ID: 1083592234

View in Genome Browser
Species Human (GRCh38)
Location 11:63902581-63902603
Sequence CTGCTGGGCCAGAGGGAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1731
Summary {0: 1, 1: 0, 2: 31, 3: 598, 4: 1101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083592234 Original CRISPR CTGCTGGGCCAGAGGGAGGA TGG (reversed) Exonic
900347429 1:2216387-2216409 ATGTTGGGCCCGAGGGAGGGAGG - Intergenic
900394305 1:2446868-2446890 CTGCAGGGGCAGGAGGAGGAAGG - Intronic
900495306 1:2973414-2973436 GTGCTGGGGCAGAGGGAGGAGGG + Intergenic
900607628 1:3530958-3530980 CTGCTAGGCTGGAGGGAGCAGGG - Intronic
900787198 1:4656162-4656184 CTCCAGGGCCAGATGGAAGAGGG + Intronic
900831222 1:4967131-4967153 CAGCTGGAGCAGAGGGAGCAGGG - Intergenic
900954099 1:5876218-5876240 CAGCTGGGAGGGAGGGAGGAAGG + Intronic
900982389 1:6053608-6053630 CGGCTAGGCTGGAGGGAGGAAGG + Intronic
900986065 1:6073334-6073356 CTGCTGGGACAGAGCGGGGAGGG - Intronic
901229301 1:7633140-7633162 CTGCAGGGACAAAGAGAGGACGG - Intronic
901408638 1:9067302-9067324 CCTCTGGGCCAGAGGGATGAAGG - Intronic
901444105 1:9296804-9296826 TTGCTTGGACAAAGGGAGGATGG + Intronic
901733049 1:11294461-11294483 CTGCAGGGCAAGAGAGATGAGGG - Intronic
902237164 1:15064821-15064843 ATGCGAGGCCACAGGGAGGAAGG - Intronic
902599671 1:17532382-17532404 CTGCTGAGCCAAGGGGAGGTTGG - Intergenic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
903261230 1:22132787-22132809 CTGCTGTGCCAGATGAAGGCAGG - Intronic
903464944 1:23545445-23545467 CTGCTGGGACAGAGGGAGTTGGG + Intergenic
903684871 1:25123639-25123661 CTGCTTATCCACAGGGAGGAGGG - Intergenic
903724164 1:25428876-25428898 GTGTTGGGGCAGAGGCAGGAAGG + Intronic
904116181 1:28163706-28163728 CAGCTGGGCCAGTGGGGAGAGGG - Intronic
904489460 1:30849532-30849554 CTGCTGTTCGAGAGGCAGGAAGG - Intergenic
904560549 1:31394564-31394586 AAGCTGGCCCAGAGAGAGGAAGG + Intergenic
904585723 1:31579573-31579595 CTGCAGAGTCAGAGGGAGAAGGG + Intronic
904615676 1:31748287-31748309 GAGCTGGGCCAGAGAGGGGAAGG + Intronic
904648599 1:31987363-31987385 CTGGTAGGGCAGAGTGAGGAGGG - Intergenic
905292892 1:36935013-36935035 CTGGTGGGCAATGGGGAGGAAGG - Intronic
905455450 1:38085050-38085072 ATTCTGGGACAGTGGGAGGAGGG + Intergenic
905541850 1:38766184-38766206 CTGCTGGAACAGCAGGAGGAAGG + Intergenic
905617031 1:39408650-39408672 GGGCCGGGCCAGCGGGAGGAGGG + Intronic
906241104 1:44242746-44242768 CTGCTGGGCAAGACGGGGGCTGG + Intronic
906746425 1:48225127-48225149 CTGCTGAGCCAGAGGGAAGCAGG + Intronic
907032175 1:51183354-51183376 CTGCTGGGACCTAGGGAAGAAGG + Intergenic
907224016 1:52927911-52927933 CTGGAGGGACAGAGGGAGGCCGG - Intronic
907444534 1:54499422-54499444 CCGCAGGGCAAGAGGGAGGCAGG + Intergenic
907919157 1:58896789-58896811 CAGCTGGGAGGGAGGGAGGAAGG + Intergenic
909501178 1:76337301-76337323 CTGCTGGCCCAGAGGCAAGAGGG + Intronic
909973133 1:82014728-82014750 ATGATGGGCTACAGGGAGGAAGG - Intergenic
910864107 1:91771934-91771956 CAGCTGGGCCAGAGGGTGAATGG + Intronic
