ID: 1083587647

View in Genome Browser
Species Human (GRCh38)
Location 11:63872178-63872200
Sequence CACCTCTCTGTGGCAGCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 219}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083587642_1083587647 14 Left 1083587642 11:63872141-63872163 CCGGCCACTCCTGACAAATATTT 0: 1
1: 1
2: 0
3: 37
4: 428
Right 1083587647 11:63872178-63872200 CACCTCTCTGTGGCAGCCTTGGG 0: 1
1: 0
2: 0
3: 22
4: 219
1083587644_1083587647 5 Left 1083587644 11:63872150-63872172 CCTGACAAATATTTCTGTCACTA 0: 1
1: 0
2: 2
3: 18
4: 246
Right 1083587647 11:63872178-63872200 CACCTCTCTGTGGCAGCCTTGGG 0: 1
1: 0
2: 0
3: 22
4: 219
1083587641_1083587647 17 Left 1083587641 11:63872138-63872160 CCTCCGGCCACTCCTGACAAATA 0: 1
1: 0
2: 1
3: 6
4: 78
Right 1083587647 11:63872178-63872200 CACCTCTCTGTGGCAGCCTTGGG 0: 1
1: 0
2: 0
3: 22
4: 219
1083587643_1083587647 10 Left 1083587643 11:63872145-63872167 CCACTCCTGACAAATATTTCTGT 0: 1
1: 0
2: 2
3: 63
4: 1151
Right 1083587647 11:63872178-63872200 CACCTCTCTGTGGCAGCCTTGGG 0: 1
1: 0
2: 0
3: 22
4: 219
1083587640_1083587647 22 Left 1083587640 11:63872133-63872155 CCATTCCTCCGGCCACTCCTGAC 0: 1
1: 0
2: 13
3: 28
4: 309
Right 1083587647 11:63872178-63872200 CACCTCTCTGTGGCAGCCTTGGG 0: 1
1: 0
2: 0
3: 22
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083587647 Original CRISPR CACCTCTCTGTGGCAGCCTT GGG Intronic
900150894 1:1179016-1179038 CCCGTCTCTGTGGCAGCTGTGGG - Intronic
900163517 1:1235674-1235696 CAGCTCTCTGGGCCAGCCCTGGG + Intergenic
900370595 1:2330367-2330389 CACCTCTTTGTGGCAGACGAGGG + Intronic
900958680 1:5905539-5905561 CACCTCCCTGTGGAAACCCTGGG + Intronic
901510383 1:9715487-9715509 CACCTCCCAGTGGCTGCCTTGGG + Intronic
903011086 1:20330892-20330914 CACCAGTCTGTGGCAGACGTTGG - Exonic
904302221 1:29561669-29561691 GCCCTCTCTGTAGCAGCCCTTGG + Intergenic
904371081 1:30047723-30047745 CAGCTCTCTGTGGCCCCATTGGG - Intergenic
904775182 1:32901707-32901729 CCCCTCTCCGTCCCAGCCTTGGG - Intergenic
905791520 1:40792125-40792147 CACTTCTCTCTGGGAGCCTCGGG + Intronic
907456404 1:54579271-54579293 CAGCTCTCTTTGGCAGCATCTGG + Intronic
912548270 1:110466573-110466595 CTCCTCTCTGTGCCAGCCTGGGG - Intergenic
913257530 1:116967253-116967275 CTCCTGTCAGGGGCAGCCTTTGG + Exonic
915159634 1:153908836-153908858 CACCACTGTGTTCCAGCCTTGGG - Intronic
915719653 1:157975314-157975336 CACCACTCTGTGGTGGACTTTGG - Intergenic
916092818 1:161321586-161321608 CACTTCTTTCTGGGAGCCTTGGG + Intronic
917686631 1:177423242-177423264 CACCTCTCTGTGGCCAGCTGGGG + Intergenic
918857231 1:189772863-189772885 CACTTTTCTCTGGCTGCCTTTGG - Intergenic
