ID: 1083588549

View in Genome Browser
Species Human (GRCh38)
Location 11:63878254-63878276
Sequence ATGGAGATGAGGAATGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 747
Summary {0: 1, 1: 0, 2: 2, 3: 65, 4: 679}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083588549 Original CRISPR ATGGAGATGAGGAATGAGGC TGG (reversed) Intronic
900031158 1:373981-374003 ATGGAGAGGAGAAAGGAGACGGG - Intergenic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900274612 1:1816138-1816160 AGGGAGAGGAGGAAGGAAGCAGG - Intronic
900867072 1:5276210-5276232 TTGGAGAGGAGCAGTGAGGCTGG - Intergenic
901280827 1:8033434-8033456 ATGAAGGTAAGGAATGAGGCTGG + Intergenic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
901767478 1:11512506-11512528 ATGGAGATGAGGAATTTGTTGGG - Intronic
902526077 1:17058379-17058401 TTGGAGGTGTGAAATGAGGCGGG - Intergenic
902729189 1:18357426-18357448 ACGGAGATGAGGGATGAGGTGGG + Intronic
902729202 1:18357462-18357484 ATGGAGATGGGGGATGAGGTGGG + Intronic
902774379 1:18665288-18665310 GTGAAGGTGAGCAATGAGGCGGG + Intronic
903169309 1:21542241-21542263 GTGGGCATGAGGAATGAGGCAGG - Intronic
904888195 1:33757714-33757736 ATGGAGATAAGGAATGAAGGAGG - Intronic
905313572 1:37066870-37066892 ATGAAGATGGGGAAGGAGGGAGG - Intergenic
905489441 1:38332098-38332120 AGGGAGAGGAGGAGTGAGGTTGG - Intergenic
905878979 1:41451223-41451245 GTGGAAATGTGGAGTGAGGCTGG - Intergenic
905919517 1:41710163-41710185 GTGCAGATGAGAAATGTGGCAGG - Intronic
906562023 1:46765314-46765336 ATGGAGAGAAGGAATGAAGAGGG - Intronic
906794804 1:48688352-48688374 ATGGAGATGAGGAAGCAGGAAGG - Intronic
906968364 1:50483649-50483671 ATGGAGATGTGGAATCAAGTTGG + Intronic
907052221 1:51337250-51337272 TTGGAGGTGAGCAAGGAGGCTGG - Intronic
907362706 1:53932667-53932689 TTGGAGCTGAGGCATGAGGATGG - Intronic
907370900 1:54002764-54002786 AGGGTGATTAGGAATGAGCCAGG - Intergenic
907737100 1:57124946-57124968 AAGAACATGAGGCATGAGGCCGG - Intronic
907881518 1:58553449-58553471 ATAGACAAGAGGAACGAGGCTGG - Intergenic
907930912 1:58999182-58999204 TTGAAGATGAGGAATTAGGCTGG + Intergenic
908513799 1:64872011-64872033 AGGGTGATGGGGAACGAGGCTGG - Intronic
910087064 1:83416038-83416060 ATGCAGATGAGAGATGAGGAAGG + Intergenic
911515860 1:98867191-98867213 ATGGAGATGAGAAACTAGTCAGG - Intergenic
911854618 1:102860707-102860729 ATAGAAATGAGGAGGGAGGCCGG - Intergenic
912029851 1:105227275-105227297 ATGGAGATGAGGAATTTGTTGGG + Intergenic
912699201 1:111863954-111863976 ATTGAAATGAGGAGTGAGGTGGG + Intronic
913610662 1:120506742-120506764 GGGGAGATGAGGAAAGAGGTGGG + Intergenic
913710076 1:121473896-121473918 ATGGAGATGAGGAATTTGTTAGG - Intergenic
914356928 1:146894498-146894520 ATAGAGATGAGGGAATAGGCAGG + Intergenic
914430117 1:147613076-147613098 ATGGGGCTGAAGAATGGGGCTGG + Exonic
914580528 1:149015497-149015519 GGGGAGATGAGGAAAGAGGTGGG - Intronic
915086251 1:153390895-153390917 CTGGAGGTGGGGAGTGAGGCAGG - Intronic
915289592 1:154874292-154874314 AAGGTGGTGAGGAATGAGCCTGG - Intergenic
915313110 1:155014277-155014299 AAAGAGATGGGGAATGGGGCAGG + Intronic
915740322 1:158113962-158113984 CTGGGGGTGAGGAAGGAGGCAGG + Intergenic
915894252 1:159799087-159799109 ATGGAGAGAGGGAATGAGGGTGG + Intergenic
916060454 1:161094901-161094923 ATGGAGAGGTGGAATAAGGATGG - Intergenic
916477310 1:165182719-165182741 ATGGAGATGAGGAATTTGTTGGG + Intergenic
916613896 1:166420075-166420097 AGAGATAGGAGGAATGAGGCAGG + Intergenic
916615535 1:166435421-166435443 ATGGGGATGAGGTTTGAGGGAGG - Intergenic
916915028 1:169397189-169397211 ATGAACATGAGGAAGGAGGAGGG + Intronic
917173476 1:172203890-172203912 ATGGAAATGAAGAATCAAGCTGG - Intronic
917923531 1:179770536-179770558 CTGGAGATGAAAAATGAGACTGG - Intronic
918128872 1:181607798-181607820 GTGGAGATTAGGAATGAGGCTGG + Intronic
918339140 1:183552880-183552902 ATGGAGATGGGGCAGGAGGGTGG - Intronic
919209164 1:194456520-194456542 ATGGAGATGAGGAACTTGACAGG - Intergenic
919242651 1:194935275-194935297 ATGGAGATGAGGAACTAGTTGGG + Intergenic
919839425 1:201598296-201598318 TTGAAGATAAAGAATGAGGCAGG + Intergenic
920057408 1:203202586-203202608 ATGGGAATGAGGAATGAGCAGGG - Intergenic
920344029 1:205294414-205294436 ATGGTGAGGAGGATGGAGGCAGG + Intergenic
920432834 1:205929604-205929626 ATGGAGATTAGACATAAGGCAGG + Intronic
920819024 1:209363062-209363084 ATGCAGCTGATGAATGAGACTGG + Intergenic
921057479 1:211554510-211554532 ATGGAGATGAGCAGAGAGGGAGG - Intergenic
921430791 1:215063448-215063470 ATGGAGATGAGGATGGGGACAGG - Intronic
921496965 1:215853799-215853821 ATGGAGATGAGGAATTTGTTGGG - Intronic
921536240 1:216352094-216352116 CTGGAGTTCAGGAAAGAGGCTGG + Intronic
921747772 1:218756932-218756954 ATGGGGATGTGAAATGAGGATGG + Intergenic
922597420 1:226824582-226824604 CAGGAGATGAGGAATGTGGATGG - Intergenic
923009352 1:230075775-230075797 ATGGGGATTAGGGATGAGGGCGG + Intronic
923423546 1:233844901-233844923 AGGGAGGTCAGGAAAGAGGCAGG - Intergenic
923546027 1:234923825-234923847 CTGGGGATGAGGAATGAGATGGG - Intergenic
923646207 1:235822888-235822910 ATGTGGATGAGAACTGAGGCTGG + Intronic
924247653 1:242100518-242100540 ATGGAGATGAGGAAACAGGACGG - Intronic
1062784899 10:256203-256225 CTGGAGAAGTGGAGTGAGGCAGG - Intergenic
1062902996 10:1159684-1159706 AGGCAGATGAGGGATGACGCAGG + Intergenic
1063149166 10:3321214-3321236 ATGGAGATGGGGACTGATGCAGG + Intergenic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063891776 10:10637512-10637534 CAGGAGATGAGGAAAGAGCCTGG + Intergenic
1064332027 10:14402949-14402971 ATGGAGATGGGGACAGAGGGTGG + Intronic
1066050755 10:31632945-31632967 TTGGAGATCAGGAATGGGGCAGG - Intergenic
1066088067 10:31990470-31990492 ATAAAGATGAGGACTGAGGGTGG - Intergenic
1066693586 10:38057926-38057948 ATGAAGAGGAGGGTTGAGGCTGG + Exonic
1066999219 10:42591118-42591140 ATGAAGAGGAGGGTTGAGGCTGG - Exonic
1067218682 10:44325417-44325439 CTGGAGAAGAGGAGTGAGGTAGG - Intergenic
1067229720 10:44397707-44397729 ATGCAGATGAGGCCTGGGGCAGG + Intergenic
1067313871 10:45142539-45142561 AGGGAGATGAGAATGGAGGCAGG - Intergenic
1068011368 10:51455676-51455698 ATGGAGATGAGGAACGTGTTGGG - Intronic
1069040727 10:63693258-63693280 ATGGAGATGAGGAACTTGTCGGG + Intergenic
1069559701 10:69420752-69420774 TTAGAGAAGAGGAGTGAGGCTGG + Intergenic
1069846366 10:71374600-71374622 ATGGAGATGGGGACAGGGGCAGG - Intergenic
1070452612 10:76577283-76577305 ATCCACAGGAGGAATGAGGCTGG + Intergenic
1070552470 10:77501601-77501623 AGGGGGAGGAGGAATCAGGCTGG - Intronic
1070583402 10:77742127-77742149 AGGTAGCTGAGGAAAGAGGCTGG + Intergenic
