ID: 1083587648

View in Genome Browser
Species Human (GRCh38)
Location 11:63872180-63872202
Sequence AGCCCAAGGCTGCCACAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 291}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083587648_1083587652 -8 Left 1083587648 11:63872180-63872202 CCTCTCTGTGGCAGCCTTGGGCT 0: 1
1: 0
2: 2
3: 22
4: 291
Right 1083587652 11:63872195-63872217 CTTGGGCTGTGTTCTGGAAAGGG 0: 1
1: 0
2: 16
3: 22
4: 322
1083587648_1083587656 18 Left 1083587648 11:63872180-63872202 CCTCTCTGTGGCAGCCTTGGGCT 0: 1
1: 0
2: 2
3: 22
4: 291
Right 1083587656 11:63872221-63872243 AGCTTTCCTCTCCCTGTGGGAGG 0: 1
1: 0
2: 2
3: 29
4: 251
1083587648_1083587651 -9 Left 1083587648 11:63872180-63872202 CCTCTCTGTGGCAGCCTTGGGCT 0: 1
1: 0
2: 2
3: 22
4: 291
Right 1083587651 11:63872194-63872216 CCTTGGGCTGTGTTCTGGAAAGG 0: 1
1: 0
2: 0
3: 28
4: 243
1083587648_1083587655 15 Left 1083587648 11:63872180-63872202 CCTCTCTGTGGCAGCCTTGGGCT 0: 1
1: 0
2: 2
3: 22
4: 291
Right 1083587655 11:63872218-63872240 AGGAGCTTTCCTCTCCCTGTGGG 0: 1
1: 0
2: 4
3: 19
4: 196
1083587648_1083587654 14 Left 1083587648 11:63872180-63872202 CCTCTCTGTGGCAGCCTTGGGCT 0: 1
1: 0
2: 2
3: 22
4: 291
Right 1083587654 11:63872217-63872239 GAGGAGCTTTCCTCTCCCTGTGG 0: 1
1: 0
2: 2
3: 17
4: 269
1083587648_1083587653 -5 Left 1083587648 11:63872180-63872202 CCTCTCTGTGGCAGCCTTGGGCT 0: 1
1: 0
2: 2
3: 22
4: 291
Right 1083587653 11:63872198-63872220 GGGCTGTGTTCTGGAAAGGGAGG 0: 1
1: 0
2: 1
3: 34
4: 314
1083587648_1083587657 19 Left 1083587648 11:63872180-63872202 CCTCTCTGTGGCAGCCTTGGGCT 0: 1
1: 0
2: 2
3: 22
4: 291
Right 1083587657 11:63872222-63872244 GCTTTCCTCTCCCTGTGGGAGGG 0: 1
1: 0
2: 7
3: 34
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083587648 Original CRISPR AGCCCAAGGCTGCCACAGAG AGG (reversed) Intronic
900596762 1:3483489-3483511 AGCCCTGGGCGGGCACAGAGTGG + Intergenic
900991916 1:6102012-6102034 AGCCCCAGGCTGGCAAAGGGAGG - Exonic
902152691 1:14457139-14457161 TGTCCAAGGCTTCCACAAAGTGG + Intergenic
902669520 1:17963157-17963179 ACCCAAAGCCTGGCACAGAGTGG + Intergenic
902803294 1:18844827-18844849 ACCCCAAGGCCTGCACAGAGTGG + Intronic
903009071 1:20317721-20317743 AGCCAAAGGCTGCCAGGGATGGG + Intronic
903490950 1:23728086-23728108 AGCCCAGTACCGCCACAGAGGGG + Intergenic
903795799 1:25928002-25928024 AGCCCAGAGCAGCTACAGAGAGG - Intergenic
904500931 1:30912499-30912521 CGCCCAGGCCTGACACAGAGTGG + Intergenic
904775180 1:32901705-32901727 GGCCCAAGGCTGGGACGGAGAGG + Intergenic
905028559 1:34866804-34866826 ACCCCAAGGCTTCCTCAGCGCGG - Intronic
905107200 1:35571317-35571339 AACCCAAGGAAGCCACAGACAGG + Intergenic
905548550 1:38818319-38818341 AGACCAAGGCTGCCATCTAGCGG + Intergenic
905749658 1:40451023-40451045 ATCCAAAGGCGGCCACGGAGCGG + Exonic
905847208 1:41242521-41242543 AGCCCCACGCGGCCTCAGAGCGG - Intergenic
906296685 1:44652995-44653017 AGCTCAAGGCTCCCACAGCAGGG - Intronic
907012487 1:50977314-50977336 AACCCAAGCCTTCCACGGAGGGG + Intergenic