911108748 1:94161191-94161213 CTTCTGGGACAGAGGGTGGAGGG + Intronic
912595947 1:110875754-110875776 CTGCTGGGGCAGAGGAGGGAAGG + Intronic
912659787 1:111517063-111517085 CACTTGGGACAGAGGGAGGAAGG - Intronic
912956440 1:114156897-114156919 AGGCTGGGGCAAAGGGAGGAGGG + Intergenic
914824992 1:151133518-151133540 CTGCCGACCGAGAGGGAGGAGGG + Intronic
915040070 1:152960904-152960926 TTCCTGGGTCAGAGTGAGGAAGG + Intergenic
915115318 1:153594915-153594937 CTGATGGACCAGAGAGAGGAAGG - Intergenic
915141623 1:153771782-153771804 TCGCTGGGCCTGGGGGAGGAAGG - Exonic
915149579 1:153819717-153819739 CTAGTGAGCCAGAGCGAGGAAGG - Exonic
915361845 1:155290544-155290566 AGGCTGGGCCAGAGGAGGGAGGG + Exonic
915530814 1:156501036-156501058 CTGCCGGGAGGGAGGGAGGAAGG + Intergenic
915603506 1:156937074-156937096 GTGCTGGGCCTTGGGGAGGAGGG + Intronic
916047190 1:161008924-161008946 CTGGTGGGAGAGAGGGAGGTGGG - Intronic
916348371 1:163820478-163820500 CAGATAAGCCAGAGGGAGGAAGG + Intergenic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
917478144 1:175386389-175386411 CTGGTGAGTCAGAGAGAGGATGG + Intronic
917968836 1:180194706-180194728 CTGCTAGGGCAGAGGGAGCTGGG + Intronic
918218651 1:182415650-182415672 CTGCCTGGTCAGAGGGAGGAGGG + Intergenic
918320793 1:183362422-183362444 CTGCAGGGCCAGGGGGCGGTGGG - Intronic
919705161 1:200669436-200669458 CTGCTGGGCGGGACGGCGGACGG + Intronic
920049263 1:203153541-203153563 CTGCAGGGCTACAGGGAGGAGGG - Intronic
920180872 1:204131120-204131142 TTTCTGGGCCAGAGCCAGGAAGG + Exonic
920198669 1:204245807-204245829 CTGCTGGCCCAAAGGGATGTGGG - Intronic
920251433 1:204624772-204624794 CTGAGGGTCCAGAGGGAGGGTGG + Intronic
920415823 1:205798816-205798838 CTGGTGAGCAAGTGGGAGGAGGG + Intronic
920533564 1:206722851-206722873 CTGCTGCACCACATGGAGGATGG - Intronic
920977718 1:210801474-210801496 GTGCTGGTCCAGATGGAAGAGGG - Intronic
921036330 1:211382677-211382699 CTGCTGGACTGGAGGGAGGGAGG - Intergenic
921187581 1:212683546-212683568 CTGCTGGGCTGAAGGAAGGAAGG - Intergenic
921325369 1:213982936-213982958 CCGCGGGGCCAGAGCGAGGAGGG + Intergenic
922422927 1:225471556-225471578 CCCCTGGGCCTGAGGGAGGTGGG + Intergenic
922541095 1:226420530-226420552 CTGCTGGGCCAGTGTGAGGAAGG - Intergenic
922726533 1:227925474-227925496 CTCCAGGGTCAGCGGGAGGATGG + Exonic
922764920 1:228151720-228151742 CTGCTGGGGCAGAGTGGGCATGG + Intronic
922820120 1:228479020-228479042 CTGCAGGGCCAGAGACAGCATGG - Intergenic
922882093 1:228988825-228988847 CTGCTGGTCCATAGTGAGGGTGG + Intergenic
922937550 1:229433528-229433550 TTGCTGGGCCAGCGTGAGGGTGG + Intronic
923625029 1:235606783-235606805 CTCATGGGCCAGGGGGAGCATGG + Intronic
923988990 1:239413195-239413217 TTGTTGGGCCAAAGGGTGGAAGG - Intronic
1063378674 10:5570475-5570497 CAGATGGGGCAGAGGGCGGAGGG + Intergenic
1063881181 10:10534513-10534535 CCTCTGAGCCAGAGGGAGAAAGG + Intergenic
1064259563 10:13774309-13774331 CTGCTGGGAAAGAGAGAGGAAGG + Intronic
1065059266 10:21881514-21881536 CTGCTGTGCCTTAGGGAGTAGGG + Intronic
