ID: 1083587037

View in Genome Browser
Species Human (GRCh38)
Location 11:63867744-63867766
Sequence TCTCACCATGGCTGACGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083587032_1083587037 14 Left 1083587032 11:63867707-63867729 CCCAGAGTGGCTTCTTCTCATTC 0: 1
1: 0
2: 1
3: 19
4: 241
Right 1083587037 11:63867744-63867766 TCTCACCATGGCTGACGCCGTGG 0: 1
1: 0
2: 1
3: 2
4: 76
1083587033_1083587037 13 Left 1083587033 11:63867708-63867730 CCAGAGTGGCTTCTTCTCATTCC 0: 1
1: 0
2: 2
3: 19
4: 250
Right 1083587037 11:63867744-63867766 TCTCACCATGGCTGACGCCGTGG 0: 1
1: 0
2: 1
3: 2
4: 76
1083587034_1083587037 -8 Left 1083587034 11:63867729-63867751 CCAGCACTGCCTAACTCTCACCA 0: 1
1: 0
2: 0
3: 18
4: 202
Right 1083587037 11:63867744-63867766 TCTCACCATGGCTGACGCCGTGG 0: 1
1: 0
2: 1
3: 2
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083587037 Original CRISPR TCTCACCATGGCTGACGCCG TGG Intronic
901520528 1:9780835-9780857 ACTCGCCATGGCTGAGGCCAAGG - Intronic
902123858 1:14191944-14191966 TCTCACCATGGCTGTCTCATTGG + Intergenic
907163707 1:52391281-52391303 TCTCACTCTGTCTGACGCCCAGG - Intronic
907452171 1:54552446-54552468 TCTGCCCATGGCTGAGGCTGGGG - Intronic
913132861 1:115857853-115857875 TCTGCCCATGGATGCCGCCGAGG - Intergenic
915642119 1:157236049-157236071 TCTCACCATAGCTGAAACTGAGG - Intergenic
916441013 1:164824667-164824689 TCTCACCATGGCTAAGGAAGGGG - Intronic
917794848 1:178525920-178525942 TCTCAACATGGATGACCCCTAGG + Intronic
917799282 1:178555566-178555588 TCTCAACATGGCTGCAACCGGGG + Intergenic
922787860 1:228292085-228292107 CCTGGCCATGGCGGACGCCGGGG + Exonic
924592219 1:245414475-245414497 TCTGAGCAGGGCTGAAGCCGTGG + Intronic
1070436784 10:76401595-76401617 TCCCACCATGGCAGAGGCCTGGG + Intronic
1074796134 10:116946741-116946763 TCTCACTATGTCTGTCGCCCAGG + Intronic
1076776242 10:132699662-132699684 TCCCACCCTGGCTGACCCTGCGG - Intronic
1077646946 11:3933629-3933651 TCTCAACATGGCTGAGGCTCAGG + Intronic
1083587037 11:63867744-63867766 TCTCACCATGGCTGACGCCGTGG + Intronic
1089938741 11:122393690-122393712 ACTCACCCTGGCTGAGGCTGAGG + Intergenic
1093074675 12:14745691-14745713 TCTCAACCTGGCTGACGCTTGGG - Intergenic
1094286785 12:28803154-28803176 ACTCACCATGGGTCATGCCGTGG + Intergenic
1096124674 12:49110561-49110583 GCTCAGCATGACTGAAGCCGAGG + Exonic
1096969146 12:55651560-55651582 TCCAACCATGGCTGGGGCCGAGG + Intergenic
1105469562 13:20680683-20680705 TCTCAACATGGCTGCAACCGGGG + Intronic
1110190869 13:72727594-72727616 ACTCGCCATGGCTAAGGCCGAGG + Exonic
1113903918 13:113810814-113810836 TGTCACCGTGGCTGACTCAGCGG - Intronic
1118475800 14:66115720-66115742 TCTCTCCCTGGCTGACTCCTGGG - Intergenic
1119445602 14:74661028-74661050 TCTCCCCATGGCTGAGACAGTGG + Intronic
1119600085 14:75969938-75969960 TCTCATCTGGGCTGCCGCCGTGG + Intronic
1121754592 14:96392148-96392170 TCCCACCATGGCTGAAGAAGAGG + Exonic
1122025841 14:98875365-98875387 TCTCACCATAGCTGACCCACAGG + Intergenic
1136401882 16:30023745-30023767 TGTCCCCAGGGCTGACGCCGTGG - Exonic
1136634117 16:31508358-31508380 GCTCGGCATGGCTGACGACGCGG - Exonic
1147722296 17:42546757-42546779 TCTCACCATGGCCTGCACCGTGG + Intergenic
1147723480 17:42552927-42552949 TCTCACCATGGCCCGCACCGTGG + Exonic