907560858 1:55386121-55386143 AGCCCATGGCTGCAGCAGAGGGG + Intergenic
907824765 1:58004787-58004809 AGCCAATGCCTACCACAGAGAGG + Intronic
908429230 1:64039632-64039654 AGCCAAAAGCTTCCACAGTGAGG + Intronic
908507927 1:64824354-64824376 AGCCTAATGCTGCCACCCAGTGG + Intronic
911372737 1:97013814-97013836 AGCCAAAGGGTGACACAGGGTGG + Intergenic
911464243 1:98232626-98232648 AGTCCATGGCTCTCACAGAGAGG + Intergenic
911752028 1:101506124-101506146 AGGACAAAGCTTCCACAGAGTGG - Intergenic
912548269 1:110466571-110466593 AGCCCCAGGCTGGCACAGAGAGG + Intergenic
913401196 1:118435415-118435437 AACCCAAGGCTATCACAGTGTGG - Intergenic
913557472 1:119982382-119982404 AGTCAAAAGCAGCCACAGAGAGG + Intronic
915734723 1:158077539-158077561 AGCCCAAGGCAGGCCCAGGGAGG - Intronic
915778645 1:158520888-158520910 ATCTCAAGGCTCCCACAAAGAGG - Intergenic
915940956 1:160117854-160117876 AGCCAGAGGCTGGGACAGAGTGG - Intronic
916438112 1:164795345-164795367 AGCCCAAGGAAGTAACAGAGAGG - Intronic
917086914 1:171312746-171312768 AGAACAAAGCTTCCACAGAGTGG - Intergenic
917369891 1:174281159-174281181 AGAACAAAGCTTCCACAGAGTGG + Intronic
917499727 1:175575398-175575420 AGCACAAGGCTTGCACATAGTGG - Intronic
918136379 1:181677796-181677818 AGCCCAGGGGTGTCATAGAGTGG + Intronic
919966382 1:202530715-202530737 AGTACAAGGCAGCAACAGAGAGG - Intronic
923328516 1:232901298-232901320 AGCCCAAGGCTTCAGCAAAGTGG + Intergenic
924306078 1:242690427-242690449 AGAACAAAGCTTCCACAGAGTGG - Intergenic
924832007 1:247606084-247606106 AGCCTATGGTTGCCACAGAGAGG - Exonic
1063104885 10:2984549-2984571 AGCCCCAGCCTGGCAGAGAGTGG + Intergenic
1063812867 10:9734198-9734220 GGTCCAAGGCTGCTACAAAGAGG + Intergenic
1064260061 10:13778159-13778181 TGCCCAAGGCTGCCACCTGGTGG + Intronic
1064591607 10:16897835-16897857 AGCCCAACGCTGCTGCCGAGTGG - Intronic
1067720268 10:48722851-48722873 AGCTCAGGGCTGCCAGACAGAGG - Intronic
1069152685 10:64984893-64984915 AGACCAAAGCTTCCACAGCGTGG + Intergenic
1070569728 10:77631869-77631891 AGCCCAAGGCTCCCAAAGGGAGG + Intronic
1070627546 10:78061974-78061996 CTCCCACGGCAGCCACAGAGTGG + Intergenic
1071547281 10:86538344-86538366 AGGACAAAGCTGCCACAGCGTGG + Intergenic
1072522041 10:96237490-96237512 AGCCCAAGAGTGCAAGAGAGGGG + Intronic
1074584423 10:114753266-114753288 AGGGCAAGACAGCCACAGAGGGG + Intergenic
1074708192 10:116154778-116154800 GGTCCTAGGCTGGCACAGAGAGG + Intronic
1075437470 10:122455900-122455922 AGCCCCAGGCAGCCACCGAAAGG - Intronic
1076466617 10:130687042-130687064 AGCTCTATGCTGCCACAAAGGGG + Intergenic
1076554969 10:131315356-131315378 CGCCCAAGGCAAGCACAGAGTGG + Intergenic
1076814660 10:132908864-132908886 AGCCCTTGGCTGCCCCTGAGCGG + Intronic
1078571112 11:12458685-12458707 CACCCTGGGCTGCCACAGAGGGG - Intronic
1079746061 11:24131755-24131777 AGAACAAAGCTTCCACAGAGTGG - Intergenic
1079883409 11:25955447-25955469 AGCATAATGCTGTCACAGAGTGG - Intergenic
1080733864 11:34990047-34990069 ATCCCAAGGATGCCACTGTGGGG + Intronic
