ID: 1083584030

View in Genome Browser
Species Human (GRCh38)
Location 11:63843544-63843566
Sequence GTAGTTCAGCTGTTCCTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083584030_1083584033 15 Left 1083584030 11:63843544-63843566 CCTATAAGGAACAGCTGAACTAC 0: 1
1: 0
2: 0
3: 9
4: 81
Right 1083584033 11:63843582-63843604 TGGACCCCCATTGTTGATTCTGG 0: 1
1: 0
2: 0
3: 4
4: 54
1083584030_1083584031 -5 Left 1083584030 11:63843544-63843566 CCTATAAGGAACAGCTGAACTAC 0: 1
1: 0
2: 0
3: 9
4: 81
Right 1083584031 11:63843562-63843584 ACTACTCCAAACACTCTCACTGG 0: 1
1: 1
2: 1
3: 7
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083584030 Original CRISPR GTAGTTCAGCTGTTCCTTAT AGG (reversed) Intronic
901026713 1:6282229-6282251 GGAGCTCAGCTCTTCCCTATAGG + Intronic
905754690 1:40499061-40499083 GCAGCTCAGCTGGTCCTTCTAGG - Intergenic
907730582 1:57061723-57061745 GTCCTTCAGCTGCTCCTCATGGG + Intronic
911106231 1:94134137-94134159 GTAGATGAGCTGTTCCTATTCGG - Intergenic
911352451 1:96770933-96770955 CCTGTTCAGATGTTCCTTATAGG + Intronic
911924255 1:103808108-103808130 GTACTTCAGCTGTTACATCTAGG - Intergenic
913252786 1:116925890-116925912 GTAGTTAAAGTGTTCCTTAAAGG + Intronic
917610368 1:176683336-176683358 GTGGTACAGCTGTTCCTTAATGG - Intronic
917962811 1:180157909-180157931 GTGGTTCAGCCATTTCTTATGGG + Intronic
920873541 1:209813989-209814011 ATAGTTCAGCAGTACCTCATGGG + Intergenic
923029696 1:230238078-230238100 AGACTTCAGCTGTTCCATATAGG - Intronic
1064760569 10:18615714-18615736 GTGGTTCAGTGGTACCTTATTGG - Intronic
1067363727 10:45605464-45605486 CTACTTCAGGTGTTTCTTATAGG + Intergenic
1068141443 10:53013185-53013207 TTAGTACTGCTCTTCCTTATTGG - Intergenic
1069095326 10:64252318-64252340 GTTTTTCAGCTATTTCTTATTGG + Intergenic
1069096385 10:64264679-64264701 GAATTTCACCTGTGCCTTATGGG - Intergenic
1071182522 10:83003535-83003557 GTAGTCCAGCTCTTCCTTGGTGG + Intergenic
1080558983 11:33444821-33444843 CCGGTTCAGGTGTTCCTTATTGG + Intergenic
1083584030 11:63843544-63843566 GTAGTTCAGCTGTTCCTTATAGG - Intronic
1083702785 11:64490726-64490748 GTTGTTCAGCAGTCCCTGATTGG - Intergenic
1089209963 11:116793000-116793022 GGAGTTCAGCTTTTCCTCATGGG - Intergenic
1093692750 12:22125873-22125895 GTAATACAGCTGTTCCAAATGGG - Intronic
1095082764 12:38026750-38026772 GTAATTCAGCTTTTCTGTATAGG - Intergenic
1095904231 12:47361047-47361069 GGAGTACAGCTGGTCCTTATAGG + Intergenic
1096316327 12:50569929-50569951 GAAGTTCAGCTGTTACATCTTGG - Intronic
1096872435 12:54601798-54601820 GTAGTTCAGGAGTTCCAGATGGG - Intergenic
1101643001 12:106601917-106601939 GCATTTCAGCTGGTCCTTAAAGG - Intronic
1102270442 12:111530425-111530447 CTAGATCAGCTGTTGCTGATAGG - Intronic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1113370574 13:109721558-109721580 GAACTTCAGGTCTTCCTTATTGG + Intergenic
1113418458 13:110150689-110150711 GGACTTCAGCTGTGCCCTATGGG - Intronic
1114643342 14:24239492-24239514 GTTGTTCAGCTGTGCCTAAAAGG - Intergenic
1119740546 14:77011259-77011281 GGGGTTCAGCTGTTCCTCATAGG + Intergenic
1122378536 14:101285683-101285705 GTAGTTCAGCTGCACCTTCCAGG + Intergenic
1130025872 15:80270102-80270124 ATAGTTCAGCTGTTCTGTAATGG + Intergenic
1131770410 15:95730572-95730594 GTAGTTCAGCTCTTCCACTTAGG + Intergenic
1133155296 16:3870518-3870540 GCAGTTCAACTGTTTTTTATTGG - Intronic
1140378719 16:74467105-74467127 GTAGTTAATCTGTTTCTGATAGG - Intronic
1149889869 17:60378378-60378400 CCAGTTTAGCTGTTCCTTAAAGG + Intronic
1153512840 18:5874116-5874138 GTAGTTCATCTCTGCCTTCTTGG - Intergenic