1065487605 10:26249877-26249899 CTGCCAGGACAGAGGCAGGAGGG + Intronic
1065821568 10:29530364-29530386 CAGGTGGGCCAGAGGCAGGAGGG + Intronic
1065958153 10:30711080-30711102 GAGCTGGGGCAAAGGGAGGAGGG + Intergenic
1067208334 10:44238495-44238517 CTCCTGGGCCAGTTGAAGGAGGG + Intergenic
1067450351 10:46378222-46378244 GTGCTGGGGCAGAGGGAAGCCGG + Intronic
1067577747 10:47418868-47418890 CTGCTGGCCCAAATGGAGGATGG + Intergenic
1067586894 10:47481541-47481563 GTGCTGGGGCAGAGGGAAGCCGG - Intronic
1067633950 10:47989308-47989330 GTGCTGGGGCAGAGGGAAGCCGG - Intergenic
1068936284 10:62638557-62638579 CTGCTGAGCTAGAGGGTGGAAGG - Intronic
1069264653 10:66443083-66443105 CTGCAAGGCCACAGGGAGGCTGG + Intronic
1069819502 10:71218590-71218612 CTGGTGCTCCAGGGGGAGGAAGG + Intronic
1069821285 10:71230240-71230262 CTGATTGGTCAGAGTGAGGAGGG + Intronic
1070555537 10:77524935-77524957 CTGCTGGTGCTGAGGGAGGCCGG - Intronic
1070969210 10:80549686-80549708 CTGCTGGGCCTGAGGAAGGCAGG - Intronic
1072201777 10:93166558-93166580 CTGGTGGGTGAGAGGGAGAATGG - Intergenic
1072330653 10:94347155-94347177 CTGCTGTGCCTGCGGGAGGTCGG - Intronic
1073070182 10:100788371-100788393 CTGGAGGGGCAGTGGGAGGAGGG + Intronic
1073300064 10:102465747-102465769 CTGCTGGGGCAGATTGAGGGTGG + Intronic
1073439267 10:103543152-103543174 CTGCAGGACTACAGGGAGGAGGG - Intronic
1074094787 10:110301997-110302019 CTTCTTGGGCAGTGGGAGGAGGG - Intronic
1074249593 10:111731170-111731192 ATGCTGGGCCACAGGGCTGAGGG + Intergenic
1074338161 10:112599223-112599245 CTGCAAGGCCAGAGTGAGGTAGG + Intronic
1074436961 10:113442397-113442419 TGGCTGGGGGAGAGGGAGGAGGG - Intergenic
1074530691 10:114296941-114296963 CTGCTGGCCCCAAGGGAGGCTGG + Intronic
1075454220 10:122574511-122574533 CCCATGGGCCAGAGGGAGAAGGG - Intronic
1075595644 10:123727254-123727276 CTGATGGGCCAGAGGATGGTGGG - Intronic
1076571867 10:131438433-131438455 CTGCTGGGCAAGGAGGAGGCTGG + Intergenic
1076727827 10:132421620-132421642 CTGCTGGGGCAGAGGCTGGCTGG - Intergenic
1076748147 10:132524698-132524720 CTCCTGGGCCAGAGGAGAGAAGG - Intergenic
1076920982 10:133454538-133454560 CTGCTGGGTCAGGGGCAGGGAGG + Intergenic
1077060855 11:617323-617345 CGGCTGGGGGAGAGGGTGGAGGG + Exonic
1077159937 11:1108054-1108076 GGGCTGGGTGAGAGGGAGGAGGG + Intergenic
1077243612 11:1524974-1524996 CTGCTGGGGAAGGGGAAGGAAGG + Intergenic
1077320420 11:1938523-1938545 CTGGTGTGCAAGAGGGCGGAGGG - Exonic
1077368595 11:2171287-2171309 CAGCTGGGGCAGAGGGAGGCAGG + Intronic
1077368758 11:2171912-2171934 CTGCTGTGCCTGATGGAGGCGGG + Intergenic
1077608584 11:3628818-3628840 ATGCAGGGGCAGAGGCAGGATGG + Intergenic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1078122960 11:8529282-8529304 TTCCTGGGCCAGAGGCAGGTAGG + Intronic
1078169072 11:8914836-8914858 CATCTGTGCCAGAGGAAGGAGGG + Exonic
1078835512 11:15025743-15025765 CAGCTGTGGCAGAGGGAGCAGGG - Intronic
1078855579 11:15204317-15204339 CTGCTGGGCCAGAGCCAGCCTGG + Intronic
1079100524 11:17538809-17538831 CTGCTGGGCCACAGTTAGGCAGG + Intronic