1070736869 10:78869055-78869077 ATGGAGAGGAGGAAGAATGCAGG - Intergenic
1071187047 10:83058199-83058221 ATGTAGGTGAAGAATCAGGCAGG - Intergenic
1071990224 10:91094064-91094086 ATGGAGATGAGGAATTAACTGGG - Intergenic
1072312109 10:94166534-94166556 ATGGAGTTGAAGAGTTAGGCAGG - Intronic
1073048671 10:100654421-100654443 AGGGAGAGGAGGAAGGAGGGAGG - Intergenic
1074105060 10:110383155-110383177 CTGGAGATGGGGAATGTGTCAGG + Intergenic
1074922629 10:118032570-118032592 ATGGAGATCAGGAATTGTGCTGG - Intronic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1076862384 10:133144794-133144816 ATGGAGCTGTGGATGGAGGCTGG - Intergenic
1077088608 11:767429-767451 ACGCAGCTGAGGAATGACGCAGG + Exonic
1077246792 11:1543656-1543678 ATGCAGATGAGGCCTGAGGCTGG + Intergenic
1078323419 11:10357870-10357892 ATGGGGGTGAGGAACCAGGCTGG - Intronic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1078955234 11:16186733-16186755 CTGGAGATGTGGAATGTGCCAGG - Intronic
1079826888 11:25207182-25207204 ATGGAGATGAGGAATTTGTTGGG + Intergenic
1080232596 11:30034733-30034755 ATGGAGATGAGGAATTTGTTGGG - Intergenic
1081224387 11:40502113-40502135 ATGGAGATGAGGAACTAGTTGGG - Intronic
1081746153 11:45473809-45473831 ATGGAGTGGAGGAAAGGGGCAGG + Intergenic
1082209743 11:49484276-49484298 CTGGAGATCAGGTAGGAGGCAGG - Intergenic
1082996829 11:59261842-59261864 TTGGAGATGAGGTGTGAGGCCGG + Intergenic
1083225672 11:61282969-61282991 ATGGAGATGAGGGAGGAAGAGGG - Intronic
1083254427 11:61487427-61487449 GTGGAGAAGAGGGATGAGGGAGG + Intronic
1083588549 11:63878254-63878276 ATGGAGATGAGGAATGAGGCTGG - Intronic
1084837966 11:71818445-71818467 ATGGAGATGAGATATCAGGCAGG + Intergenic
1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG + Intergenic
1086207306 11:84274925-84274947 ATGGAGAAGAAGCATGTGGCTGG - Intronic
1086213896 11:84353944-84353966 ATGGAGGAGAGGAATGAGAGTGG - Intronic
1086482531 11:87258358-87258380 ATGTATAAGAGGAAAGAGGCTGG - Intronic
1086495706 11:87402533-87402555 ATGGGGATCAGGAATCAGGGAGG + Intergenic
1086604463 11:88679897-88679919 AAGAAGATGAAGAATGAGGAAGG - Intronic
1086980771 11:93195890-93195912 AGGGAAATCAGGAATGAGGGTGG - Intronic
1087043061 11:93820401-93820423 ATGGAGTTGAGGACTGTGGATGG - Exonic
1087200689 11:95341567-95341589 AGGAAGATGAGGAATGAGTCAGG - Intergenic
1087765365 11:102146317-102146339 ATGCAGATGAGGCTAGAGGCCGG - Intronic
1087901754 11:103649240-103649262 TTGGAGATGTGCAATGTGGCTGG - Intergenic
1088377743 11:109160391-109160413 ATGGAGATGAGGAATTTGTTGGG - Intergenic
1089339609 11:117748635-117748657 TTGGAGATGAGGATTAAGGAGGG + Intronic
1090487380 11:127126027-127126049 ATGGAGATTTAGAAGGAGGCTGG - Intergenic
1090661629 11:128886392-128886414 AAGGAGAAGAGGAATGAAACTGG - Intergenic
1090998842 11:131891360-131891382 ATCGAGATGAGGTATAAGACAGG + Intronic
1091647079 12:2282064-2282086 AGGAAGATAAGGAATGAGGGAGG - Intronic
1091835651 12:3583818-3583840 GGGGTGGTGAGGAATGAGGCTGG - Intronic
1092082862 12:5732508-5732530 GTGGCGATGAGGTATGAAGCTGG - Exonic
1092400739 12:8175628-8175650 ATGGAGATGAGATATCAGGCAGG - Intronic
1092593585 12:9975379-9975401 ATGGAGATGAGGAATTTGTTGGG + Intronic
1093822857 12:23643138-23643160 ATGGGGATGGAGAGTGAGGCAGG + Intronic
1095954547 12:47798685-47798707 AAGGAGTTGAGGACTGAGACTGG + Intronic
1096007045 12:48182172-48182194 TTGGTGATGAAGAGTGAGGCTGG - Intergenic
1096111037 12:49029360-49029382 ATGGGGATGAGGAACAAGGGTGG - Intronic
1096824310 12:54263062-54263084 ATTGAGATGAGAAAAGAGGCTGG + Intronic
1097102207 12:56597777-56597799 AAGGAGGTGGGGAAGGAGGCTGG + Exonic
1097180057 12:57166697-57166719 CTGGAGAGGAGGAACAAGGCAGG + Intronic
1097404917 12:59177532-59177554 ATGGAGATGAGGAACTTGGTTGG - Intergenic
1099635114 12:85203587-85203609 ATGGAGATGAGGAATTTGTTGGG + Intronic
1099672980 12:85718295-85718317 ATGGAGATGAGGAATTTGTTGGG - Intergenic
1100708647 12:97229357-97229379 AATGAGATGAGCAATGAGGGGGG - Intergenic
1101008670 12:100427500-100427522 AGGAAGATGAGGACTGAGGATGG + Intergenic
1101013226 12:100472737-100472759 GGGCAGATGAGGAATGGGGCTGG + Intergenic
1101714845 12:107301749-107301771 GTGGAGATGGGGCATGAGGTAGG - Intergenic
1101988287 12:109464246-109464268 ATTCTGATCAGGAATGAGGCAGG - Intronic
1102348973 12:112178499-112178521 ATGGAGCTGAGGACTGAGAAAGG + Intronic
1102633363 12:114301211-114301233 AAGGAGATCTGGAATGGGGCAGG + Intergenic
1102788169 12:115620886-115620908 GTGGTTATGAGGAATGTGGCTGG + Intergenic
1102834308 12:116039853-116039875 ATGGAACTGAGGAAAGAGGTCGG + Intronic
1103743186 12:123105124-123105146 AAGGAGGTGAGGAGTGAGCCAGG - Intronic
1103894425 12:124263703-124263725 AAGGAGATGAAGAATATGGCAGG - Intronic
1104097040 12:125567402-125567424 AAGGAGATGAGGAAGGAGAAAGG - Intronic
1104293726 12:127492935-127492957 ATAGTCATGAGGAATGAGTCTGG - Intergenic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1104510269 12:129371372-129371394 ATGGTGATGATGAATGATGATGG + Intronic
1104676012 12:130713040-130713062 AGGGAGAGGAGGAATGAGGGAGG + Intronic
1104731096 12:131105737-131105759 ACGGAGCTGAGGACAGAGGCAGG - Exonic
1104808136 12:131602580-131602602 AAGGAGATGAGGAATTTGTCGGG - Intergenic
1104930131 12:132334356-132334378 GTGGAGTTCAGGAATGAGGGTGG + Intergenic
1105609523 13:21955767-21955789 ATGGAGATGAGGCATTTGCCGGG - Intergenic
1105910791 13:24864188-24864210 AGGGAGATGAGTGCTGAGGCAGG + Intronic
1105965500 13:25380204-25380226 AGGGAGATGAGAGATGAGGGAGG + Intronic
1106145799 13:27048917-27048939 TTGGAGGTGGAGAATGAGGCGGG - Intergenic
1106158930 13:27183482-27183504 ATAGAGGTGAGGCAGGAGGCTGG - Intergenic
1106168292 13:27268546-27268568 CTGCAGATAAGAAATGAGGCCGG + Intergenic
1106375548 13:29183341-29183363 ATGGAGATGAGGAAAACAGCAGG + Intronic
1106771207 13:32962258-32962280 ATGGAGATCAGGAAAGAAGGAGG + Intergenic
1106928923 13:34642322-34642344 TTGGAGCTGAGGATTGAGGTTGG + Intergenic
1107057998 13:36127713-36127735 ATGGAGATCAGGAAGAAAGCAGG - Intronic
1107252523 13:38381054-38381076 ATCGGGATGGAGAATGAGGCTGG + Intergenic
1107481027 13:40786458-40786480 ATGGAGAGGAGAAATGTGGAAGG + Intergenic
1107571442 13:41663306-41663328 ATGGAAAAGAGGAATGAGGGTGG - Intronic
1108003777 13:45927589-45927611 ATGGTGATTGGGAATGGGGCTGG - Intergenic
1108033925 13:46267340-46267362 ATGGAGACCAGGAATGGAGCAGG + Intronic
1108306162 13:49136016-49136038 TTGTAGGTGAGGAATGAGACTGG - Intronic
1108443209 13:50477527-50477549 ATGGAAATGAGGAAAGGGGAAGG + Intronic
1109276252 13:60307137-60307159 ATGGAGATGAGGAACTTGTCGGG - Intergenic
1109294591 13:60514127-60514149 ATGGAGATGAGGAATTTGTTGGG + Intronic