922669724 1:227500031-227500053 CTCCTTCCTGTGGCAGCCTCCGG - Intergenic
923084699 1:230694609-230694631 CCCCTCTTTGTGGCAGGCTGGGG - Intergenic
924832006 1:247606082-247606104 TGCCTCTCTGTGGCAACCATAGG + Exonic
1065478572 10:26168086-26168108 CCCTTCTCCATGGCAGCCTTTGG + Intronic
1065567174 10:27024058-27024080 AACCTATCTGTGTCATCCTTTGG - Intronic
1066534958 10:36381315-36381337 AATCTCTTTGTGGGAGCCTTGGG - Intergenic
1067399808 10:45960989-45961011 CACCTCTATGTGGCACAATTCGG + Intergenic
1067868136 10:49930280-49930302 CACCTCTATGTGGCACAATTCGG + Intronic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1070627548 10:78061976-78061998 CCCCACTCTGTGGCTGCCGTGGG - Intergenic
1072249268 10:93568626-93568648 CACCTCTCTGTCTCAGGCTCTGG - Intronic
1074128068 10:110546147-110546169 CAGCAGTCTCTGGCAGCCTTTGG + Intergenic
1074824915 10:117207761-117207783 CAGCTCCCTGTGGCAAACTTTGG - Intronic
1076106069 10:127824671-127824693 CACATGGCTGTGGAAGCCTTAGG + Intergenic
1076602091 10:131663773-131663795 CAACTGTCTGTGGCAGCCAGAGG - Intergenic
1076933749 10:133553531-133553553 CCCTTCACTGAGGCAGCCTTTGG + Intronic
1077626944 11:3780683-3780705 CCCCTCGCTTTGGCAGGCTTAGG + Intronic
1078766201 11:14300888-14300910 CACCACTCTGTGGCAGTGTTTGG - Intronic
1081654872 11:44850468-44850490 CACCCCTCTGTGCCATCCTCCGG - Intronic
1083251515 11:61470968-61470990 CTCCTTTCTGTGGCAGCCCAGGG + Intronic
1083587647 11:63872178-63872200 CACCTCTCTGTGGCAGCCTTGGG + Intronic
1084334710 11:68449969-68449991 GACCTCTCTGTGCCAGCCCAAGG + Intergenic
1085276098 11:75301386-75301408 CACCTCTATGTGAGGGCCTTCGG + Intronic
1085618454 11:78019805-78019827 CACCTCTCTGTGCCAGACCCTGG + Intronic
1086597164 11:88586584-88586606 AGCCTTTCTGTGGCAGGCTTTGG + Intronic
1087640464 11:100750034-100750056 CACCCCCTTGTGGCAGCCTCAGG - Intronic
1088353344 11:108914374-108914396 ACCCTCTCTGTGGCTGCCTCTGG - Intronic
1088844555 11:113653945-113653967 CACATGTCTGTGGAAGCCTCAGG + Intergenic
1088854765 11:113738353-113738375 CACCTTTCTGTGCCCGCATTTGG + Exonic
1090626780 11:128615146-128615168 CAACTCTCTGGGGCAGCCAGCGG - Intergenic
1091046387 11:132329498-132329520 CATCTCTCTGGGGCAGCCTGCGG - Intronic
1092048272 12:5448732-5448754 CAGCTCTTTCTGGCAGGCTTAGG - Intronic
1092547181 12:9462253-9462275 AGCCTCTCTTTGGCAGACTTTGG + Intergenic
1092732385 12:11547097-11547119 CACCTCTCACTGGCAGGGTTAGG - Intergenic
1094412645 12:30183189-30183211 CACTGCTCTGTGGCAGCATCTGG - Intergenic
1094505758 12:31059811-31059833 AGCCTCTCTTTGGCAGACTTTGG - Intergenic
1098150273 12:67539331-67539353 CACGTCTCAGTGGCAGAGTTGGG - Intergenic