1079419456 11:20272477-20272499 GAGCTTGGCCAGGGGGAGGAAGG - Intergenic
1081556316 11:44165309-44165331 CTGCTTGTCCACAGAGAGGAAGG - Intronic
1081809392 11:45906623-45906645 CTGCTGGGCCCTAGACAGGAGGG + Exonic
1083155761 11:60821966-60821988 CTGCAGGGCCTGGGGGTGGAGGG - Intergenic
1083160911 11:60853571-60853593 CTGCTGGGCCTGGTGGAGAATGG - Exonic
1083274246 11:61587886-61587908 ACGCCGGCCCAGAGGGAGGAGGG + Intergenic
1083275055 11:61592188-61592210 GGGCTGGAGCAGAGGGAGGATGG + Intergenic
1083299476 11:61732801-61732823 CAGCCTGGCCAGAGGGAGAAGGG + Intronic
1083365347 11:62138757-62138779 CAGCTGAGCCAGAGGTAAGACGG + Exonic
1083592234 11:63902581-63902603 CTGCTGGGCCAGAGGGAGGATGG - Exonic
1083654025 11:64220416-64220438 CTCCTGGGCGAGAGGGGTGAGGG - Exonic
1083664552 11:64267422-64267444 CTGCTGGGCGAGATGCCGGAGGG + Exonic
1083678598 11:64341197-64341219 GTGCGGGGGCAGAGGCAGGAGGG - Intronic
1083752160 11:64766741-64766763 CTCCTGGTCCAGGGGGTGGAGGG - Intronic
1083799706 11:65039560-65039582 ATGCTGGGCCCCAGAGAGGAGGG + Intronic
1083809520 11:65095982-65096004 CTGCTGTCCCAGAAGGGGGACGG - Intronic
1083865074 11:65449239-65449261 CTGCAGGGCCAGAGAAAGGGGGG + Intergenic
1084207629 11:67605233-67605255 ATGCTGGGCATGAGGGGGGATGG - Intronic
1084459010 11:69285934-69285956 CTGCTAGGCCAGACTGAGGCAGG - Intergenic
1084518622 11:69649696-69649718 CTGTGGGGCCAGAGGAATGAAGG + Intronic
1084556570 11:69879472-69879494 CTGCTGGCCCAGGGGGAGGTGGG + Intergenic
1084884998 11:72198084-72198106 CTGCTCTGCCAGAGCTAGGATGG + Intergenic
1085054114 11:73394166-73394188 CTGCTGGGGCAGGGGGTGGGAGG + Intronic
1085331361 11:75654529-75654551 CTCCTGGTCTAGTGGGAGGAAGG - Intronic
1085695954 11:78704960-78704982 CTGCAGGGACAGAGGGAGCTGGG - Intronic
1086226037 11:84510915-84510937 ATACAGGGACAGAGGGAGGAGGG + Intronic
1088540760 11:110911273-110911295 CTGCTGGTGCAGAGGGGAGAGGG + Intergenic
1088847786 11:113682330-113682352 CTGCAGGCCCTGAGGAAGGAGGG + Intergenic
1089051372 11:115548898-115548920 ATGGTGAGCCAGAGGAAGGAGGG + Intergenic
1089209834 11:116792352-116792374 CAGCTGGGGCAGAGGGATGGGGG - Intronic
1089346574 11:117795403-117795425 CTGCGGGGGCGGAGGGAGGCAGG + Intronic
1089615342 11:119691869-119691891 CTGCTGAGAAAGAGGGAGGAAGG - Intronic
1089637918 11:119828153-119828175 CAGCTGGGAAAGAGGGAGGCTGG + Intergenic
1090088253 11:123670403-123670425 CTTCTGGACCAGAGGGAAAAGGG + Intergenic
1090208672 11:124899936-124899958 CTGTGGGGCCAGAGTGATGAAGG + Intergenic
1090387583 11:126365711-126365733 CTGGTGGGGCAGCTGGAGGAAGG + Intronic
1090441539 11:126728937-126728959 CTTTCGGGGCAGAGGGAGGAGGG + Intronic
1090590593 11:128262720-128262742 GGGCTGGGCTAGAGGAAGGAAGG + Intergenic
1090737754 11:129625806-129625828 CTGCTGAGGCAGAAGCAGGAGGG - Intergenic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1092930020 12:13307072-13307094 CTTCTTGGCCTGAGGGTGGAGGG + Intergenic
1095854428 12:46844552-46844574 CTTCTGGCCCAGAAAGAGGAAGG - Intergenic
1096260391 12:50086357-50086379 ATCCTGGGGCAGAGGGAGGGAGG + Intronic
