ID: 1083588517

View in Genome Browser
Species Human (GRCh38)
Location 11:63877995-63878017
Sequence AACCGGATCCTGTTACTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 46}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083588517_1083588523 28 Left 1083588517 11:63877995-63878017 CCACTTAGTAACAGGATCCGGTT 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1083588523 11:63878046-63878068 AGTGGCAAGCCCAGTAAGGCAGG 0: 1
1: 0
2: 1
3: 8
4: 142
1083588517_1083588522 24 Left 1083588517 11:63877995-63878017 CCACTTAGTAACAGGATCCGGTT 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1083588522 11:63878042-63878064 CAGCAGTGGCAAGCCCAGTAAGG 0: 1
1: 0
2: 1
3: 19
4: 416
1083588517_1083588521 10 Left 1083588517 11:63877995-63878017 CCACTTAGTAACAGGATCCGGTT 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1083588521 11:63878028-63878050 GGTTGAGACTGCAGCAGCAGTGG 0: 1
1: 0
2: 3
3: 24
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083588517 Original CRISPR AACCGGATCCTGTTACTAAG TGG (reversed) Intronic
903900349 1:26640087-26640109 ATACGCATCCTGTTACTAAGAGG + Intergenic
903901320 1:26647951-26647973 ATACGCATCCTGTTACTAAGAGG - Intergenic
912499044 1:110109878-110109900 AACTGGATGGTGTTACTCAGAGG + Intergenic
915369376 1:155335184-155335206 AACCTCATCCTGTTTCCAAGGGG - Intergenic
919114239 1:193260606-193260628 AACTCCATCCTGTTACTGAGGGG - Intergenic
1070271265 10:74957699-74957721 AACCCGGTCCTCTTACTAACGGG - Intronic
1083378462 11:62244914-62244936 ACCAGCATCCTGTTACTAATGGG + Intergenic
1083588517 11:63877995-63878017 AACCGGATCCTGTTACTAAGTGG - Intronic
1089568709 11:119387892-119387914 AAGTGGGTCCTGTTATTAAGTGG + Intergenic
1102815711 12:115864222-115864244 ACCTGGATCCTCTTACAAAGGGG + Intergenic
1105271999 13:18885483-18885505 AACTGGCTCCAGTTCCTAAGAGG - Intergenic
1106413344 13:29525968-29525990 AAACGGCTTCTGTTACTCAGTGG + Intronic
1109710841 13:66157515-66157537 ATCCAGACCCTGTTTCTAAGAGG + Intergenic
1115161460 14:30400872-30400894 AACTGGATCCTGTACCTGAGGGG - Intergenic
1117093672 14:52274908-52274930 CACCGGCTCCTGTACCTAAGAGG - Exonic
1202903987 14_GL000194v1_random:58162-58184 AACTGCCTCCTGTCACTAAGGGG + Intergenic
1161330540 19:3684799-3684821 AACCAGATCCTGGTGCTCAGAGG - Intronic
933403281 2:81826073-81826095 AAGCAGCTCCTGCTACTAAGTGG - Intergenic
941063279 2:160872205-160872227 AACTGGAGCCTGTGACGAAGCGG + Intergenic
941718747 2:168790708-168790730 AACTGGATCCTGTTGCTATGGGG + Intronic
944883017 2:204034314-204034336 AACCAGATCCTGTTAACAAAAGG + Intergenic
947626126 2:231620113-231620135 AACTGGCTCCTGATTCTAAGAGG + Intergenic
1176623357 21:9072929-9072951 AACTGCCTCCTGTCACTAAGGGG + Intergenic
1182381591 22:29894231-29894253 AACTGGCTCCAGTTCCTAAGAGG + Intronic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
949626589 3:5874192-5874214 AACTGCATGCTGTTAATAAGGGG + Intergenic
952495220 3:33909934-33909956 AACTGGATCCTGTGTATAAGAGG + Intergenic
966109875 3:176387245-176387267 GAGTGGATCCTGCTACTAAGTGG - Intergenic
969100828 4:4766896-4766918 AACCGGGTCATGTTACAGAGGGG + Intergenic
978489328 4:109294897-109294919 CACCTAATCCTGTTAGTAAGAGG + Intronic
981561164 4:146050019-146050041 AATCGGATGCTGTTGGTAAGGGG - Intergenic
984055835 4:174928381-174928403 AACCGCATCCTGTAACTGACTGG + Intronic
984175372 4:176410834-176410856 AAATGGATCCTGTTGCTGAGAGG - Intergenic
992298331 5:75350337-75350359 AGCCGAATCCTGTAACTCAGAGG + Exonic
994494408 5:100491594-100491616 GACCGTAAACTGTTACTAAGAGG - Intergenic
1013047112 6:106497479-106497501 AAGCAGAGCCTGCTACTAAGGGG - Intergenic
1015190582 6:130467670-130467692 AATCTGATCATGTCACTAAGTGG + Intergenic
1016719297 6:147275478-147275500 AACAGGATCATGTTAGAAAGAGG - Intronic
1020457381 7:8389582-8389604 AAACGCATCCTGTAACTAAGTGG - Intergenic
1023177728 7:37449330-37449352 AACCGGTTCCGGATATTAAGGGG + Intergenic
1027969682 7:85062796-85062818 AACCTTTTCCTGTAACTAAGTGG - Intronic
1035772078 8:2155646-2155668 AACCCGAGCCTGTGACCAAGGGG - Intronic
1049010686 8:139885038-139885060 AACCGGATCCTGGATCAAAGAGG + Intronic
1051282813 9:15459943-15459965 AAGTGGATCCTGTTCCTCAGTGG - Exonic
1052397065 9:27950852-27950874 ACCAAGAACCTGTTACTAAGAGG - Intronic
1059237366 9:112772303-112772325 AACTGCATCCTCTTACAAAGAGG - Intronic
1203746542 Un_GL000218v1:43357-43379 AACTGCCTCCTGTCACTAAGGGG + Intergenic
1203563569 Un_KI270744v1:76123-76145 AACTGCCTCCTGTCACTAAGGGG - Intergenic
1187231275 X:17425728-17425750 AACTGGATCCTGTTACTGCTGGG + Intronic
1187522632 X:20027042-20027064 AATCAGATCCTGCTAATAAGGGG + Intronic
1201159869 Y:11158371-11158393 AACTGCCTCCTGTCACTAAGGGG + Intergenic