1100913677 12:99393365-99393387 CACCTCTCTTAGGGAGACTTTGG + Intronic
1101338108 12:103814843-103814865 GACTTCTCTGTGGCAGACTTGGG + Intronic
1102605578 12:114065025-114065047 CACCCCTTTGTGGCGGCCTCAGG + Intergenic
1103707002 12:122880826-122880848 CACCTCTGTGTGCCAGGCTCGGG + Intronic
1106030444 13:25997347-25997369 CATTTCTCTTTGGCTGCCTTTGG + Intronic
1106788560 13:33130987-33131009 CACCTCTGTGTGGCTGCAGTGGG + Intronic
1107014577 13:35697687-35697709 CACCTATGTGTGAAAGCCTTGGG - Intergenic
1112200545 13:97269698-97269720 AACCTCTCTGAGGCTCCCTTTGG + Intronic
1113524704 13:110965917-110965939 CACCCCACTGTGGCGGCCTCAGG + Intergenic
1113718003 13:112527893-112527915 CACCTCTGTGTTCCAGGCTTTGG - Intronic
1113756987 13:112819326-112819348 CTCCTCTGTGTGGAAGCCTTTGG - Exonic
1115217121 14:31025564-31025586 CACCTCTCTGTGGGAGAGTCCGG - Intronic
1117179918 14:53181287-53181309 CACCCCCTTGTGGCAGCCTCAGG - Intergenic
1118747454 14:68784554-68784576 CAACTCCCTGAGGCAGCCCTAGG + Intergenic
1118885934 14:69865925-69865947 TTCCTCTCTGTGGCAGCCAGAGG + Intronic
1119935909 14:78592416-78592438 CCCCTCTCTGTTGGACCCTTGGG - Intronic
1120423288 14:84315491-84315513 CAGCTCCCTGTGTCAGCCTCAGG - Intergenic
1122838041 14:104440826-104440848 CACATCTCTGTGTCACACTTTGG - Intergenic
1122853084 14:104547208-104547230 CCCCTCTCTGTGACAGAGTTTGG + Intronic
1122961620 14:105096455-105096477 GACCTCCCTGGGGCAGCCATGGG - Intergenic
1124347929 15:28934760-28934782 CCCATCTCTGTGACAGCCCTGGG - Intronic
1124636357 15:31367278-31367300 CACCTCTCTGCAGCAGGCTGAGG + Intronic
1124997723 15:34740020-34740042 CACCTCTCTCTGGCGGTCCTGGG - Intergenic
1125679892 15:41523984-41524006 ATCCTCACTGTGGCACCCTTTGG - Intronic
1126685641 15:51246695-51246717 CCCCTCCCTGTGGCAGGCTAGGG - Intronic
1128498291 15:68210567-68210589 CACCTCCCAGCTGCAGCCTTCGG + Intronic
1130203265 15:81852716-81852738 CACCTCTCTGAGGCTGCCACTGG - Intergenic
1130233168 15:82112229-82112251 CTGCTCTGTGTGGCTGCCTTGGG - Intergenic
1130510220 15:84583023-84583045 ACCCTCTCTGTGGCTGCATTTGG - Intergenic
1130859964 15:87877058-87877080 CACCTCTTTGGGGCAGACTCGGG + Exonic
1132354263 15:101159565-101159587 CACACCTCCGGGGCAGCCTTGGG - Intergenic
1133279108 16:4655172-4655194 ACCCTCTCTGTGGCAGCCCCTGG - Intronic
1136027104 16:27475535-27475557 CACCTCTCTGTTGGGGTCTTGGG + Intronic
1136375410 16:29862555-29862577 CACCCCTCTCAGCCAGCCTTGGG - Intronic
1136594423 16:31238125-31238147 CACCTCTCTTTGTCAGATTTTGG - Intergenic
1138345944 16:56320261-56320283 TATCTCTATGTGGCAGCCCTGGG + Intronic
1138590927 16:57999490-57999512 CACCACTTTGTGGCAGCATGAGG + Exonic
