTCACCCCCGTCCGGG - Intronic
1033220410 7:139523683-139523705 GCCTCCACGCACAGCCGGGCTGG - Intergenic
1033705558 7:143882617-143882639 CGCGCCCCGCACCCCCGCCCCGG + Intronic
1033732882 7:144195803-144195825 GGCTCCCCTCTCCGCCGGCCCGG - Intergenic
1033743734 7:144294383-144294405 GGCTCCCCTCCCCGCCGGCCCGG - Intergenic
1033750167 7:144355214-144355236 GGCTCCCCTCCCCGCCGGCCCGG + Intergenic
1034355828 7:150450153-150450175 ACCTCCCCGAACCCCAGCCCGGG - Intergenic
1034515886 7:151579098-151579120 CCCTCCCCGCTGCCCCTGCCGGG + Intronic
1035356280 7:158277741-158277763 GCCTGACCACAACCCCGGCCGGG - Intronic
1035710486 8:1709828-1709850 ACCCCCCCGCCCCCCCCGCCAGG + Intergenic
1036644079 8:10601294-10601316 GCCTCTCACCACCCCCAGCCAGG - Intergenic
1036910913 8:12755839-12755861 GCGTCCCCCAACCCCCGGCAGGG - Intronic
1037839120 8:22231651-22231673 CCCTCTCCCCCCCCCCGGCCAGG - Intronic
1038016937 8:23523408-23523430 CCCTCCCTGCAACCCCGTCCTGG - Intergenic
1038020827 8:23550831-23550853 GCATGCCCGCACCCACGGGCTGG + Intronic
1038447623 8:27614856-27614878 GCCCCCCGGCGCCCCCAGCCCGG - Exonic
1038566325 8:28622675-28622697 GGCTCACCGCATCCCCGGCCCGG - Intronic
1038734513 8:30156673-30156695 CCCCCCCCGCCCTCCCGGCCGGG - Intronic
1039885932 8:41653934-41653956 GCCCCGGTGCACCCCCGGCCAGG - Intronic
1041028609 8:53712531-53712553 GACACCCCGCACCCGCGCCCGGG - Intergenic
1042936334 8:74062388-74062410 CCCTCCCCGCACCCCAACCCCGG + Intergenic
1045499221 8:102732153-102732175 GCCTCACCCCACCCCAGACCAGG - Intergenic
1045761913 8:105619681-105619703 GCCTCCCCCCACCCCGCGACAGG + Intronic
1045815100 8:106270059-106270081 GCCTCCCCCCGCCCCCGGCGTGG + Intergenic
1047621012 8:126608008-126608030 CCCTCCCCCCACCCCAGGACAGG + Intergenic
1048227413 8:132601765-132601787 CCCTCCCCGCACCCCATGACAGG - Intronic
1048277403 8:133077423-133077445 ACCTCCCCTGACCCCCAGCCCGG + Intronic
1048340058 8:133531654-133531676 CCCTCCCCTCACCCCCTGACTGG - Intronic
1049004718 8:139847518-139847540 GCCTCCCTGGAGGCCCGGCCTGG + Intronic
1049109622 8:140635163-140635185 GCGTCCTCGCATCCCCCGCCCGG - Intronic
1049145885 8:141000953-141000975 CCCCTCCCGCGCCCCCGGCCCGG - Intronic
1049146022 8:141001471-141001493 GCCACCCCGAAACCCCGGCGCGG - Intronic
1049339512 8:142104597-142104619 GACTCCCCAAACCCCAGGCCTGG + Intergenic
1049415164 8:142491733-142491755 GCCTCCCTGCACCCCTTTCCCGG + Intronic
1049651386 8:143771471-143771493 GCCTCTCCCCACCCCAGGGCCGG + Intergenic
1049661414 8:143821225-143821247 GCCTCCCTGCCCCCGTGGCCTGG - Intronic
1049719527 8:144109234-144109256 GCATCTCCGCAGCTCCGGCCAGG + Intronic
1049761450 8:144333725-144333747 GCCGCCCCGGCCCCCCGGCCCGG + Exonic
1049786794 8:144454744-144454766 GCCTCCCAGCACCACCAGGCAGG - Intronic
1049936552 9:505330-505352 GCCTCCCCGCCCTCCAGCCCCGG - Intronic
1051641911 9:19231090-19231112 GCCTCCCCGCGTCGCCCGCCGGG + Intronic
1052165005 9:25315408-25315430 GCCTCCCCCCACCCCACGACAGG - Intergenic
1053157531 9:35791491-35791513 GCCTTCCCCCACCCCCCACCCGG - Intergenic
1053313472 9:37034351-37034373 GCCGCCCCACACTGCCGGCCCGG + Intergenic
1054781942 9:69174022-69174044 GCCGCCTCCCGCCCCCGGCCAGG + Intronic
1054794920 9:69291767-69291789 CCCTCCCCCCACCCCCCGACAGG - Intergenic
1055757720 9:79573009-79573031 GCCTCTCCGCACCCCCTCCGAGG - Intronic
1056163565 9:83921332-83921354 ACTTCCCCGCACCGCCCGCCAGG + Intronic
1056216309 9:84408753-84408775 GCCTCCCCCCACCCCCGTCGTGG + Intergenic
1056331194 9:85522715-85522737 GCAACCCAGCACCCCGGGCCTGG - Intergenic