1082260302 11:50072844-50072866 GGCCCGAGGATGCCACAGCGAGG + Intergenic
1083196309 11:61090683-61090705 GGGCCAAGGCTGCCACACCGAGG + Intergenic
1083251516 11:61470970-61470992 ATCCCTGGGCTGCCACAGAAAGG - Intronic
1083587648 11:63872180-63872202 AGCCCAAGGCTGCCACAGAGAGG - Intronic
1083740758 11:64710535-64710557 AGCCCAATTCAGCCACAGTGAGG + Intronic
1083827426 11:65211475-65211497 AGCCCATGGCTGGCACAGGCAGG - Exonic
1084334711 11:68449971-68449993 AGCCTTGGGCTGGCACAGAGAGG - Intergenic
1084490897 11:69477755-69477777 AGCCCCAAGCTGCCACAGCCTGG + Intergenic
1084652952 11:70499753-70499775 AGCCCGGGGCTGCTGCAGAGAGG + Intronic
1084831855 11:71775533-71775555 AGAACAAAGCTGCCACAGTGTGG - Intergenic
1085526862 11:77169263-77169285 TGCCCACGGCTGCCCCAGGGAGG - Intronic
1087318484 11:96632376-96632398 AGATCAAGGCTGCCACAAAGGGG + Intergenic
1088353342 11:108914372-108914394 CGCCAGAGGCAGCCACAGAGAGG + Intronic
1089112124 11:116065320-116065342 AGGGGAAGGCTGACACAGAGTGG - Intergenic
1089385945 11:118068153-118068175 AGCACCAAGCTGCCACAGAAAGG + Intergenic
1089504948 11:118956725-118956747 AGCCCAAGCCTGCCACCTGGTGG + Intronic
1089608518 11:119656257-119656279 AGCCCAGAGCTAGCACAGAGTGG - Intronic
1090746542 11:129710157-129710179 AGGCCACAGCTGACACAGAGAGG - Intergenic
1092123126 12:6058183-6058205 AGCCCTAGGCTGCAAAAGGGGGG + Intronic
1093945044 12:25098815-25098837 AGCAAAAGGCTGATACAGAGTGG - Intronic
1103944002 12:124516321-124516343 GGCCCAGGGCTGGCACGGAGGGG + Intronic
1104001608 12:124863918-124863940 AGCCCAAGGCTGCCCGGGGGCGG - Intronic
1104874751 12:132026224-132026246 GGGCCAAGGCAGGCACAGAGCGG - Intronic
1106575553 13:30971043-30971065 AGCCCAAGGCAGCCCCAAAGAGG - Intronic
1106933725 13:34695394-34695416 AGACCAAGGCTTGGACAGAGAGG + Intergenic
1107014576 13:35697685-35697707 AGCCCAAGGCTTTCACACATAGG + Intergenic
1108436281 13:50404642-50404664 AGCCCCAAGCTGTCAAAGAGGGG - Intronic
1109662055 13:65473502-65473524 AACCCAAGGGTGACACAGAATGG - Intergenic
1111239898 13:85459731-85459753 AGAACAAAGCTTCCACAGAGTGG - Intergenic
1112327324 13:98450659-98450681 AGCTCAGGGCTGGCACTGAGAGG + Intronic
1114080306 14:19197975-19197997 AGGCCAGGGCTGGTACAGAGGGG - Intergenic
1115854059 14:37611089-37611111 AGTCCGAGGCTGCCCCGGAGCGG + Intronic
1117650482 14:57899907-57899929 AGGACAAAGCTTCCACAGAGTGG + Intronic
1118768989 14:68929222-68929244 AGACCAAGGCTGCCCCAGGCTGG - Intronic
1118989963 14:70789096-70789118 AGCCAAAGGCTGTAACAGACAGG + Intronic
1119878935 14:78084897-78084919 AGAAGAAGGATGCCACAGAGAGG - Intergenic
1122317473 14:100834692-100834714 AGCACCAGCCTGGCACAGAGTGG + Intergenic
1124249487 15:28097507-28097529 AGATAAAGGCTACCACAGAGGGG - Intronic
1125679891 15:41523982-41524004 TGCCAAAGGGTGCCACAGTGAGG + Intronic
1126128225 15:45314900-45314922 AGAACAAAGCTTCCACAGAGTGG - Intergenic
1126685639 15:51246693-51246715 AACCCTAGCCTGCCACAGGGAGG + Intronic
1127377364 15:58397538-58397560 AATCCAATGCTGCCACAGTGGGG - Intronic
1128812246 15:70581097-70581119 AGCACAAGGAGACCACAGAGAGG + Intergenic