1109384705 13:61611163-61611185 AAGGAAAAGAGGAAGGAGGCAGG - Intergenic
1109481684 13:62963758-62963780 GTGGAGATGAGGAATGTGTTGGG + Intergenic
1109953981 13:69541340-69541362 ATGGAGGTGAGGAATAGGGATGG - Intergenic
1110411932 13:75214294-75214316 AGAGGGATGAGGAATGAGGAGGG - Intergenic
1111066928 13:83106543-83106565 ATGGAGATGAGGAATTTGTTGGG + Intergenic
1112441223 13:99426387-99426409 AGGGAGTGGAGGAATGAGGGGGG - Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113525730 13:110973772-110973794 ATGGAGTTGGGGAAAGAGGGTGG + Intergenic
1113905389 13:113817202-113817224 CTGGAGAGGAGGAAGGAGGTTGG - Intergenic
1114492189 14:23109999-23110021 ATGAAGATGAGGAAGGAGGAAGG + Intergenic
1114774431 14:25465273-25465295 TGGGAGCTGAGGAATCAGGCAGG + Intergenic
1114936701 14:27548156-27548178 ATGGAGATGAGGAATTTGTTGGG + Intergenic
1115364145 14:32537468-32537490 ATGGAGATCAGAGATGAGGAAGG + Intronic
1115609281 14:35035990-35036012 ATGGAGATGAGGAATTTGTTGGG - Intergenic
1115929680 14:38477418-38477440 ATGGAGATGAGGAACTTGTCTGG + Intergenic
1116079800 14:40157239-40157261 ATGGAGATGAGGAATTTGTTGGG - Intergenic
1116241299 14:42346557-42346579 TTGGAGAGGAGGCATGGGGCTGG + Intergenic
1116275157 14:42823778-42823800 ATGGAGATGAGGAACTTGTCTGG + Intergenic
1116651641 14:47601195-47601217 ATAGAGATGAGGAGTGAGACAGG + Intronic
1116675367 14:47899981-47900003 ATGGAGAAGCGGAAAAAGGCGGG + Intergenic
1116866611 14:50036560-50036582 AAGGAGGTGATGAAGGAGGCTGG + Intergenic
1117799281 14:59426877-59426899 ATTGAAATGAGGAAAGAGGGTGG - Intergenic
1118249661 14:64147295-64147317 AAGGAAATGAGGGAGGAGGCTGG - Intronic
1118260208 14:64239271-64239293 ATGCTGATGAGGAAAGATGCGGG - Intronic
1118297909 14:64587318-64587340 GTGAAGATGAGGAATCAGGAGGG + Exonic
1118334971 14:64845454-64845476 ATGGAGATGAGGAGACTGGCAGG - Intronic
1119201478 14:72756027-72756049 ATGGAGGTGGGGAAGGAGGATGG + Intronic
1119450221 14:74702883-74702905 ATGGAGATGAGGAATTTGTTGGG - Intronic
1119523149 14:75301272-75301294 GTGGAGATGGTAAATGAGGCTGG + Intergenic
1119887694 14:78157171-78157193 ATGGAGAGGAGGAAGTAGGAGGG + Intergenic
1122236315 14:100332522-100332544 TTGGGGATGAGGCATGAGGCCGG - Intergenic
1122685800 14:103505593-103505615 GTTGAGATGCGGAATGTGGCTGG + Intergenic
1122801273 14:104230824-104230846 ATGGAGATGAGGCCTGAGGAGGG + Intergenic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1128233639 15:66052472-66052494 ATGTGGATCAGGATTGAGGCTGG - Intronic
1128532381 15:68463336-68463358 GAGGAGATGAGGGATGAGGAAGG + Intergenic
1128568240 15:68715177-68715199 ATGGAGTTGAGGAAGGTGGCAGG - Intronic
1129039098 15:72670476-72670498 ATGGGGCAGAGGAAGGAGGCGGG + Intergenic
1129399610 15:75274326-75274348 ATGGGGCAGAGGAAGGAGGCGGG + Intronic
1129675011 15:77627817-77627839 ATGGATATGAGCAATCAGGGAGG - Intronic
1130197314 15:81792711-81792733 ATGGATTTGAGAAATGAGGAGGG + Intergenic
1130927583 15:88396940-88396962 ATGCAGCTGGGGACTGAGGCAGG - Intergenic
1131796236 15:96019566-96019588 ATGCAGTAGAGGATTGAGGCAGG + Intergenic
1132121854 15:99183168-99183190 ATGGAGATGAGGAATTTGCTGGG + Intronic
1132345543 15:101106386-101106408 AGGGAGAGAAAGAATGAGGCCGG + Intergenic
1132840437 16:1976180-1976202 AGGGAGTTGAGGAGAGAGGCTGG - Intronic
1133515751 16:6507136-6507158 GTGGAGGTGAGGAACGATGCTGG - Intronic
1134390988 16:13819839-13819861 AAGGCCATGAGGGATGAGGCTGG - Intergenic
1134416150 16:14045042-14045064 ATGGTGACGAGAAATGAGACAGG - Intergenic
1134460168 16:14423528-14423550 CCAGAGCTGAGGAATGAGGCTGG - Intergenic
1134849397 16:17468680-17468702 ATGAAGAGAAGGAAGGAGGCAGG - Intronic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135008963 16:18856059-18856081 ATAAAGATGAGGAAGAAGGCAGG - Intronic
1135587208 16:23680032-23680054 ATGGGGAGGTGGATTGAGGCCGG - Intronic
1135896971 16:26415106-26415128 ATGGAGCTCAGGAAAGAAGCTGG - Intergenic
1136005052 16:27323758-27323780 AGGGAGATGAGGCAGGAGGATGG - Intronic
1136291122 16:29272034-29272056 CTGGAGATGAGCCCTGAGGCTGG + Intergenic
1136698950 16:32115558-32115580 ATGGAGATGGGGTAGAAGGCCGG - Intergenic
1136768658 16:32812270-32812292 ATGGAGATGGGGTAGAAGGCTGG + Intergenic
1136799457 16:33058858-33058880 ATGGAGATGGGGTAGAAGGCCGG - Intergenic
1137447157 16:48538966-48538988 AAGGAGACGAGGACTCAGGCTGG + Exonic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137633859 16:49968554-49968576 AGGTGGATGAGGACTGAGGCAGG - Intergenic
1137688341 16:50402398-50402420 CTGGAGGTGAGAGATGAGGCTGG - Intergenic
1137960561 16:52877946-52877968 ATAGAAATGAGGGATGAGGGTGG - Intergenic
1138013312 16:53404852-53404874 ATTAAGAAGAGAAATGAGGCCGG - Intergenic
1138420271 16:56894537-56894559 AAGGAGATAGGGAATGAGGAGGG - Exonic
1138623660 16:58232002-58232024 ATGGTTATGAGGAATGAGGTTGG + Intronic
1139113483 16:63920357-63920379 ATGGAGATGAGGAACGTGTTGGG - Intergenic
1139480751 16:67229292-67229314 TGGGTGATGAGGGATGAGGCAGG + Intergenic
1140171440 16:72608986-72609008 AACGAGATGAGGCAAGAGGCAGG + Intergenic
1141037901 16:80644233-80644255 ATGGAGATGAGGAATTTGTTGGG - Intronic
1141792753 16:86247979-86248001 ATGGAGATGGGAAAGGAGCCGGG + Intergenic
1141813009 16:86388775-86388797 ATGGAGATGATGATAGAGGGAGG - Intergenic
1141854047 16:86669009-86669031 CTGAAGATGAGGGATGATGCAGG + Intergenic
1142096986 16:88245495-88245517 CTGGAGATGAGCCCTGAGGCTGG + Intergenic
1203071075 16_KI270728v1_random:1074378-1074400 ATGGAGATGGGGTAGAAGGCCGG + Intergenic
1143011187 17:3867127-3867149 ATGGCGATGAGGTGTGAAGCAGG + Intronic
1143210932 17:5186857-5186879 ATGGAGATGAGGAACTTGTCGGG - Intronic
1143476383 17:7205845-7205867 ATGGGGATGGGGATTGAGGATGG - Intronic
1143627780 17:8121171-8121193 ATGGAGAGCAGGACTGAGGGTGG + Exonic
1144445730 17:15326356-15326378 ATGAAGCTGAGAAATGAGGAGGG + Intronic
1145357117 17:22169020-22169042 GTGGAGATGAGGAATGTGTTGGG - Intergenic
1145399477 17:22519641-22519663 ATGGAGATGTTGGATGGGGCGGG - Intergenic
1145753579 17:27373472-27373494 ATGGAGATGAGGAACTTGGTGGG + Intergenic
1145992992 17:29090328-29090350 ATACAGATGGGAAATGAGGCAGG + Intronic
1145999956 17:29125102-29125124 CTGGAGATAAGGCAAGAGGCTGG - Intronic
1146484474 17:33231853-33231875 ATTGAGATGAGCAATGGGGAGGG + Intronic
1146505215 17:33399091-33399113 ATAGAGATGAGCAAAGAGGAAGG + Intronic
1146886276 17:36473089-36473111 ATGGAGGGCAGGAATGAGACTGG + Intergenic
1147327453 17:39676304-39676326 AAGGAGAAGAGGAAGGCGGCAGG + Intronic
1147938183 17:44025621-44025643 AAGGAAGTGAGGAAAGAGGCTGG - Intergenic
1148203844 17:45767374-45767396 GAGGAGATGAGGCAGGAGGCTGG + Intergenic
1148221297 17:45864204-45864226 TAGGAGATGAGGAGTGGGGCTGG + Intergenic