1139300153 16:65938172-65938194 CACCTCTCTGTGAAGGCCATAGG - Intergenic
1139732643 16:68959778-68959800 CAACTCTCCGTGGAAGCCTTTGG + Intronic
1141214720 16:82012266-82012288 AACCTCTCTGAGTCTGCCTTTGG - Intergenic
1141552201 16:84813546-84813568 CACCTCTCTGGGGGACCCTGAGG - Intergenic
1142188670 16:88706874-88706896 CGCCTCCCCGTGTCAGCCTTGGG + Intronic
1142962056 17:3557338-3557360 CACCTCCCTGGGTCAGCCTCGGG + Intronic
1143354481 17:6315818-6315840 CCCATCTCTTTGGCAGCCTGAGG + Intergenic
1144088235 17:11830028-11830050 CTCCTCTCTGTGGTGGACTTGGG + Intronic
1151277301 17:73045114-73045136 GGCCTCTCTGGGGTAGCCTTGGG + Intronic
1152081489 17:78190258-78190280 CACCTCTGTGTGTCAGCCATAGG + Intronic
1152081630 17:78191071-78191093 GACCTCTCCGTGGCCGCATTGGG + Intronic
1152259767 17:79260616-79260638 CACCTCTCTGGGCCACCCCTGGG - Intronic
1152763055 17:82119585-82119607 CAGGTCTCTTGGGCAGCCTTTGG + Intronic
1154110701 18:11566191-11566213 AACCCCTCTGTGGCTGCATTTGG + Intergenic
1155809762 18:30217172-30217194 CAGGTCTCTGTGGCAGTCATGGG + Intergenic
1156516660 18:37685992-37686014 CTCCTCTCTTTTGGAGCCTTGGG + Intergenic
1157001972 18:43537717-43537739 CATCTCTCAGTGTCAGCATTTGG - Intergenic
1157818540 18:50748896-50748918 CACCTCTCTGTGGTGGCCCCTGG + Intergenic
1158788539 18:60745620-60745642 CACCTTTCTGTGACATCCTATGG - Intergenic
1159102415 18:63970901-63970923 CCCCTCTCTGTTGCAGCCACCGG + Intronic
1160834160 19:1116756-1116778 CCCCTCTCTGTGGCCACCTGTGG - Intronic
1161738824 19:6007914-6007936 CTCCTCTCTGTGGCCTCCCTTGG - Intronic
1163590738 19:18192918-18192940 CCCCTTTCTGTGCCAGCCTATGG - Intergenic
1163819819 19:19489879-19489901 CACCTCTGTGCTGAAGCCTTGGG + Intronic
1164797769 19:31048218-31048240 CACTCCTCTGTGGCTGGCTTTGG + Intergenic
1166946423 19:46399806-46399828 CACCTCACTTTGCCATCCTTGGG + Intergenic
1168294672 19:55372930-55372952 CCCCTCACTGACGCAGCCTTGGG - Intergenic
925311608 2:2888287-2888309 CACCTCTGTGATGCAGGCTTGGG - Intergenic
926047544 2:9720828-9720850 CTCATGTCTGTGGCAGCTTTAGG - Intergenic
926906369 2:17809347-17809369 CAACTGTATGTGACAGCCTTGGG - Intergenic
929116230 2:38446645-38446667 CTCCTCTCTGTGGCCTCCTGGGG + Intergenic
929180335 2:39031141-39031163 TACTTTGCTGTGGCAGCCTTAGG + Intronic
929338171 2:40777913-40777935 CATGTCTCTGTGTCAGCTTTTGG - Intergenic
929885166 2:45871781-45871803 CTCCTCTCTGGGGCAGTCTCAGG - Intronic
932515120 2:72338790-72338812 TTCCTGTCTGTAGCAGCCTTGGG - Intronic
933817100 2:86077024-86077046 CATCTCTTTGTGGCACACTTGGG - Intronic
935083431 2:99821942-99821964 CACCTCTTTCTCACAGCCTTGGG - Intronic
938194057 2:129310483-129310505 CTCCTCTTTGCGGCAGCCTTGGG - Intergenic