1130901788 15:88212790-88212812 TGCCAATGGCAGCCACAGAGTGG - Intronic
1133306303 16:4811830-4811852 AGCCCAAGAATGCCACAGACAGG + Intronic
1133367387 16:5221482-5221504 AGAACAAAGCTGCCACAGCGTGG + Intergenic
1134076838 16:11297868-11297890 AGCCCAAGACTGCCACGCCGTGG + Intronic
1134095257 16:11414630-11414652 AGGGCAAGGCTGCCACAGCGTGG + Intronic
1134590626 16:15450155-15450177 AGCCTAAAGCTGCCATAGACAGG + Intronic
1135224481 16:20643623-20643645 AGCCCAAAGCTTCCACAGCAGGG + Intronic
1135673861 16:24397541-24397563 ATCCCAATGCTGCCACACTGAGG + Intergenic
1136265001 16:29110920-29110942 AGCTCAGGGCGGCCACAGTGTGG + Intergenic
1136265178 16:29112434-29112456 AGCTCAGGGCGGCCACAGTGTGG - Intergenic
1136375408 16:29862553-29862575 ACCCCAAGGCTGGCTGAGAGGGG + Intronic
1137643513 16:50054535-50054557 AGCCAAAGGCAGCCACTGGGGGG + Intergenic
1137653029 16:50136584-50136606 AGCTCAAGTCTGCCTCACAGTGG - Intergenic
1138270987 16:55695647-55695669 AGCCCAGGGCTGGTACAGAGAGG - Intronic
1139305146 16:65979213-65979235 AGCCCAAAGCTGGCACATAATGG - Intergenic
1139956450 16:70695487-70695509 AGTCCAAGGCTGCCCTGGAGTGG - Intronic
1142053794 16:87978895-87978917 AGCTCAGGGCGGCCACAGTGTGG + Intronic
1142053978 16:87980409-87980431 AGCTCAGGGCAGCCACAGTGTGG - Intronic
1142303785 16:89274418-89274440 ACCCCAGGGCTGCCACATCGAGG - Intronic
1142349610 16:89574193-89574215 AGCCCTTGGCTGTCACATAGCGG - Intergenic
1142409942 16:89910886-89910908 AGACCAAGCCAGGCACAGAGTGG - Intronic
1143383102 17:6508561-6508583 AGCGAAAGGCTGCCACAGTCAGG + Intronic
1144088236 17:11830030-11830052 AACCCAAGTCCACCACAGAGAGG - Intronic
1146654793 17:34628841-34628863 AGCCCCAGGATCCCACTGAGGGG - Intronic
1146910476 17:36645457-36645479 AGCCCAAAGCAGACACAGAAAGG - Intergenic
1147311010 17:39596232-39596254 AGCCCAGGCCTGGCACAGACAGG + Intergenic
1147375061 17:40018352-40018374 AGCCCAAGGCTGCCACAAGCAGG - Intergenic
1149074681 17:52581022-52581044 AGGACAAAGCTTCCACAGAGTGG - Intergenic
1150833616 17:68544345-68544367 AGCGCCAGGCTGCCTGAGAGTGG + Intronic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1153832327 18:8934943-8934965 AGAACAAAGCTTCCACAGAGTGG + Intergenic
1155602901 18:27569638-27569660 AGAACAAAGCTTCCACAGAGTGG + Intergenic
1157317417 18:46603933-46603955 AGCCCCAGGCTGCAACCCAGTGG + Intronic
1157711215 18:49850934-49850956 AGCCCAGGGCTGCTCCAGACTGG + Intronic
1160027584 18:75231173-75231195 GCCCCAAGCCTGGCACAGAGTGG + Intronic
1160681232 19:412486-412508 AATCCAAGGCTGCCCCACAGTGG + Intergenic
1161261178 19:3338689-3338711 AGCCCCAGGGTGGCACAGGGTGG + Intergenic
1161431398 19:4234375-4234397 TGCCTGGGGCTGCCACAGAGGGG - Intronic
1161500360 19:4611270-4611292 ACCCCAGGGGTGCCCCAGAGAGG - Intergenic
1164528599 19:29029872-29029894 AGACCAACCCTGCCAGAGAGAGG - Intergenic
1166316695 19:41993473-41993495 AGCCCCAGGCTGCGACACTGCGG + Intronic
1168294670 19:55372928-55372950 GGCCCAAGGCTGCGTCAGTGAGG + Intergenic
925109222 2:1319498-1319520 ATCCCAGGGGTGCCACGGAGGGG - Intronic