1056732609 9:89178650-89178672 GCGGCCGCGCAGCCCCGGCCCGG + Exonic
1057757178 9:97847945-97847967 GCCCCCCCACCCCCCGGGCCTGG - Intergenic
1057864678 9:98669968-98669990 GCATCCTCCCACCCCCGCCCTGG - Intronic
1058413829 9:104764328-104764350 CCCTCCCCTCCCCTCCGGCCAGG - Intronic
1058699127 9:107586608-107586630 GCCACCCCCCAACCCAGGCCTGG - Intergenic
1058961772 9:109998620-109998642 GGCTCCCCACTCCCCCGCCCTGG - Intronic
1059102301 9:111483218-111483240 GGCTCCCCCGACCCCGGGCCAGG + Intronic
1059387319 9:113974733-113974755 GCCCCCCTGCACCCCCTGCCTGG + Intronic
1059500912 9:114753288-114753310 CCCTCCCCCCACCCCAGGACAGG - Intergenic
1060934200 9:127506284-127506306 TCCACCCAGCACCCCCAGCCTGG + Exonic
1060979867 9:127785841-127785863 GGCTCCCCGCGCCCCCGATCGGG + Intronic
1061002403 9:127909918-127909940 GCGTCCCCGCGTGCCCGGCCTGG + Intronic
1061261508 9:129483010-129483032 GCCTCCCTGCTCCCCCGCCCTGG - Intergenic
1061887018 9:133596233-133596255 GGCTCCCCGCACAGCCGCCCGGG - Intergenic
1062022604 9:134326534-134326556 GGCTCCCCGCCGCCCGGGCCCGG + Intronic
1062062886 9:134506404-134506426 GCCTCCCCCCACCCCACGACAGG + Intergenic
1062160252 9:135075895-135075917 GCCGCCCCGCGCCCCCGGCCTGG + Intronic
1062162604 9:135088316-135088338 TGCTCCCCGCTCCCCCAGCCTGG + Intronic
1062347674 9:136122903-136122925 GCCTTCCTGCGCCCCCGGCCTGG + Intergenic
1062378420 9:136275305-136275327 CCCTCCCAGCACCCCCAGCCGGG - Intergenic
1062441344 9:136571063-136571085 GCCTGCCGTCACCCCCGGACAGG + Intergenic
1062448849 9:136607147-136607169 GCCCCACCGCACCCCAGGCCCGG - Intergenic
1062533976 9:137013563-137013585 GCCTCCCTGCTCGCCCTGCCAGG - Exonic
1062534045 9:137013776-137013798 GCCTCCCCCCACCGCCCGCTGGG - Intronic
1062556276 9:137114635-137114657 GCCGCCACTCACCCCCCGCCTGG + Exonic
1062581228 9:137230126-137230148 GCTGCCCCGCACCCCAGGGCAGG + Intergenic
1062629102 9:137455694-137455716 GCCTCCCCTCAGCCCCCACCCGG + Intronic
1062708687 9:137960051-137960073 ACCTCCCCTCTCCCCCGCCCCGG - Intronic
1203530516 Un_GL000213v1:138740-138762 GCCTCCTCCCATCCCAGGCCCGG + Intergenic
1203470776 Un_GL000220v1:114458-114480 TCCTCCCCGCGCCCCCGCCCCGG + Intergenic
1203478597 Un_GL000220v1:158430-158452 TCCTCCCCGCGCCCCCGCCCCGG + Intergenic
1186278452 X:7966245-7966267 GCCTCCCCCCACCCCATGACAGG + Intergenic
1187445937 X:19361098-19361120 GCCTCCACCCACTCCCAGCCAGG + Exonic
1187900748 X:24025320-24025342 GCCTTCCTCCACCCCCGGCGTGG - Intronic
1189281261 X:39821391-39821413 GCCTCCCCGCACCCACCGCCCGG - Intergenic
1190119781 X:47650489-47650511 GCCCCACCGCCCCCCAGGCCTGG + Exonic
1191095982 X:56673423-56673445 CTCTCCCCCCACCCCCGCCCAGG + Intergenic
1191184137 X:57592211-57592233 GCCTCCTCGCGCCGCCGCCCGGG - Exonic
1191213251 X:57910236-57910258 GCCTCCTCGCGCCGCCGCCCGGG + Exonic
1192580483 X:72277133-72277155 GCCTCCATCCTCCCCCGGCCGGG - Intronic
1192696448 X:73421068-73421090 CCCTCCCCTCACCCCCTGACAGG - Intergenic
1195660824 X:107376195-107376217 CCCTCCCCCCACCCCCTGACAGG + Intergenic
1195853911 X:109310243-109310265 GGCTCCCCCTACCCCCGGCTGGG - Intergenic
1197264652 X:124356051-124356073 CCCTCCCCCCACCCCAGGACAGG + Intronic
1198050418 X:132946610-132946632 GCCTCCCCTCACCCCATGACAGG - Intronic
1198120979 X:133592279-133592301 CCCTCCCCCCACCCCAGGACAGG + Intronic
1198815066 X:140580693-140580715 GCCTCCCTGCACCCCGGCCCAGG - Intergenic
1200057718 X:153470403-153470425 CCCTCCCCGGTCCCCCGCCCTGG + Intronic
1200267099 X:154652542-154652564 GCCGCACCGCTCCCCCGACCAGG - Exonic