938794596 2:134707010-134707032 CACCTCTCAGAAGCAGCCTCCGG + Intronic
946219349 2:218213216-218213238 CCCCCATCTGTGGAAGCCTTAGG - Intergenic
947533655 2:230927944-230927966 CAGCTCTCTGGGGCAGGCTTGGG - Intronic
948978311 2:241478329-241478351 CACCTGCCTGGGGCAGCCTTAGG + Intronic
1171020383 20:21579372-21579394 CACTTCTCCATGGCCGCCTTGGG + Intergenic
1173638935 20:44585499-44585521 CACCTCTCTGTGCCTTTCTTAGG - Intronic
1174666732 20:52265105-52265127 GACCTCTTTGTGGGAGCCCTAGG + Intergenic
1174745958 20:53063129-53063151 CAAGTCTCTGTGCCAGACTTTGG - Intronic
1175988008 20:62773789-62773811 CTCCTCTCCATGACAGCCTTGGG - Intergenic
1176115063 20:63428605-63428627 CACCTCTCTTGGGCAGGCCTGGG + Intronic
1178742578 21:35216006-35216028 GACCTCTCTGTGGCTGCCTAAGG - Intronic
1179538486 21:42068050-42068072 CTCCTCCATGTGGCAGCCTTCGG - Intronic
1180984644 22:19897195-19897217 CACGTCTCTGAGTCAGCCTGGGG + Intronic
1181148315 22:20864561-20864583 CACCCCTCTGAGGCAGCGTGTGG + Intronic
1183379486 22:37483904-37483926 CATCGCTCTGTGCCAACCTTAGG - Intronic
1183740835 22:39667653-39667675 GCCATCTCTGTGGGAGCCTTGGG + Intronic
1184287920 22:43482450-43482472 CACCTCTCTGTGGGAGCCAGTGG + Intronic
954604390 3:51897510-51897532 CACCCCCTTGTGGCAGCCTCAGG + Intronic
955397053 3:58565031-58565053 CAGCTATCTGTGGCAGTTTTGGG + Intronic
956735887 3:72237851-72237873 CACTTCTCTGTGTCAGACTCAGG - Intergenic
957977958 3:87471777-87471799 CACCTATCTGTAGCAGGCTTAGG - Intergenic
958933064 3:100228279-100228301 CACGTCTCTGTGTCACCTTTTGG + Intergenic
961481359 3:127183053-127183075 CACCTCTCCAGGGCTGCCTTAGG - Intergenic
962266397 3:133947415-133947437 AACCTCCCTGCTGCAGCCTTGGG - Exonic
962879116 3:139559483-139559505 CAGCTTGCTGTGGCAGCTTTTGG + Intergenic
963729034 3:148953257-148953279 CACCTCTGTTTGGCTGCCTTTGG + Intergenic
965758921 3:172054206-172054228 CCCATCCCTGTGGCTGCCTTGGG - Intronic
967453008 3:189648434-189648456 CACCTCTGTGTGCCAGCCTGTGG - Intronic
970057143 4:11988061-11988083 AGTCTCTCTGTGGGAGCCTTGGG + Intergenic
972407653 4:38762175-38762197 CACCTCTCCCAGGCGGCCTTAGG + Intergenic
972569813 4:40300307-40300329 CACCTCTCTGTGGCTGATCTGGG - Intergenic
974076078 4:57169771-57169793 CACTTCCCAATGGCAGCCTTTGG - Intergenic
974474870 4:62365686-62365708 CACCTCTCTATGGCTCCCTTTGG - Intergenic
975452687 4:74548028-74548050 AATCTCTGTGTGGCTGCCTTTGG - Intergenic
975507711 4:75157299-75157321 AGTCTCTCTGTGGGAGCCTTAGG - Intergenic
978237653 4:106478869-106478891 CACCTCTAGGTAGCAGCCTCTGG - Intergenic
979359990 4:119750633-119750655 CATCTCTCGCTGGCAGCCTGAGG - Intergenic