925972355 2:9114629-9114651 AGCCCAAGGGAGCCACAGTGTGG + Intergenic
926083292 2:10005938-10005960 AGAACAAAGCTGCCACAGTGTGG + Intergenic
926164081 2:10507300-10507322 AGCACAGGGCTGACACACAGCGG + Intergenic
927090257 2:19705202-19705224 AGCCCAGGGCTTCTACACAGTGG - Intergenic
927208140 2:20622930-20622952 AGCCCGAGGCTGCTAATGAGGGG + Intronic
927331320 2:21866939-21866961 AGCCCCAGGGTGGCACAGAGTGG - Intergenic
928097068 2:28411293-28411315 AGCCCTAGGCTGCTAGAGAGTGG - Intronic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
933341844 2:81035430-81035452 AGAACAAAGCTTCCACAGAGTGG - Intergenic
934546976 2:95225931-95225953 AGCCCAGGAAAGCCACAGAGTGG - Intronic
934739146 2:96706658-96706680 AGCCCCAGGCCCCAACAGAGAGG + Exonic
934762581 2:96864676-96864698 TGGCCAGGGCTCCCACAGAGTGG - Intronic
935173379 2:100628092-100628114 AGGCCAAGGCTCCCACAGCCAGG + Intergenic
935359703 2:102237148-102237170 AGCCAGAGGCAGCCACAGTGTGG - Intronic
936290795 2:111222474-111222496 AGCCCAAGGAAGCCACGGTGTGG - Intergenic
937984266 2:127631546-127631568 AGCCCCACGCTGACACAGACTGG - Intronic
938194056 2:129310481-129310503 GTCCCAAGGCTGCCGCAAAGAGG + Intergenic
938564767 2:132508740-132508762 AGCCCCAGGGAGCCTCAGAGAGG + Intronic
938994772 2:136666451-136666473 TGCCCATGGAGGCCACAGAGGGG - Intergenic
939410274 2:141815746-141815768 AGCACAAAGCTTCCACAGCGTGG - Intronic
940562305 2:155313864-155313886 AGCCCCAGGCCTCCACAAAGAGG + Intergenic
941160339 2:162027999-162028021 GGCTCAAGGCTGCCACTGAAGGG - Intronic
942431670 2:175918154-175918176 AGGCCAAGTCTGGCCCAGAGTGG - Intergenic
945221143 2:207485507-207485529 AGGCCAGGTCTGCCAGAGAGAGG + Intergenic
946114798 2:217451882-217451904 AGTCCCAGGCTGCCAGAGACTGG + Intronic
946219347 2:218213214-218213236 ATCCTAAGGCTTCCACAGATGGG + Intergenic
946475678 2:220004518-220004540 AGCCCTTGGCTTCCACTGAGGGG + Intergenic
946760120 2:222985170-222985192 AGGCTAAAGCTGCCACAGGGAGG + Intergenic
947698814 2:232215739-232215761 AGCCAAAGCCTGGCACACAGGGG - Intronic
947927719 2:233936253-233936275 AGCCCAGGGCTGACTCAGAGTGG + Intronic
948064288 2:235065106-235065128 AGCCCAAGGCAGGCAGAGGGGGG + Intergenic
1171185873 20:23123680-23123702 GTCCCACAGCTGCCACAGAGTGG + Intergenic
1171952681 20:31435280-31435302 AGCCCAAGATTTACACAGAGGGG + Intergenic
1172165257 20:32894902-32894924 TGCCCAAGACTGCCAGAGTGGGG - Intronic
1172274846 20:33673913-33673935 AGCCTGGAGCTGCCACAGAGTGG + Intronic
1172624584 20:36339973-36339995 AGGCTAAGGCAGCCGCAGAGCGG + Intronic
1172771301 20:37384173-37384195 AGCCCAAGGATGCCAGCCAGCGG + Exonic
1174006821 20:47417483-47417505 AGCACAACACTGCCAGAGAGGGG + Intergenic
1175127976 20:56766624-56766646 TGCTCGTGGCTGCCACAGAGGGG - Intergenic
1175988007 20:62773787-62773809 TGCCCAAGGCTGTCATGGAGAGG + Intergenic
1176297528 21:5082152-5082174 AGCCCCAGGCCTCCACGGAGAGG - Intergenic
1176372202 21:6068909-6068931 AGCCCAGGCCTGCCACGGCGGGG - Intergenic
1176525964 21:7918505-7918527 AGCAAAGGACTGCCACAGAGTGG - Intergenic