1148756761 17:49977148-49977170 AGGCAGACGAGGAATGAGGCTGG + Intergenic
1150118560 17:62578232-62578254 ATGGAGAGGAGGGAGGAGGAGGG + Intronic
1150629453 17:66868875-66868897 ATGGAGATGAGAGAGGAGACAGG + Intronic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1151474263 17:74336766-74336788 CTGGAGATGAGGAATCAGTTGGG - Intronic
1151948048 17:77330108-77330130 AAGGAGAGGAGGCAGGAGGCAGG - Intronic
1152948495 17:83211732-83211754 ATGGAGAGGAGAAAGGAGACGGG + Intergenic
1153828349 18:8897788-8897810 ATGGAGGTCAGGGCTGAGGCTGG + Intergenic
1154031516 18:10757407-10757429 ATGAAGATGAGGAAGAAGGCTGG + Intronic
1154073469 18:11176946-11176968 CAGGAGAGGAGGAAGGAGGCAGG - Intergenic
1154146908 18:11874189-11874211 ATGGAGATGACGCATGCTGCTGG - Intronic
1154261935 18:12842633-12842655 AGGGACATGAAGAATGTGGCTGG + Intronic
1154341954 18:13510858-13510880 ATGGAGAGGATTAATGTGGCTGG + Intronic
1154366484 18:13714440-13714462 AGGGTAATGAGAAATGAGGCTGG + Intronic
1155544840 18:26904260-26904282 ATGGAGATGAGGAATTCGTTGGG - Intergenic
1155742957 18:29313176-29313198 TTGGAGAGTAGAAATGAGGCAGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156229690 18:35141233-35141255 AAGAGGAAGAGGAATGAGGCAGG - Exonic
1156391383 18:36653595-36653617 ATGGAGATGAGGGCAGAGGGAGG + Intronic
1156940888 18:42766322-42766344 ATGGAGATGAGGAATTTGTTGGG + Intronic
1157231106 18:45916860-45916882 ATGGAGTTGGGGAGTGAGGAGGG - Intronic
1157522011 18:48351982-48352004 ATGGAGGTGAGGAAGGGGGCTGG - Intronic
1159030274 18:63223609-63223631 GCTGAGATGAGGAATGAGACTGG - Intronic
1160016090 18:75141797-75141819 ATGGAGCGGAGGACTGAAGCGGG - Intergenic
1160355175 18:78221632-78221654 ATCCAGATGAGGAAGGAGGGAGG - Intergenic
1160453438 18:78980124-78980146 ATGGGGCTGAGCAATTAGGCTGG - Intergenic
1160527339 18:79545404-79545426 GAGAGGATGAGGAATGAGGCTGG + Intergenic
1160809426 19:1007061-1007083 ATGTTGATGGGGAAGGAGGCTGG + Intronic
1160820986 19:1057940-1057962 ACGGAGAAGAAGAAGGAGGCTGG - Exonic
1161500814 19:4614436-4614458 ATGGAGATGAGGACAGGGGGTGG + Intergenic
1161502257 19:4622834-4622856 ATGGAGACGAGGCAGGAGGTGGG + Intergenic
1161537757 19:4830824-4830846 AAGGAGCTGAGGGAGGAGGCTGG + Intronic
1162022282 19:7873391-7873413 GCGGAGCTGAGGAAGGAGGCTGG + Intronic
1163125734 19:15243292-15243314 ATGGAGGTGAGGGGTGGGGCAGG + Exonic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1163646783 19:18494060-18494082 GTGGAGAGGAGGAGTGAGGTTGG - Intronic
1163676092 19:18656026-18656048 TTCTAGATGAGGAAGGAGGCTGG - Intronic
1164011914 19:21210933-21210955 ATGGAAATGATGAAGGAGTCTGG + Intergenic
1164038528 19:21474408-21474430 ATGGCCATTAGGAATGGGGCGGG - Intronic
1164244267 19:23416732-23416754 ATGGCCATTAGGAATGGGGCAGG + Intergenic
1164414148 19:28032241-28032263 ATGGAGATGAGGAATTTGTCGGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166174875 19:41060540-41060562 ATGAAGATGAGAAATAAGGTTGG + Intergenic
1166561793 19:43737551-43737573 GTGGGGAGGAGGAATGAGGCAGG - Intronic
1167225375 19:48235577-48235599 ATAGAGATGAGGTCTCAGGCTGG + Intronic
1167462274 19:49631900-49631922 TTGCAGAGGAGGAATGAGCCCGG - Intergenic
1167527690 19:49995139-49995161 AGGAAGAAGAGGAAAGAGGCCGG + Intronic
1167891267 19:52541536-52541558 ATAGAGGTGAGGAATAAGACCGG + Intronic
1167916576 19:52744737-52744759 ATAGAGGTGAGGAATAAGACTGG - Intergenic
1167920738 19:52781300-52781322 ATAGAGGTGAGGAATAAGACCGG - Intronic
1168113802 19:54209602-54209624 AGGGAGATGGGCAATGAGGGTGG + Intronic
1168280800 19:55304585-55304607 CTGGAGATGAGGCTCGAGGCGGG + Exonic
1168517112 19:57017662-57017684 AGGGAGATGGGGGATGAGGAGGG - Intergenic
1168517152 19:57017763-57017785 AGGGAGATGGGGGATGAGGAGGG - Intergenic
925361698 2:3284478-3284500 ATGGAGATGGGGCGGGAGGCCGG + Intronic
925733962 2:6944175-6944197 TTGGAGATGCGGGAGGAGGCCGG + Intronic
926119899 2:10236215-10236237 ATGGAGAAGAGGGAAGAGGGTGG - Intergenic
926982429 2:18585742-18585764 ATAGAGATGATGAATTAGGTAGG + Intronic
928014686 2:27644887-27644909 TTAGAGATGAGGTCTGAGGCTGG - Intronic
929083386 2:38144274-38144296 ATGTATATGGGGAATGAGGAAGG - Intergenic
929733861 2:44524566-44524588 ATGAAGATGAGGGAAGAGGAAGG - Intronic
929747942 2:44678530-44678552 ATGCACTTCAGGAATGAGGCAGG - Intronic
929769841 2:44882669-44882691 AGGAAGATGAGGAAGGGGGCAGG - Intergenic
930262777 2:49166649-49166671 AAGGAGGTGAGGCATGAGGAGGG + Intergenic
930725334 2:54676146-54676168 ATGGAGATGAGGCAGGGGGAAGG - Intergenic
930961545 2:57267779-57267801 ATGGAGATGAGGAATTTGTTGGG - Intergenic
931244168 2:60478890-60478912 AGAGAGATGAGGACTGAGGCTGG - Intronic
931838324 2:66123831-66123853 GAGGGGATGAGGAATGAGGAGGG - Intergenic
932627791 2:73312717-73312739 ATGAAGGTGAGAAATGGGGCAGG - Intergenic
932756525 2:74413674-74413696 GTGGAGACTAGCAATGAGGCAGG + Intergenic
933230287 2:79799203-79799225 AAGAAGAGGGGGAATGAGGCTGG - Intronic
933335377 2:80951226-80951248 ATGGAGATGAAAAATGAAGCTGG - Intergenic
933702236 2:85263719-85263741 TTGGAGATGAGGAGGAAGGCTGG + Intronic
934110640 2:88739053-88739075 GTAGAGATGAGTTATGAGGCTGG + Intronic
934156110 2:89202735-89202757 ATGGAGATGAGCCATTAGGCAGG + Intergenic
934159479 2:89234830-89234852 AAGGAGATGAGGGAGGAGGAGGG - Intergenic
934207798 2:89947601-89947623 AAGGAGATGAGGGAGGAGGAGGG + Intergenic
934211206 2:89980028-89980050 ATGGAGATGAGCCATAAGGCAGG - Intergenic
934475714 2:94592081-94592103 GTGGTGATGAGGAAGGAGCCAGG + Intronic
934777782 2:96950036-96950058 ATGGAGACGGGGAAAGAGGCAGG + Intronic
935867522 2:107406638-107406660 ATGCAGAGTAGAAATGAGGCTGG - Intergenic
936392308 2:112086722-112086744 ACAGAGCTGAGGAATGAGGGAGG - Intronic
936399058 2:112152087-112152109 AGTGAGAGGATGAATGAGGCAGG + Intronic
936665678 2:114592548-114592570 GTAGAGCTGAGGAATGATGCAGG + Intronic
936683658 2:114803562-114803584 ATGGAGATGAGGAATTTGCTGGG + Intronic
936739129 2:115483607-115483629 ATCGTGATGAGAAGTGAGGCAGG + Intronic
937270407 2:120647505-120647527 AGGGTGATGAGGCATCAGGCTGG - Intergenic
937304144 2:120860805-120860827 ATGGTGATGAGGAAGGAGCTAGG + Intronic
938417347 2:131114729-131114751 ATGGAGATGAGGAACTAGTTGGG - Intronic
938789414 2:134663665-134663687 AGGAAGATGAGGAAGGATGCAGG - Intronic
939155967 2:138524738-138524760 ATGGAGATGAGGAATGTGTTAGG - Intronic
939165750 2:138639630-138639652 ATAGAGATAAGAAATGAGGTAGG + Intergenic
939490503 2:142870479-142870501 AGGAAGGTTAGGAATGAGGCAGG + Intergenic
941932651 2:170957570-170957592 ATGAAGAAAAGGAAGGAGGCTGG - Intronic
942799271 2:179858071-179858093 ATGGAGATGGGAAACGAGTCAGG + Intronic