1148079143 17:44957912-44957934 TCACTCCATGGCTGCCGCCCAGG + Intergenic
1152072652 17:78141636-78141658 TCTGGCCCTGGCTGACGCTGTGG - Exonic
1161591320 19:5130438-5130460 TCTCCCCATTGCTGGCCCCGGGG + Intronic
1162502934 19:11064843-11064865 TCTCAGCTTGGCTGACCCAGGGG - Intronic
1162863485 19:13525853-13525875 TCTCTTCATGGCTGAGGCTGAGG - Intronic
1164024604 19:21339828-21339850 TCTCAACATGGCTGCAACCGGGG + Intergenic
1168332792 19:55579578-55579600 CCTCACCGTGGCCGAGGCCGGGG - Exonic
932865178 2:75334188-75334210 TCTCCCCATGGCTGAAGGCCAGG + Intergenic
933726268 2:85429452-85429474 TCTTACCATGGCAGAGGCAGAGG - Intronic
936389214 2:112056018-112056040 GGTCACCATGCCCGACGCCGTGG + Intronic
940301274 2:152178367-152178389 TCTCAACATGGCTGCAACCGGGG + Intergenic
947121190 2:226816854-226816876 TGTCACCAAGGCTGGCGCAGTGG - Intergenic
1169211069 20:3766654-3766676 CCTCACCTTGGCTGACCCCCTGG - Intronic
1170025231 20:11882030-11882052 TTTCATCATGGCTCTCGCCGGGG - Intergenic
1170302893 20:14905852-14905874 TCTCACCATAGCTGATGGAGTGG - Intronic
1173185480 20:40836866-40836888 TCTCACCATTGCTGTTGCCTGGG + Intergenic
1179905196 21:44418965-44418987 GCTGAGCATGGCTGACCCCGAGG - Intronic
1181290035 22:21784638-21784660 TCTCACTCTGGCTGGCGCCCAGG - Intronic
1182288835 22:29263917-29263939 TGCCACCGTGGCTGTCGCCGTGG - Exonic
950536213 3:13580404-13580426 TCTCACCATTGCAGGAGCCGGGG + Intronic
953391492 3:42536328-42536350 ACTCACCCCGGCAGACGCCGGGG + Exonic
954519261 3:51208846-51208868 TCTCACCATGGCTGGCGCTGGGG - Exonic
977443354 4:97098456-97098478 TCTCAACATGGCTGCAACCGGGG + Intergenic
978760391 4:112351090-112351112 TGTCACCATGGCTGATGGAGTGG + Intronic
985772975 5:1824659-1824681 ACACAGCATTGCTGACGCCGAGG + Intergenic
1000062748 5:157671379-157671401 TCTCACCACGGCGGATGCCGAGG + Intronic
1000615319 5:163419520-163419542 TCTCAACCTGGCTGACGCTTAGG + Intergenic
1002102416 5:176863977-176863999 TCTCAGGATGGCTGAGGCCTTGG - Intronic
1002447230 5:179297093-179297115 TCTAACCATGGCAGATGCTGCGG - Intronic
1005857889 6:29877078-29877100 TCTCAACATGGCTGCAACCGAGG + Intergenic
1009062470 6:58414270-58414292 TCTCAACATGGCTGCAACCGGGG + Intergenic
1011596599 6:89022468-89022490 ACTCACCATGGTTGAAGCTGTGG + Intergenic
1011678601 6:89760376-89760398 TCTCACCATGTGTGTCTCCGGGG - Intronic
1013519660 6:110921504-110921526 TCTCAACATGGCTGCAACCGGGG - Intergenic
1025102685 7:56149347-56149369 TCTCACCATGGCTGCAACTGAGG - Intergenic
1029652486 7:101903122-101903144 TCTCTCCCTGGTTGACCCCGAGG + Intronic
1035590765 8:811575-811597 TCTCACCATGGCAGGAGCCCTGG - Intergenic
1040377106 8:46836782-46836804 ACTCACCATCGCGGACGCCCTGG - Intergenic
1040914694 8:52557192-52557214 GTTCACCATGGCTGATGCCCGGG + Intronic
1048971763 8:139649076-139649098 TCTCCCCATCCCCGACGCCGTGG + Intronic
1049592141 8:143467596-143467618 TCACACCGTGGCTGAGTCCGGGG + Intronic
1052760694 9:32588068-32588090 ACTCACCATGGCTAAAGCTGTGG + Intergenic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1060283177 9:122227403-122227425 ACTCACCATGGCGGGCGGCGCGG + Exonic
1188783196 X:34310422-34310444 TCTCACCATGGCAGAGCCTGTGG - Intergenic
1190265092 X:48823380-48823402 TCCCTCCATGGCTGCCTCCGAGG - Exonic
1201370475 Y:13257772-13257794 TCTCAACATGGCTGTAACCGGGG - Intronic