1177047961 21:16194520-16194542 AGCCCAGAGCTGCCACCCAGAGG - Intergenic
1178742577 21:35216004-35216026 GGCCTTAGGCAGCCACAGAGAGG + Intronic
1179751317 21:43469630-43469652 AGCCCAGGCCTGCCACGGCGGGG + Intergenic
1179859501 21:44179796-44179818 AGCCCCAGGCCTCCACGGAGAGG + Intergenic
1180122278 21:45761808-45761830 AGGTCAAGGCTGGCAGAGAGGGG - Intronic
1180500469 22:15924709-15924731 AGGCCAGGGCTGGTACAGAGGGG + Intergenic
1181553013 22:23651798-23651820 AGCCAAAGGCTGCCTCATATTGG - Intergenic
1181742535 22:24932892-24932914 AGCCCAAGGTGGCCACAGAGTGG + Intergenic
1182559365 22:31147726-31147748 TGCCCAAGGCTGCCCAGGAGGGG - Intergenic
1182621179 22:31619620-31619642 AGCCCAGGGCTTCCCCAAAGCGG + Exonic
1183079847 22:35449396-35449418 AGGCCATGGCTGGGACAGAGAGG - Intergenic
1183079888 22:35449595-35449617 AGACCACGGCTGGGACAGAGGGG - Intergenic
1183351607 22:37337680-37337702 TGCCCAAGGCGGACAGAGAGGGG - Intergenic
1183784200 22:40019898-40019920 AGCCGACGCCTGTCACAGAGCGG - Exonic
1184088679 22:42281253-42281275 AGCACAAGGCAGCCTGAGAGAGG + Intronic
1184584373 22:45437372-45437394 AGAACAAAGCTCCCACAGAGTGG - Intergenic
950366683 3:12490769-12490791 GGCCCAAGGCAGCCACGGAATGG + Intronic
957056035 3:75443956-75443978 AGACCAAAGCTTCCACAGTGTGG + Intergenic
959422897 3:106149645-106149667 AGCACAAAGCTTCCACAGTGTGG - Intergenic
963483290 3:145904034-145904056 AGCCCAGGGCTGTCACAGCCTGG + Intergenic
963492431 3:146018148-146018170 AGTACAAAGCTTCCACAGAGTGG - Intergenic
963651688 3:147988879-147988901 AGAACAAAGCTTCCACAGAGTGG + Intergenic
963909909 3:150807980-150808002 AGGCCCAGGCTGCCATGGAGTGG + Intergenic
966548850 3:181182581-181182603 AGCACAAGGCTTCCACACTGTGG + Intergenic
971139445 4:23907910-23907932 TGCGCAAGGCACCCACAGAGAGG - Intergenic
971639982 4:29118327-29118349 AGAACAAAGCTTCCACAGAGTGG - Intergenic
972049846 4:34715707-34715729 AGTCCAAAGCTTCCACAGCGTGG - Intergenic
974474869 4:62365684-62365706 AGCCAAAGGGAGCCATAGAGAGG + Intergenic
978527526 4:109680633-109680655 AGGCTATAGCTGCCACAGAGGGG - Intronic
979420128 4:120493931-120493953 AGAACAAAGCTTCCACAGAGTGG - Intergenic
980243178 4:130202905-130202927 AGAACAAAGCTCCCACAGAGTGG + Intergenic
981033471 4:140149377-140149399 GGCTCCAGGCTGCCACAGAGGGG - Intronic
982125077 4:152177406-152177428 AGCCCATGACTGCCATTGAGGGG + Intergenic
984773934 4:183463890-183463912 AGAACAAAGCTTCCACAGAGTGG + Intergenic
986121299 5:4838558-4838580 AGAACAAAGCTGCCACAGTGTGG - Intergenic
987238879 5:15972229-15972251 ATCACAAAGCTGTCACAGAGAGG - Intergenic
988279388 5:29126811-29126833 AGAACAAGGCTTCCACAGTGTGG + Intergenic
988508594 5:31846089-31846111 AACCCAAAGCCACCACAGAGGGG - Intronic
988990194 5:36662870-36662892 AGCCCATGGCGGCCTCTGAGTGG - Intronic
991175835 5:63686837-63686859 AGCCCCATGGTGCCAGAGAGGGG + Intergenic
991971869 5:72149090-72149112 AGCACAATGCTGGCACATAGTGG + Intronic
992895026 5:81238490-81238512 AGACCAATGCTGCCAAAGTGTGG - Intronic
996211672 5:120818361-120818383 AGAACAAAGCTGCCAGAGAGTGG - Intergenic