943214214 2:185009823-185009845 ATGGAGGTGTGGAAAGAGGAAGG - Intergenic
943417705 2:187629837-187629859 ATGGAGATGAGGAATTTGTTGGG + Intergenic
944656154 2:201878427-201878449 ATGGAGGGCAGGAAAGAGGCAGG - Intronic
944678680 2:202055993-202056015 AGGAAGATGAGGAAGGAGCCAGG + Intergenic
945201369 2:207285088-207285110 ATGGAGATGAGAGATAAGGCTGG + Intergenic
945571033 2:211468018-211468040 ATGGAGATAAATAATGTGGCTGG + Intronic
946521267 2:220467567-220467589 GTGGAGATGATGAATGAGCAGGG + Intergenic
946531230 2:220572464-220572486 ATGTTGATGAGAAATGAGGCTGG + Intergenic
947534274 2:230931175-230931197 GTGGAGATGAAGACTGAGCCAGG - Intronic
947848077 2:233261686-233261708 ATGGAGAAAAGGAACAAGGCTGG - Intronic
948102014 2:235382795-235382817 ATGGTGAAGAGGTCTGAGGCGGG - Intergenic
948230997 2:236349220-236349242 ATGGAGCTGAAGAGTGAGGAGGG + Intronic
948249355 2:236513218-236513240 AAGGAGGTGAGGAAGGAGCCTGG - Intergenic
948441382 2:237992626-237992648 AAGGAAATGAGGCATGAGGTAGG + Intronic
948863099 2:240762386-240762408 ATGATGATGGGGAATGGGGCTGG - Intronic
1169405865 20:5320654-5320676 ATGGAGATAACGAATGAAGCAGG + Intergenic
1169549206 20:6684895-6684917 ATGGACATGGGAAATCAGGCTGG + Intergenic
1169580819 20:7021823-7021845 ATGGAGATGAGGAATTTGTCGGG + Intergenic
1169994357 20:11540546-11540568 CTGGAGTTGAGAAATCAGGCTGG + Intergenic
1170368263 20:15620136-15620158 ATGGAGATGGGGGACAAGGCAGG + Intronic
1170638490 20:18130325-18130347 ATGGAGATGAATAGTGATGCTGG + Intergenic
1170644000 20:18180324-18180346 ATGGAGATGAGGAATTTGTTGGG - Intronic
1171144561 20:22770409-22770431 ATAGAGAGTAGGAATGAGTCAGG + Intergenic
1171362485 20:24597728-24597750 AAGGAGGTGTGGAAGGAGGCAGG + Intronic
1172199958 20:33118436-33118458 CTGGAGAAGAGGAGTGAAGCAGG + Intergenic
1172507679 20:35475708-35475730 TTGAAGGTGAAGAATGAGGCAGG - Intronic
1172570170 20:35964084-35964106 GTGGTTATGAGGAAGGAGGCTGG - Intronic
1173161188 20:40653627-40653649 AGGGAAATGAGAAATGAGGCAGG + Intergenic
1173284718 20:41659814-41659836 ATGGAGGTGAGAGATGAGGATGG - Intergenic
1174500472 20:50980708-50980730 CTGGAGATGTGGAGTGAGCCGGG + Intergenic
1175442682 20:59002420-59002442 CAGGAGATGAGGCCTGAGGCAGG - Intronic
1175940869 20:62536971-62536993 TTGGCCATGAGGAATGAGCCCGG + Intergenic
1175956200 20:62610645-62610667 ATGAAGATGAGCAAGAAGGCAGG + Intergenic
1177067862 21:16463459-16463481 ATGGAGATGAGGAATGTGTTGGG + Intergenic
1177742111 21:25167319-25167341 ATGGAGATGAGGAACTTGTCGGG + Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178561376 21:33642448-33642470 AGGGAGATGAGGAGATAGGCGGG + Exonic
1179838694 21:44055840-44055862 AGGGAGAAGAGGACTGAGCCAGG + Exonic
1179915658 21:44476556-44476578 ATGGAGATGAGGATATAGGATGG + Intergenic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1181791236 22:25268447-25268469 AAGGAAAAGAGGAATGAGACAGG + Intergenic
1181869322 22:25885598-25885620 TTAGAGATGAGGCATGAAGCCGG + Intronic
1181885311 22:26017379-26017401 AGGGAGAGGAGGAAGGAGGAGGG - Intronic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182736272 22:32533776-32533798 ATCGAGGTGAGGGATGAAGCAGG - Exonic
1182779167 22:32853707-32853729 AAGGAGAGGAGGAATGAGTTTGG - Intronic
1182951594 22:34381306-34381328 ATGGGGATGAAGAAAGAGGTAGG + Intergenic
1183267361 22:36836928-36836950 GGGGAGATGAGGAGGGAGGCTGG + Intergenic
1183806423 22:40215372-40215394 ATGGCAATGAGAAATGTGGCTGG - Intronic
1184015500 22:41782942-41782964 ATGCAGAGGAGGGAAGAGGCGGG - Intronic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184566834 22:45297097-45297119 AAGGAGATGAGGCATGAGGGTGG + Intergenic
1184909019 22:47513618-47513640 ATGGAGATGAAGGCAGAGGCTGG - Intergenic
949329094 3:2901480-2901502 ATGGAGAAGGTGCATGAGGCAGG - Intronic
949901254 3:8816523-8816545 ATGGAGACGTGGAATGATTCCGG + Intronic
950237255 3:11334187-11334209 ATAGAGATGAGGAATTATTCTGG - Intronic
950630115 3:14276673-14276695 CTGGAGGTGAGGAAGGAGGAAGG + Intergenic
950685086 3:14611268-14611290 ATGGTCATGAGGCAGGAGGCAGG - Intergenic
950694857 3:14690960-14690982 ATGGAGGTGAGGGCTGAGGAAGG - Intronic
951290053 3:20863980-20864002 ATGGAGATGAGGAATTTGTTGGG - Intergenic
951853698 3:27170921-27170943 ATGGAGAGGAGAAATGAGAGAGG - Intronic
952202869 3:31149379-31149401 ATGGAGATGAGGAACTAGTGGGG - Intergenic
952608800 3:35182206-35182228 ATGGAGATGAGGAACTTGTCAGG - Intergenic
953277638 3:41518780-41518802 ATGGAAATGTGGAATCAAGCAGG - Intronic
953550158 3:43895848-43895870 ATGGAGGTGAGGAAGGGGGCTGG - Intergenic
954228735 3:49199847-49199869 CTGGAGTTGAGGAGTGAGACCGG + Intronic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
956290084 3:67651999-67652021 TTGGGGATGGTGAATGAGGCAGG - Intronic
956403414 3:68903901-68903923 ATGGAAAGGAGGAAAGAGGGAGG - Intronic
956621574 3:71226425-71226447 GTGGAGTTGAGCAGTGAGGCTGG - Intronic
956714257 3:72064271-72064293 ATGGAGATGAGGAATTTGTTGGG - Intergenic
956938674 3:74132507-74132529 ATGGAGATGAGGAATTTGTTGGG - Intergenic
957757451 3:84509264-84509286 ATGGAGATGAGGAACTAGTTGGG + Intergenic
957929684 3:86862406-86862428 ATGGAGATGAGGAATTTGCTGGG + Intergenic
958877735 3:99635039-99635061 ATGGAGAGGAGGGATGAGGAGGG - Intergenic
959369061 3:105500275-105500297 AAGGAGATGAGAAAAGAGGAAGG - Intronic
959831515 3:110868730-110868752 TGGGAGATGAGGATTGAGGAGGG + Intergenic
961330335 3:126134574-126134596 ATGGAGATTAGGGTTGGGGCAGG - Intronic
962265658 3:133942659-133942681 AAGGAGATGAGGAAGATGGCCGG + Exonic
962325604 3:134429525-134429547 ATGCAGATTAGACATGAGGCAGG - Intergenic
963386296 3:144598841-144598863 ATGGAGATGAGGAATTTGTTGGG - Intergenic
963764132 3:149316116-149316138 ATGGAGAGGAGAAAAGATGCAGG + Intergenic
964158549 3:153617309-153617331 AAGGAGAAGAGGAAGGAGGCAGG - Intergenic
964159105 3:153624843-153624865 ATGGAGATAAACAATGAGACAGG - Intergenic
966207663 3:177421473-177421495 AGGAAGAAGAGGAATGGGGCAGG + Intergenic
966589044 3:181659834-181659856 ATGGACCTGAGGAATCAGGTAGG - Intergenic
967501517 3:190203423-190203445 ATGGAGATGAGGAATTTGTTGGG + Intergenic
967555696 3:190855325-190855347 GTCGAGATGAGGAGGGAGGCTGG - Exonic
967721551 3:192821387-192821409 ATGAGGTTGAGGAATGAGGTGGG - Intronic
967953356 3:194857938-194857960 AGGGAGAGAAGAAATGAGGCAGG - Intergenic
968518781 4:1026435-1026457 ATGGAGGCGGGGACTGAGGCGGG - Exonic
968693434 4:2008521-2008543 TGGGAGATGAGGATCGAGGCGGG + Intronic
969317608 4:6391334-6391356 AAGCAGATGAGGGAGGAGGCTGG + Intronic
969519554 4:7667954-7667976 AGGGAGGTGTGGCATGAGGCTGG - Intronic
969779382 4:9385950-9385972 ATGGAGATGAGATATCAGGCAGG + Intronic