1157131796 18:45014192-45014214 GAAGCTCAGCTGTTTCTTAATGG - Intronic
1165818774 19:38660952-38660974 GCATTTCAGCTGTTCCTTAACGG + Intronic
938728627 2:134129089-134129111 GTAGGTCAGAGGTCCCTTATGGG + Intronic
941578398 2:167265053-167265075 GTAGTTCTGCTGGTCTTTGTGGG + Intergenic
945373986 2:209057465-209057487 GTATTTCTGCTGTTGCTTTTAGG + Intergenic
947329222 2:229011313-229011335 TTAGTTCTTCTCTTCCTTATTGG + Intronic
1185380385 22:50505091-50505113 GTAGTCCAACTGTCCCTTGTGGG - Exonic
949931410 3:9081308-9081330 GTACTTCTCCTGTTCCTCATTGG - Intronic
950046992 3:9954526-9954548 GTTTTTCAGCTGTTCCTTGCAGG + Intergenic
953669007 3:44947016-44947038 GTAATTCAGTTTTTCCTTACTGG - Intronic
955909953 3:63849880-63849902 GTTGTCCAGCTTTTGCTTATAGG - Intronic
956512081 3:70005341-70005363 GCAGTTCTTCTGTTCCATATGGG + Intergenic
962420448 3:135224455-135224477 GATGTCCATCTGTTCCTTATTGG + Intronic
966485399 3:180463315-180463337 GTATATCAGCTATTCCTTCTGGG + Intergenic
969335450 4:6506714-6506736 TTAGCTGAGCTGTTCCTTCTTGG + Intronic
970848823 4:20576921-20576943 GTTTTTCAGCATTTCCTTATTGG - Intronic
974093583 4:57337867-57337889 ATAGGTCAGCTGCTCCTTATAGG - Intergenic
976022156 4:80642088-80642110 GTATTTCATCTGTTGCTTTTGGG + Intronic
976023175 4:80656006-80656028 TTACTGCAGCTGTTCATTATGGG - Intronic
976603793 4:86963759-86963781 GTATTTCAGCTGAACCTTAAAGG - Intronic
982540221 4:156659722-156659744 GTAGCTCAGCTGTTTATGATTGG + Intergenic
983109505 4:163731336-163731358 TTTTTTCAGCTGTTCCATATGGG - Intronic
990344793 5:54861478-54861500 GAAGTTCAGCTACTCCTTTTGGG - Intergenic
992570740 5:78054454-78054476 GAAGCTCACCTGTTCCTTTTAGG - Intronic
996502261 5:124230239-124230261 GAAGTTCAGCTGTTCCTGGCCGG - Intergenic
999227523 5:150038826-150038848 GTTGTTTAGCTGTTCCCCATGGG + Intronic
999724394 5:154423347-154423369 GAAGTTAAGTCGTTCCTTATTGG + Intergenic
1001637663 5:173223733-173223755 GTAGTCCAGCTGTTCCTTTAAGG + Intergenic
1006761030 6:36460824-36460846 GCAGTGCCGCTGCTCCTTATAGG - Intronic
1011902332 6:92314156-92314178 GTAGATCATCTGTTTCTTATTGG + Intergenic
1012355626 6:98310489-98310511 GTAGTTCAGCTCTGCATTCTGGG + Intergenic
1017630053 6:156388302-156388324 GGAGTTCCCATGTTCCTTATAGG + Intergenic
1021251272 7:18329049-18329071 GTAGTTCATTTGTTTCTTCTAGG + Intronic
1024391576 7:48818979-48819001 GTAATTCAGCAGCTACTTATTGG - Intergenic
1033412056 7:141127090-141127112 ACAGTCCAGCTGTTCCTTCTTGG + Intronic
1040125812 8:43736329-43736351 GTTATTCAGCTTTTCCCTATAGG - Intergenic
1044328023 8:90882679-90882701 GTAGATCACCTGTTCCTTGCTGG + Intronic
1050667186 9:7952893-7952915 GGAGTGCAGCTGTTGCTGATTGG - Intergenic
1055509107 9:76977364-76977386 GTAGATCAGCTTTTTCTCATTGG - Intergenic
1057756713 9:97844715-97844737 GTAGTTCAGTGATTGCTTATGGG + Intergenic
1185638250 X:1570934-1570956 GTAGCTGAGCAGGTCCTTATGGG - Intergenic
1186690338 X:11968627-11968649 GGACTTCAGATGTTCCTCATAGG + Intergenic
1187979573 X:24741089-24741111 TTACTTCAGTTTTTCCTTATGGG + Intronic
1189053114 X:37667486-37667508 AAAGGTCAGCTGTTCTTTATGGG + Exonic
1189119755 X:38381953-38381975 ATAGTGCAGATGTTCCTGATTGG + Intronic
1190473723 X:50808089-50808111 CTCTTTCAGCTGTTCCTTATGGG - Intronic
1191707185 X:64105558-64105580 GTTGTCCATCTGTTCCTTAATGG - Intergenic
1194747295 X:97642033-97642055 GTAGTTCAGCTGTTCAAGCTAGG - Intergenic
1198109663 X:133491873-133491895 TTAGTTCAGCTGTTCACTTTTGG + Intergenic
1198267574 X:135023443-135023465 GTAGGTCAGAAGTTCCATATGGG + Intergenic
1201931326 Y:19352604-19352626 GTTGTTCAGCTCTTATTTATAGG + Intergenic