979649712 4:123115189-123115211 CGGCTCTCGGTGGCAGCCTGGGG + Intronic
980180751 4:129397775-129397797 CACCTATCTGTGGCACCCAGTGG + Intergenic
984667608 4:182445970-182445992 CACGTCTCTGTGGAACTCTTTGG + Intronic
985230593 4:187811800-187811822 CACCTCTGAGTGGCACCCTGAGG + Intergenic
985372914 4:189305976-189305998 CAAATCTCTGTGGCAGAATTTGG + Intergenic
986546485 5:8903612-8903634 CCCTTCTCTGTGGCAACCATGGG + Intergenic
986727342 5:10608965-10608987 CACATCTTAGTGCCAGCCTTGGG + Intronic
988160423 5:27513082-27513104 CACATCTCTGTTTCAGACTTTGG + Intergenic
989952236 5:50313097-50313119 CATCTCTGTTTGGCAGCCCTCGG + Intergenic
991321965 5:65383830-65383852 AGGCTCTCTGTGGCATCCTTTGG + Intronic
993902710 5:93595447-93595469 CAGCTCTCTGTAACAGCTTTCGG + Intergenic
997595808 5:135106809-135106831 CACCTCCATGAGGCAGCCTCAGG - Intronic
998552919 5:143094412-143094434 CACCCCCTTGTGGCAGCCTCAGG - Intronic
998848955 5:146336828-146336850 CACATCTGTGTCCCAGCCTTTGG + Intronic
999500622 5:152143163-152143185 CACTTCTCTGAGACAGCCTTTGG - Intergenic
999553907 5:152720515-152720537 TGCCTCACTGTGGCAGCCTTGGG + Intergenic
1000889121 5:166783437-166783459 CACCGCTCTGTGACAGCGGTGGG - Intergenic
1001534812 5:172490982-172491004 CACCTCTCTGTTGCCTCCTCAGG + Intergenic
1002069848 5:176672735-176672757 CTCCTCTCTGTGCCCGCATTGGG - Intergenic
1002540668 5:179904563-179904585 CACTTCCCTCTTGCAGCCTTGGG + Intronic
1003500206 6:6696901-6696923 CACCTCTCGGTGGAAGCAGTTGG + Intergenic
1004258370 6:14085648-14085670 CATACCTGTGTGGCAGCCTTTGG + Intergenic
1004522784 6:16378034-16378056 CAGCCCTCTATGGCAGCCATGGG + Intronic
1004603913 6:17176230-17176252 CACCTCTCTGTGGCAGAACGGGG - Intergenic
1006605357 6:35252268-35252290 CACAGCTCAGTGCCAGCCTTTGG - Exonic
1011224651 6:85093436-85093458 CTCGTCTCTGTGACATCCTTTGG - Intergenic
1011643684 6:89437466-89437488 CATCTCTCTGTGCCCTCCTTAGG + Intronic
1012903248 6:105032397-105032419 CACCTATCTTTGCCAGCATTTGG + Intronic
1012908155 6:105091224-105091246 GACCTCTCTGAGGCAGCCAGTGG - Intergenic
1013608325 6:111771648-111771670 CTGCTGTCTGAGGCAGCCTTGGG - Intronic
1017613304 6:156214113-156214135 CAGCTCCCTGTGTCAGTCTTGGG + Intergenic
1018238154 6:161745953-161745975 CAGCTCTCTGTGGGGGCCTGTGG + Intronic
1018294997 6:162336351-162336373 CTCCTCTCTCTGGAAGCCTCAGG + Intronic
1019285836 7:222494-222516 CCCCTCTCAGTGCCAGCCCTGGG - Intronic
1020103332 7:5407667-5407689 GACCTCTCCTTGGCCGCCTTTGG - Intronic
1022535170 7:31093952-31093974 CACCTCCCTGAGGAAGCCTCAGG - Intronic
1023257587 7:38327340-38327362 CACCTTTCTGTGTCAGGCTCAGG + Intergenic
1023357031 7:39377637-39377659 CCCCTCGCTGTGTCAACCTTGGG + Intronic