970899175 4:21138825-21138847 ATGGAAAGGAGTCATGAGGCAGG + Intronic
970978954 4:22074720-22074742 ATGGAGATGAGGAATTTGTTGGG + Intergenic
971443547 4:26717055-26717077 ATGGAGATTGGGAATCAGTCAGG - Intronic
971547935 4:27910771-27910793 AAGAAGCTGAGAAATGAGGCAGG + Intergenic
972186075 4:36529734-36529756 CTGGTGATGATGAATGAGGTTGG + Intergenic
972861021 4:43169285-43169307 ATGGTGAAGAGGAATGGAGCCGG - Intergenic
972947754 4:44278735-44278757 ACGGAGATGAGGTATGGGCCTGG - Intronic
973015814 4:45135561-45135583 ATGGAGATGAGGAATTTGTTGGG - Intergenic
973992075 4:56419089-56419111 CTGGGGATGAGGGATGAGGCAGG + Intronic
974952275 4:68597624-68597646 ATGGAGTTGAGGAATGTGTTGGG + Intronic
976040946 4:80884792-80884814 ATGGGGGTGATGAATGATGCAGG - Intronic
977356472 4:95953106-95953128 ATGGAGATGAGGAACTTGGTGGG - Intergenic
978685362 4:111435840-111435862 TTGGAGAAGAGGAATGTGGCTGG - Intergenic
978948742 4:114530085-114530107 ATGGAGATGAAGAATTAGGTGGG + Intergenic
979960513 4:127015311-127015333 ATTGGGATGAGGAATGAGGAAGG - Intergenic
980202705 4:129676681-129676703 ATGGAGATGAGGAATTTGTTGGG + Intergenic
980394784 4:132197602-132197624 ATGGAAATGAGGAATGGGGCTGG + Intergenic
980641347 4:135584763-135584785 ATGGAGATGAGGAATCTGTTGGG + Intergenic
980868116 4:138577661-138577683 ATGGAGATGAGGAATTTGTTGGG - Intergenic
980882329 4:138724558-138724580 ATAGAGAAGGGGAAAGAGGCAGG - Intergenic
981116396 4:140995652-140995674 ATGGAGATGAGATAGGAGGCGGG - Intronic
981642960 4:146966649-146966671 ATGGAGATGAGGAACTTGTCGGG + Intergenic
982392968 4:154885543-154885565 ATGGAGATGAGGAACGTGTTGGG - Intergenic
983825056 4:172249197-172249219 ATGGAGATGAGGAACTTGTCAGG + Intronic
983847330 4:172536476-172536498 ATGGAGATGAGGAATGTTTTGGG + Intronic
983922089 4:173357110-173357132 GTGGAGATTAGGATTGAGGAAGG + Intergenic
984174810 4:176404051-176404073 ATGGGGCTGAAGAATGGGGCAGG + Intergenic
985962821 5:3315910-3315932 ATGGAGATCAGCAAGGATGCAGG + Intergenic
986105593 5:4656548-4656570 ATGGAGATGAGGAATTAGTTGGG - Intergenic
986633560 5:9798259-9798281 ATGGACATGAGGAATGTTTCTGG + Intergenic
987435164 5:17885113-17885135 ATGGAGATGAGGAACTTGTCGGG + Intergenic
987620886 5:20337561-20337583 ATGGAGATGAGGAATTTGTTGGG - Intronic
988388068 5:30592695-30592717 ATGGAGATGAGGAACTTGGTGGG - Intergenic
988805648 5:34738076-34738098 ATGGAATTGAGGAATGAGATGGG + Intronic
989067879 5:37482026-37482048 ATGGAGATGAGGAATTTGTTGGG - Intronic
989185526 5:38621635-38621657 ATGGAGCTGAGATATGAGGAAGG - Intergenic
989238978 5:39181789-39181811 ATGGAGATGAGAAAAGAGGTTGG - Intronic
989466790 5:41765861-41765883 ATGAAGATGAGGGATGGGGGTGG - Intronic
989514362 5:42324765-42324787 ATGGAGATGAGGAATTTGTTGGG - Intergenic
989709403 5:44378772-44378794 CTGGAATTGAGGAAAGAGGCAGG - Intronic
989966790 5:50474560-50474582 ATGGAGATGAGGAATTTGTTAGG + Intergenic
990143291 5:52730542-52730564 ATGGAGATGAGGAACTTGTCGGG + Intergenic
990748894 5:58990384-58990406 ATGGATATGAAGAAAGAAGCAGG + Intronic
991312878 5:65264277-65264299 ATGGGGCTGAGGAAGGAGGCAGG - Intronic
991946854 5:71906478-71906500 CTGGAGATGGGCAGTGAGGCTGG + Intergenic
991995616 5:72383540-72383562 ATTAAGGTGAGGAATTAGGCAGG - Intergenic
992097122 5:73373170-73373192 ATGGAGATGGGGAATGACAATGG + Intergenic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
992724286 5:79590989-79591011 GTGAAGCTGAGGTATGAGGCAGG + Intergenic
992947120 5:81821966-81821988 AGGGGGATGGGGAATGAAGCAGG + Intergenic
993094535 5:83465970-83465992 AGGGAAGTGAGAAATGAGGCAGG - Intergenic
994283616 5:97937592-97937614 ATGGAGATGAGGAATGTACTGGG + Intergenic
994310275 5:98261313-98261335 ATGAGGATCAGGAATGAGGAGGG + Intergenic
994485802 5:100386352-100386374 ATGGAGATGAGGAATTTGTTGGG + Intergenic
994494231 5:100489300-100489322 ATGGAGATGAGGAATTTGTTGGG - Intergenic
994605204 5:101958437-101958459 CTGGGTATGAGGTATGAGGCAGG - Intergenic
994749698 5:103722328-103722350 ATGGAGATGAGAAATGTGTTGGG - Intergenic
995105629 5:108374704-108374726 AGGGAGGTGAGGAAAGAGGAGGG + Intronic
995322601 5:110853747-110853769 ATGGAGAAGAAGAAGGAGACAGG + Intergenic
996063629 5:119058088-119058110 ATTAAGACGGGGAATGAGGCTGG + Intronic
996347244 5:122500424-122500446 CTGGAAATGAGGCATTAGGCAGG - Intergenic
996711950 5:126552340-126552362 ATGGAAATAAGGAGTCAGGCAGG + Intronic
997766003 5:136503989-136504011 ATGGGGATGAGGCAGGAGGAAGG - Intergenic
997910783 5:137870928-137870950 ATGGAGCTGAGGAAGCTGGCTGG - Exonic
998794640 5:145805196-145805218 ATGGAAATAAGGGATGAGGAGGG - Intronic
999181939 5:149676047-149676069 AGTGAAGTGAGGAATGAGGCTGG + Intergenic
999835705 5:155368602-155368624 AAGGAGATTAGAGATGAGGCAGG - Intergenic
1000564978 5:162835568-162835590 ATGGAGATGAGGAATTTGTTGGG - Intergenic
1001275936 5:170351588-170351610 GTGGAATTGAGGCATGAGGCAGG - Intergenic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001791028 5:174458408-174458430 AAGGAGATGGGGAAAGAGGTGGG - Intergenic
1001791040 5:174458444-174458466 AAGGAGATGGGGAAAGAGGTGGG - Intergenic
1001791089 5:174458576-174458598 AAGGAGATGGGGAAGGAGGTGGG - Intergenic
1001791098 5:174458600-174458622 AAGGAGATGGGGAAGGAGGTGGG - Intergenic
1001791107 5:174458624-174458646 AAGGAGATGGGGAAGGAGGTGGG - Intergenic
1002273191 5:178086389-178086411 CTGGAGATGAGGAGGTAGGCGGG + Intergenic
1002503820 5:179665242-179665264 TTGGAGATGATGGTTGAGGCAGG + Intergenic
1002742662 5:181444887-181444909 ATGGAGAGGAGAAAGGAGACGGG + Intergenic
1003381669 6:5629936-5629958 ATGGAGATGAGGATTAAGTAGGG + Intronic
1003432746 6:6055051-6055073 ATGCAAATGAGGGAGGAGGCAGG - Intergenic
1003550472 6:7098387-7098409 CTGAAGATGTGGAAGGAGGCAGG - Intergenic
1004038131 6:11944435-11944457 GTGGTGATGGGGAATGAGACTGG + Intergenic
1004830926 6:19475948-19475970 ATGGAGATGAGGAATTGGTTGGG - Intergenic
1007250094 6:40489595-40489617 AAGGGGTTGAGGGATGAGGCAGG + Intronic
1007524184 6:42476776-42476798 GTAGAGAAGAAGAATGAGGCTGG - Intergenic
1007623896 6:43231566-43231588 AAGGAAATGAGGAGTGAGCCAGG - Intergenic
1007790601 6:44306182-44306204 GTGGATATGAGGCATGGGGCTGG + Intronic
1008047984 6:46871391-46871413 TGGGAGAGGAGGAATGAGGAAGG + Intronic
1008460381 6:51763201-51763223 ATGGATATGAAAACTGAGGCTGG - Intronic
1009316177 6:62223804-62223826 ATGGAGATGAGGAATTTGTTGGG - Intronic
1009504678 6:64461440-64461462 ATGGAGATGAGCAGTCAGGGAGG + Intronic
1011268206 6:85548160-85548182 CTGGAGATGGGGAATGGGGATGG + Intronic
1011305601 6:85922977-85922999 AAGGAGATGAAGAAGGGGGCGGG - Intergenic
1011511397 6:88104981-88105003 ATGAGGATGAGGAAGTAGGCAGG + Intergenic