996681266 5:126229830-126229852 AGAACAAAGCTTCCACAGAGTGG - Intergenic
998676788 5:144418241-144418263 AGAACAAGGCTTCCACAGCGTGG + Intronic
999229888 5:150055486-150055508 AGCCTAAGCCTGCCACACACTGG - Intronic
999553909 5:152720517-152720539 CCCCCAAGGCTGCCACAGTGAGG - Intergenic
999978056 5:156931769-156931791 AGTCCCAGGATGCCACAGTGAGG - Intronic
1000329045 5:160193404-160193426 AGAACAAGGCTTCCACAGTGTGG + Intronic
1000889119 5:166783435-166783457 ACCCCACCGCTGTCACAGAGCGG + Intergenic
1001940671 5:175737372-175737394 AGCCCAAGGCTGCTGCTGAAGGG + Intergenic
1002327267 5:178418003-178418025 AGCCCTGGGCTGCCAGTGAGTGG + Intronic
1003176992 6:3758984-3759006 AGAACAAAGCTTCCACAGAGTGG - Intergenic
1003675681 6:8202329-8202351 AGACCCAGGCTGCCACCAAGGGG + Intergenic
1005432113 6:25769111-25769133 AGCCCAATGCTTCCACAGAACGG + Exonic
1005521224 6:26602239-26602261 AGCCCAGGTCAGCCACAGACTGG - Intergenic
1006752315 6:36386536-36386558 AGCCACAGGCTGCCACAGCACGG + Intronic
1007170720 6:39861416-39861438 AGCCCTAGCCTGGGACAGAGTGG - Intronic
1008456143 6:51713348-51713370 AGCCCAAGCCTGCCTCAGGCTGG + Intronic
1010429019 6:75757591-75757613 ACCCCAGGGCTGTCAGAGAGAGG - Intronic
1011129168 6:84036638-84036660 AGACCAAAGCTTCCACAGTGTGG + Intronic
1011193314 6:84757025-84757047 AGGCCACTGCTGCCTCAGAGTGG - Intronic
1014281674 6:119448546-119448568 AGCTCAAGGCTGCCAACAAGAGG - Intergenic
1015449084 6:133343361-133343383 AGCTCAAGGATGGCACAGGGTGG - Intronic
1017513442 6:155134526-155134548 AGCCCAATTCTGCCACAGAAAGG - Intronic
1018030679 6:159838730-159838752 AGCCCAGGCCTGACACAGCGTGG + Intergenic
1018494331 6:164333575-164333597 AGCCCAAGGTGACCACAAAGAGG + Intergenic
1019285834 7:222492-222514 GGCCCAGGGCTGGCACTGAGAGG + Intronic
1019329459 7:455471-455493 AGCCCAGGCCTGGCACAGGGAGG - Intergenic
1021827664 7:24571722-24571744 AGCCCAAGGCAGAGACAAAGCGG - Intergenic
1022457082 7:30566914-30566936 AGACCTAGGATGCCACAGTGTGG + Intergenic
1023875343 7:44283553-44283575 AGCCCAAGTCTTCTACATAGTGG - Intronic
1025015600 7:55436562-55436584 AGCCCAGGGCTGCCAAGCAGAGG - Intronic
1025127579 7:56356025-56356047 AGCCCAAGGCTGCAACATGAGGG + Intergenic
1026167265 7:67921600-67921622 AGCACAAGGCTGACATAGAGGGG + Intergenic
1026949999 7:74340689-74340711 AGCCCAAGGCCACCACAGCCTGG - Intronic
1027399916 7:77797064-77797086 GGCCAGAGGCTGCCATAGAGTGG + Intronic
1027555534 7:79660083-79660105 AGCTCAAGACTGACACAGACTGG - Intergenic
1029557758 7:101282155-101282177 AGCCCGAGGCTGCAACACAAGGG + Intergenic
1029658117 7:101940818-101940840 AGCCCAAGGATGCCTCACAGTGG + Intronic
1030677091 7:112395265-112395287 AACCCAAGTCTCCCACAGTGTGG - Intergenic
1032100316 7:128970924-128970946 AGCCCAAGTCAGAAACAGAGTGG + Intronic
1032160046 7:129502876-129502898 AGCCCCAGGCTGTCCCGGAGAGG + Intronic
1035436352 7:158863062-158863084 AGCACAAAGCTTCCACAGTGTGG + Intronic
1035468805 7:159096877-159096899 ACAGCAAGGCGGCCACAGAGAGG - Intronic