1026879841 7:73901383-73901405 CAGCTCTCTCTGGCAGCCCAAGG - Intergenic
1026903107 7:74047811-74047833 CACCTCGCTGGGGCAGGGTTGGG + Intronic
1035037388 7:155904066-155904088 CATCCCTCTGTGGCATCCTGTGG - Intergenic
1035165669 7:156988262-156988284 CAGCTCTGGGTGGCAGCCTAGGG + Intergenic
1037685550 8:21136703-21136725 CACTTCACTATGGCAGCCCTGGG - Intergenic
1038379638 8:27080376-27080398 CACCTCTCCCTTGCAGCCTTAGG - Intergenic
1040561003 8:48523482-48523504 CTCCTCTGTGCGGGAGCCTTAGG - Intergenic
1040879750 8:52192052-52192074 GACCCCTCTGTGCCAGCCCTGGG - Intronic
1040939164 8:52815314-52815336 CAGCTCTGTGTGGCATCCTGAGG - Intergenic
1041211847 8:55559723-55559745 CACCTGACTGTGGCCGACTTTGG - Intergenic
1048718521 8:137296624-137296646 AAGCTCACTGTGGCAACCTTTGG + Intergenic
1049572579 8:143376163-143376185 CACCTCTCTGTGCCTGCATCAGG - Intronic
1049632831 8:143668132-143668154 CACCTCTCTGGGGCAGGCTGAGG - Intergenic
1055019670 9:71656275-71656297 CACGTATCTGTGACAGCCTCAGG - Intergenic
1056489078 9:87087259-87087281 CTCCTATCTGTGGCTGTCTTGGG - Intergenic
1056803169 9:89708241-89708263 CACCAGTCTGTGCCAGCCTATGG - Intergenic
1056969355 9:91189446-91189468 CTCATCTCTCTGGCTGCCTTCGG - Intergenic
1057179198 9:93020812-93020834 CACCTTTCCATGGCAGCTTTAGG + Intronic
1060477009 9:123994473-123994495 CAGGCCTCTGTGCCAGCCTTTGG - Intergenic
1061855275 9:133438527-133438549 CACCCTTCTGTGGCAGGCTCAGG + Intronic
1061900544 9:133669889-133669911 CACCCCTCTGTGGCAGGTCTAGG - Intronic
1061941453 9:133886350-133886372 GACCTCCCTGTGGCAGGGTTAGG - Intronic
1062342552 9:136100249-136100271 CCCCGCTCTGTGCCAGCCTGAGG + Intergenic
1185696608 X:2199615-2199637 CCCGTCTCTGTGACAGCCTGTGG + Intergenic
1185972727 X:4682496-4682518 CACATCTCTGAGGGAGCCTCTGG + Intergenic
1188009811 X:25043665-25043687 CACCTCTCAGGGGCAGCCAAGGG + Intergenic
1188858314 X:35224613-35224635 CACCTCTCTGAGTCAGCTTCAGG + Intergenic
1196592471 X:117503078-117503100 CATCTTTCTGTGTCTGCCTTAGG - Intergenic
1197553909 X:127931424-127931446 TACCTCTCTTTGGATGCCTTAGG - Intergenic
1199762049 X:150912433-150912455 CACCTCTTTCTTGAAGCCTTTGG + Intergenic
1199949394 X:152695379-152695401 CACCTATCAGTGGCAGCCAAGGG + Intergenic
1199960282 X:152773070-152773092 CACCTATCAGTGGCAGCCAAGGG - Intergenic
1200905036 Y:8473207-8473229 CACCTCTCAGTGTTATCCTTAGG + Intergenic
1201903992 Y:19071152-19071174 CTCCTCCCTGTGGCAGTTTTTGG - Intergenic
1202242420 Y:22785532-22785554 CCCCTCTCTGTGGCTGGCTGAGG + Intergenic
1202395405 Y:24419281-24419303 CCCCTCTCTGTGGCTGGCTGAGG + Intergenic
1202475380 Y:25250811-25250833 CCCCTCTCTGTGGCTGGCTGAGG - Intergenic