1012029141 6:94036465-94036487 ATGGAGATGAGGAATTTGTTGGG + Intergenic
1012055068 6:94395752-94395774 AAGGAGAGGAGGAAGGAGGAGGG + Intergenic
1012700598 6:102452015-102452037 ATGGAGATGAGGAACTTGTCAGG - Intergenic
1013549395 6:111192338-111192360 ATGGAGATGAGGAATTTGTTGGG - Intronic
1014461076 6:121696339-121696361 ATACAGAGGAGGGATGAGGCTGG - Intergenic
1014592962 6:123295019-123295041 CAGGAAATGAGGAAGGAGGCAGG + Intronic
1014691600 6:124570002-124570024 ATGGAGATGAGGAACTAGTTGGG + Intronic
1015239518 6:131007674-131007696 ATGGAGATGAGGAATGTGTTGGG + Intronic
1015619717 6:135118431-135118453 AGAGAGAAGAGGAGTGAGGCAGG - Intergenic
1015969742 6:138731772-138731794 ATGGAGATGAGGAATTTGTTGGG - Intergenic
1016098342 6:140065780-140065802 ATCAAGATGTGTAATGAGGCTGG + Intergenic
1016253133 6:142071320-142071342 ATGGAGATGAGGAACTAGTTGGG + Intronic
1016537545 6:145125748-145125770 ATGGAGATGAGGAATTTGTTGGG + Intergenic
1018373654 6:163191327-163191349 ACTGAGCTGAGGAATGAGACTGG - Intronic
1018395427 6:163374700-163374722 ATAGAGTTGAGGAACTAGGCTGG - Intergenic
1018395853 6:163377632-163377654 CTGGAGATGAGGGATTTGGCAGG - Intergenic
1018683249 6:166282143-166282165 ATGGAGCTGAAGAAAGAGGAGGG + Intergenic
1018986382 6:168640346-168640368 ATGGAGAGGAAGCATGGGGCAGG + Intronic
1019247797 6:170720626-170720648 ATGGAGAGGAGAAAGGAGACGGG + Intergenic
1019637152 7:2081980-2082002 ATGGAGATTAGGAGAGAGGTTGG + Intronic
1019956080 7:4415487-4415509 ATGGAAATGAGGTAGGAGACGGG - Intergenic
1020256306 7:6504540-6504562 AAGGAGAGAGGGAATGAGGCTGG + Intronic
1020558596 7:9700586-9700608 ATGGAGATGAGGAAGGAAAGAGG + Intergenic
1020800922 7:12731201-12731223 GAGGAGACGAGGAATGAGGAGGG - Intergenic
1021285469 7:18776276-18776298 ATGGAGTTGTGGATTGATGCTGG - Intronic
1021598681 7:22342763-22342785 ATGGAGACGAGGAATGTGTTGGG - Intronic
1021826766 7:24561237-24561259 CTGGATGTGAGGAATGAGGAAGG - Intergenic
1022218731 7:28291058-28291080 ATGGAAAGAAGAAATGAGGCTGG - Intergenic
1022596060 7:31714305-31714327 ATGGAGATGAGGAACTAGTTGGG - Intergenic
1023669306 7:42559562-42559584 GTGGAGATGAGGAATTTGTCAGG + Intergenic
1024610309 7:51058722-51058744 ATGGAGAGGCGTGATGAGGCAGG + Intronic
1025057917 7:55779961-55779983 AAGAAGATGAAAAATGAGGCTGG - Intergenic
1026226313 7:68445124-68445146 ATGGAGACAAGGAATTTGGCAGG - Intergenic
1026680224 7:72461027-72461049 ATGGAGAGAAGGAAGGAGGAAGG - Intergenic
1027172061 7:75879372-75879394 ATGGTGATGAGGACCGAGACAGG - Intronic
1027303946 7:76872525-76872547 ATGCAGATGAGAGATGAGGAAGG + Intergenic
1027439101 7:78198698-78198720 AGAGAGATTATGAATGAGGCAGG + Intronic
1027977516 7:85178445-85178467 ATGGAGATGAGAAATGTGTTGGG + Intronic
1028445405 7:90916188-90916210 TTGGAAGTGAAGAATGAGGCTGG + Intronic
1028624611 7:92863701-92863723 ATGGAGATGAGGAAGGGAACTGG - Intergenic
1029423678 7:100484153-100484175 ATGGAGAAGGGGGATGAAGCAGG + Intronic
1029578307 7:101418845-101418867 GTGGAGAGGAGGAAAGAGGAAGG - Intronic
1030851140 7:114487754-114487776 ATGGAGATGAGGAATTTGTTGGG - Intronic
1031158101 7:118134815-118134837 ATGGAGATGAGGAACTTGTCAGG + Intergenic
1031291951 7:119949341-119949363 ATAGTGATGAGGAATGAGATTGG - Intergenic
1031473082 7:122190801-122190823 ATGGAGATGAGGAACTAGTTGGG + Intergenic
1031787911 7:126058271-126058293 ATGGAGATGAGGAATTTGTTGGG + Intergenic
1032450571 7:132026906-132026928 ATGGAAATAAGGAGTGATGCAGG + Intergenic
1032513697 7:132491833-132491855 AAGGAGATGGGGAAGGAGACAGG + Intronic
1032658839 7:133961170-133961192 TTGAAGATGAGGAAGGAGCCAGG + Intronic
1033522514 7:142175518-142175540 AATGAGATGAGGAATGAAGAGGG + Intronic
1033740840 7:144274685-144274707 AAGGGGATGAGGAAAGAGGGGGG - Intergenic
1033753066 7:144374928-144374950 AAGGGGATGAGGAAAGAGGGGGG + Intronic
1033912738 7:146285669-146285691 AGGGAGATGAGGGAAGAGGAGGG - Intronic
1034193181 7:149226307-149226329 ATTGAGATGAGAAATTAGACAGG + Intergenic
1034201729 7:149286977-149286999 ATGGGGATGTGGTATCAGGCGGG + Intronic
1034859298 7:154582248-154582270 CTGGAGATGAGGAATTGTGCTGG + Intronic
1034995095 7:155572021-155572043 ATGGAGGTGAGGAAGGAGAGGGG + Intergenic
1035143293 7:156786132-156786154 AGGGAAAGAAGGAATGAGGCCGG + Intronic
1035230598 7:157463653-157463675 ATGGAGATGAGGATGGGGGGAGG - Intergenic
1035500320 8:87238-87260 ATGGAGAGGAGAAAGGAGACGGG - Intergenic
1035633440 8:1126342-1126364 AGGCAGATGAGGAGGGAGGCAGG + Intergenic
1035633448 8:1126380-1126402 AGGCAGATGAGGAGGGAGGCAGG + Intergenic
1035633456 8:1126418-1126440 AGGCAGATGAGGAGGGAGGCAGG + Intergenic
1035702694 8:1648723-1648745 AGGGAGAGGAGGAAAGAGGCCGG - Intronic
1036187548 8:6637297-6637319 ATAGAGAGGAGGAGTGAGGTAGG + Intronic
1036276816 8:7359910-7359932 ATGGAGATGAGATATCAGGCAGG + Intronic
1036589277 8:10153263-10153285 ATGTGGATGAGGCATGAGGTGGG + Intronic
1036612983 8:10366000-10366022 AAGGAGCAGGGGAATGAGGCAGG - Intronic
1036813605 8:11885175-11885197 AAGGAGCTGAGGGAGGAGGCAGG - Intergenic
1037811568 8:22089677-22089699 GTGGAGCGGAGGAAGGAGGCAGG - Intronic
1039104028 8:33970915-33970937 ATGGACAGGAGGCATGAGGGTGG - Intergenic
1039630451 8:39106681-39106703 ATGGAGACCAGGTGTGAGGCTGG + Intergenic
1039657355 8:39424079-39424101 ATGGAGATGAGAAATGTGTTGGG - Intergenic
1039727788 8:40238490-40238512 AGGGAGAGAAGGAATGAGGGAGG - Intergenic
1041810332 8:61901890-61901912 ATGGAGACAAGGATAGAGGCCGG - Intergenic
1042622133 8:70718000-70718022 ATGGAGATGAGGAATTTGGAGGG - Intronic
1042806043 8:72772094-72772116 ATGGAGAGGAGGCAAGAGCCAGG + Intronic
1043299176 8:78705540-78705562 CTGGTGATGAGGAATGGGACTGG + Intronic
1043623687 8:82229160-82229182 ATGGAGATGAGGAACTTGGTGGG + Intergenic
1043750969 8:83933720-83933742 ATGGAGATGAGTAAGGTGTCAGG + Intergenic
1043934774 8:86130785-86130807 ATGGGGAAGAGGACAGAGGCAGG - Intronic
1045658704 8:104413430-104413452 GTTGAGATGAGGAAGGAGACAGG + Intronic
1045849206 8:106673230-106673252 ATGGAGATGAGGAATTTGTTGGG + Intronic
1046917331 8:119691558-119691580 ATGGAGATGAGGAACTCGTCGGG + Intergenic
1047678016 8:127224074-127224096 AGGGAGAGTAGAAATGAGGCTGG - Intergenic
1047701374 8:127452637-127452659 AAAGAGATGAGGAGTGGGGCGGG + Intergenic
1048189337 8:132273868-132273890 ATGGAGATGAGGAATTTGTTGGG - Intronic
1048895852 8:138991498-138991520 ATGGAGATGAGGAACTTGTCAGG - Intergenic
1049700555 8:144009634-144009656 AAGGAGATGAGCCAGGAGGCAGG - Intronic
1049740454 8:144238554-144238576 TTGAAGATGAGAACTGAGGCAGG + Intronic
1050174179 9:2852760-2852782 ATGGGAATGGGGAGTGAGGCAGG + Intergenic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1051902757 9:22060410-22060432 ATGGAGATGAGGAATTTGTTGGG - Intergenic