1036156634 8:6347977-6347999 AGCCAAAGGCAGCCAGTGAGCGG - Intergenic
1037646371 8:20796190-20796212 TGAGCAAGGCTCCCACAGAGAGG - Intergenic
1037899133 8:22677326-22677348 AGCCCAAGGCCCCCACAGCCCGG - Intergenic
1039182559 8:34882326-34882348 AGCACAAAGCTTCCACAGGGTGG - Intergenic
1040648714 8:49427159-49427181 AGAACAAAGCTTCCACAGAGTGG - Intergenic
1040687884 8:49897685-49897707 AGCCATAAGCGGCCACAGAGGGG + Intergenic
1040879749 8:52192050-52192072 TTCCCAGGGCTGGCACAGAGGGG + Intronic
1042548147 8:69969537-69969559 AGGCCATAGCTGCCACAGATAGG + Intergenic
1046055267 8:109071240-109071262 AGCCCAGGCCAGCCCCAGAGAGG + Intergenic
1049185127 8:141246496-141246518 AGGCCAAGGCAGCAACAGAGAGG + Intronic
1049220119 8:141425231-141425253 TGCCCAGGGCTGCCACAGGAGGG - Intronic
1049283068 8:141760393-141760415 AGGCTGAGGCTGCCACAGGGTGG + Intergenic
1049376305 8:142290927-142290949 AGCCCAGTGCAGACACAGAGGGG + Intronic
1049406037 8:142452254-142452276 AGCCCAGGGATGCGCCAGAGAGG + Intronic
1049632830 8:143668130-143668152 AGCCTCAGCCTGCCCCAGAGAGG + Intergenic
1049843154 8:144787070-144787092 ACCCCAGGGCTGGCAGAGAGCGG + Intronic
1050418586 9:5439109-5439131 AGCCCAAAGCAGGGACAGAGTGG + Intergenic
1051955495 9:22688016-22688038 AGAACAAAGCTTCCACAGAGCGG - Intergenic
1052160215 9:25248015-25248037 AGAACAAGGCTTCCACAGTGTGG - Intergenic
1053532725 9:38898075-38898097 AGACCAAAGCTTCCACAGTGTGG + Intergenic
1054204950 9:62122504-62122526 AGACCAAAGCTTCCACAGTGTGG + Intergenic
1054633409 9:67465866-67465888 AGACCAAAGCTTCCACAGTGTGG - Intergenic
1054765000 9:69035885-69035907 AGGCCACGGCGGCCGCAGAGTGG - Exonic
1054909196 9:70438475-70438497 AGCCCAATGCTGACACAGCGGGG - Intergenic
1055465507 9:76561541-76561563 AGCCCTGGGATTCCACAGAGAGG - Intergenic
1058403297 9:104641721-104641743 AGAACAAAGCTTCCACAGAGCGG - Intergenic
1060277087 9:122190697-122190719 AGGCAAAGCCTGCCACAGGGCGG - Intronic
1060938132 9:127527623-127527645 AGCCCAAGGCTGGGATGGAGAGG - Intronic
1060953016 9:127616836-127616858 AGACCAATGCTGGCACAAAGTGG + Intronic
1062339477 9:136087575-136087597 AGCCCAAGGCAGACCCAGAGAGG - Intronic
1203773548 EBV:61061-61083 AGCGCAGGGCGGCCAGAGAGCGG + Intergenic
1187484524 X:19689889-19689911 AGTCTAATGATGCCACAGAGTGG + Intronic
1189900599 X:45702203-45702225 AGAACAAAGCTTCCACAGAGTGG + Intergenic
1190491509 X:50987601-50987623 ACCCAAAGACTGGCACAGAGTGG + Intergenic
1190949830 X:55132587-55132609 TGCCCAAGATTTCCACAGAGTGG + Intronic
1193870832 X:86795994-86796016 AGAACAAAGCTGCCACAGCGTGG + Intronic
1201931267 Y:19352038-19352060 AGAGCAAAGCTTCCACAGAGAGG - Intergenic
1202090554 Y:21183916-21183938 AGAACAAAGCTTCCACAGAGTGG - Intergenic
1202109986 Y:21408215-21408237 AGAACAAAGCTGCCACAGTGTGG - Intergenic
1202272452 Y:23084866-23084888 AGAACAAAGCTTCCACAGAGTGG + Intergenic
1202293574 Y:23335816-23335838 AGAACAAAGCTTCCACAGAGTGG - Intergenic
1202425449 Y:24718610-24718632 AGAACAAAGCTTCCACAGAGTGG + Intergenic
1202445340 Y:24951475-24951497 AGAACAAAGCTTCCACAGAGTGG - Intergenic