1051971993 9:22899674-22899696 AGTGAACTGAGGAATGAGGCAGG - Intergenic
1052171628 9:25404861-25404883 ATAGAGATGAGGTAAGGGGCAGG + Intergenic
1052854343 9:33397836-33397858 GTGGTGATGAGGAAGGAGCCAGG - Intronic
1052917232 9:33932754-33932776 GTGGGGATAAGGAATGAGGATGG - Intronic
1053054628 9:34987322-34987344 AAGGAGATGAGGCATGAGTGTGG + Intergenic
1053416462 9:37949890-37949912 TGGGAGATGAGGGATGAGTCGGG - Intronic
1053437303 9:38084554-38084576 ATGGGGATTAGGAAGGAGGAAGG + Intergenic
1053682351 9:40493997-40494019 GTGGTGATGAGGAAGGAGCCAGG - Intergenic
1053932332 9:43122323-43122345 GTGGTGATGAGGAAGGAGCCAGG - Intergenic
1054281363 9:63130932-63130954 GTGGTGATGAGGAAGGAGCCAGG + Intergenic
1054295449 9:63329497-63329519 GTGGTGATGAGGAAGGAGCCAGG - Intergenic
1054393468 9:64634001-64634023 GTGGTGATGAGGAAGGAGCCAGG - Intergenic
1054428118 9:65139215-65139237 GTGGTGATGAGGAAGGAGCCAGG - Intergenic
1054502261 9:65882329-65882351 GTGGTGATGAGGAAGGAGCCAGG + Intronic
1055166329 9:73199736-73199758 AAGGAGATGGGGAAAGAGGGAGG + Intergenic
1055363890 9:75524205-75524227 ATGGAGATGAGGAATTTGTTGGG + Intergenic
1055476553 9:76668726-76668748 AGGAAGATGTGGAATGAAGCCGG - Intronic
1055544582 9:77356156-77356178 ATGAAGAAGAGCAAGGAGGCTGG - Intronic
1055664890 9:78543497-78543519 AGGGAGAAGAGAAATGAAGCGGG - Intergenic
1055819321 9:80242814-80242836 ATGGAGAGAAGGAAGGAGGTAGG - Intergenic
1056444510 9:86652694-86652716 ATGGAACTGAGGTAGGAGGCGGG - Intergenic
1056618695 9:88191729-88191751 GTGCAGTTGAGGAAGGAGGCTGG - Intergenic
1056824951 9:89870584-89870606 CTGGAGAAAAGGAATCAGGCTGG - Intergenic
1056878272 9:90360244-90360266 TTGAAAATGAGGAATGAGGTGGG - Intergenic
1056893933 9:90523305-90523327 ATGGAACAGAGGAAAGAGGCTGG - Intergenic
1056935113 9:90910560-90910582 AGGGGGAGCAGGAATGAGGCTGG + Intergenic
1057143487 9:92742677-92742699 ATAGAAATGTGGAATTAGGCCGG - Intronic
1057174507 9:92986214-92986236 ATGGAGATAAGGATATAGGCTGG - Intronic
1058635264 9:107032266-107032288 ATGGAGATGAGGAATTTGTTGGG + Intergenic
1058738920 9:107923127-107923149 ATGTAGACCAGGAATTAGGCTGG + Intergenic
1058766083 9:108184086-108184108 GTGGGGAAGAGTAATGAGGCCGG - Intergenic
1058822123 9:108742223-108742245 ATCGGTAAGAGGAATGAGGCCGG - Intergenic
1058961424 9:109995900-109995922 ATGGAGAGGAAGGATGAGGCAGG + Intronic
1060104985 9:120868040-120868062 CTGGAGATGTGCAATCAGGCAGG - Intronic
1060167920 9:121434917-121434939 ATGGAAATGAGGACTGCAGCAGG + Intergenic
1060203914 9:121670658-121670680 AATGTGATGAGGAAAGAGGCAGG - Intronic
1060257838 9:122048072-122048094 AGGGAGATGGGGGAGGAGGCTGG - Intronic
1060268021 9:122123425-122123447 ACGGAGATGAGGACTGAAGAGGG - Intergenic
1060673292 9:125489730-125489752 GAGGAGTTGAGGAAGGAGGCAGG + Intronic
1060773772 9:126353055-126353077 CTGGAGATGAGGATTGTGGCTGG + Intronic
1061257317 9:129460347-129460369 ATGGAGAGGAGGAGGGAGGGAGG - Intergenic
1061466038 9:130780586-130780608 AGGGAGATGAGGGAAGAGGGAGG - Intronic
1061857240 9:133448995-133449017 TTGGAGGTGAGGAAAGAGCCAGG - Intronic
1203608569 Un_KI270748v1:76106-76128 ATGGAGAGGAGAAAGGAGACGGG + Intergenic
1185492357 X:527326-527348 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492363 X:527391-527413 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492369 X:527456-527478 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492374 X:527521-527543 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492380 X:527586-527608 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492387 X:527653-527675 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492394 X:527720-527742 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492401 X:527787-527809 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492408 X:527854-527876 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492415 X:527921-527943 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492422 X:527988-528010 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492429 X:528055-528077 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492436 X:528122-528144 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492447 X:528221-528243 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492453 X:528288-528310 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492460 X:528355-528377 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1185492466 X:528422-528444 AGGAAGATGAGGAATAAGGAAGG - Intergenic
1186620528 X:11235769-11235791 ATGGAGATGAGGAATTTGTTGGG - Intronic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188000463 X:24975535-24975557 AAGCAGATGAGAAATCAGGCTGG - Intronic
1188731252 X:33648627-33648649 ATGGAGATGAGGAACGTGTTGGG - Intergenic
1190623866 X:52317158-52317180 ATGGAGATGAGGCAGGAAGTGGG - Intergenic
1190936821 X:55005223-55005245 ATGCATAAGAGGAATGAGGCAGG - Intronic
1190947263 X:55108118-55108140 ATGGAGAGGAGCCCTGAGGCAGG + Intronic
1191592065 X:62897282-62897304 GTGGAGATGGGGAATGATGAGGG + Intergenic
1192671184 X:73143717-73143739 ATGGTGATGAGGAAGGCGGGAGG - Intergenic
1192697956 X:73438043-73438065 ATGGAGATGAGGAACTTGCCAGG - Intergenic
1192841849 X:74865274-74865296 ATGGAGATGAGGAATTTGTTGGG + Intronic
1193021454 X:76797659-76797681 ATGGACGTGTGGAATGATGCTGG + Intergenic
1193043211 X:77025230-77025252 ATGGAGATGAGGAATTTGTTGGG - Intergenic
1193388115 X:80894629-80894651 ATGGAGATGAGGAATGTATTGGG + Intergenic
1193471768 X:81913205-81913227 GTGGAGATGAAGAATGAGTTAGG - Intergenic
1193854054 X:86576831-86576853 AGGGAGATGAGGAAGGTGTCAGG - Intronic
1193888032 X:87007113-87007135 ATGGAGATGAGGAATTTGTTGGG - Intergenic
1193918674 X:87399573-87399595 ATGGAGATGAGGAATTTGTTGGG + Intergenic
1195672041 X:107477891-107477913 ATGGAGATGAGTAATAAAACTGG - Intergenic
1195866666 X:109439760-109439782 ATGGAAATGAGGAATGAAGTTGG - Intronic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196434861 X:115665451-115665473 ATGCAGATCAGCAATGAGGCTGG + Intergenic
1197023545 X:121718722-121718744 ATGGAGATGAGGAACTTGTCAGG - Intergenic
1197301786 X:124789666-124789688 ATGGAGATGAGGAATTTGGTGGG - Intronic
1197871468 X:131066336-131066358 ATGGAGGTGAAGAATCAGGGTGG - Intronic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198084068 X:133266234-133266256 GTGCAGATGAGGAGTGAGGGAGG + Intergenic
1198151052 X:133910156-133910178 ATGGAGATCAGGGATAAGGTGGG - Intronic
1198496623 X:137199667-137199689 AGGGAAATGAGGACAGAGGCAGG + Intergenic
1198919439 X:141708957-141708979 ATGGAGATGAGGAACTTGGTGGG - Intergenic