1096522797 12:52193569-52193591 ATGCCAGGCCAGAGTGAGGACGG - Intergenic
1096634919 12:52952096-52952118 CTGCAGGGGCACAGAGAGGAGGG - Intronic
1096874589 12:54617396-54617418 CTGCTTGGCTTGAGGGTGGAGGG + Intergenic
1097017521 12:55997879-55997901 CAGCAGGGCCAAAGTGAGGAGGG - Intronic
1097250485 12:57629984-57630006 CAGCAGGGCCAGAGGGAGAAAGG - Intronic
1098892798 12:76026948-76026970 CTGTTGGGACAAAGGAAGGAAGG - Exonic
1100268356 12:93000046-93000068 CTGATGGGCCAGAGACAGGAGGG - Intergenic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1102032839 12:109752988-109753010 CTGCTGGCCCAGGGGTAGGCAGG - Intronic
1102691957 12:114768416-114768438 CTGCTGGGGCAGGGGGGAGAGGG - Intergenic
1103023467 12:117555103-117555125 CTGCTGGGTGAGGGGTAGGAGGG - Intronic
1103993439 12:124814452-124814474 CAGCTGGGGCCAAGGGAGGATGG - Intronic
1103995743 12:124828913-124828935 CTGCTGGTCCAGAGTGGGCAGGG - Intronic
1104160190 12:126171506-126171528 GTGTTGGGCCAAGGGGAGGAGGG + Intergenic
1104286539 12:127429734-127429756 ATGCTGGGGTAGGGGGAGGATGG + Intergenic
1104672261 12:130688891-130688913 CTGCTGGGCAAGAGTGGGGTGGG - Intronic
1104970621 12:132529103-132529125 CTGCTGGGCTCGTGGGAGGGTGG + Intronic
1104990288 12:132620662-132620684 CAGCTGGTCAGGAGGGAGGAGGG - Intronic
1106029904 13:25990568-25990590 CAGCTGGGGCAGAGGGAGGGAGG + Intronic
1106764931 13:32904037-32904059 CTGCTGGTCCAGAAGTAGGAGGG + Intergenic
1106938495 13:34750330-34750352 CTGCAGGACCACAGGGAGGGAGG + Intergenic
1107087174 13:36437778-36437800 CTGCTCGGTCAGAGAGGGGATGG + Exonic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1108226026 13:48290202-48290224 GTGCAGGGCCAGAGGTGGGAAGG - Intergenic
1109054962 13:57535144-57535166 CTGCTGGGTGAGAGGGAATATGG + Intergenic
1111909625 13:94296080-94296102 GTGCTAGGGCAGAGGGAAGAGGG + Intronic
1112707311 13:102085241-102085263 CTGGTGGGGGAGGGGGAGGAAGG + Intronic
1113175988 13:107564678-107564700 TTTCTTGGACAGAGGGAGGAAGG - Intronic
1113748593 13:112763326-112763348 CTGCTGGTCCAAAGGGAGGAGGG - Intronic
1113973574 13:114209562-114209584 CTGATGGTCTAGAGGAAGGAAGG + Intergenic
1114332559 14:21652128-21652150 CTGCTGGGCCAGCTGGGAGAGGG + Intergenic
1114613008 14:24054327-24054349 CTACTGGGCCAGCTGGAGGAGGG + Intronic
1115855160 14:37622655-37622677 CTGCATGGCCAAAGAGAGGAAGG + Intronic
1117371706 14:55084592-55084614 CCACTGGGGCAGTGGGAGGAAGG + Intergenic
1118326757 14:64786531-64786553 CTTCTGGGCCAGCGGCTGGAGGG - Exonic
1118720385 14:68589765-68589787 CTGCTGGGACAGAGGAAGAGAGG - Intronic
1119538534 14:75423018-75423040 CTCCAGGGCCACAGGGAAGAGGG + Intergenic
1120840722 14:89082857-89082879 CTGCTGGCAAACAGGGAGGAGGG - Intergenic
1121209836 14:92199963-92199985 CTGCTGGGGGAGAGGAAGAAGGG - Intergenic
1121338558 14:93091854-93091876 TTGCTGGGCGTGAGGGATGACGG + Intronic
1121572195 14:94954730-94954752 CTTCTGGGCCATAGGGAGAGAGG + Intergenic
1121679085 14:95777553-95777575 CTCCAGGCCCAGGGGGAGGAAGG - Intergenic
1121889082 14:97572451-97572473 CTGATGGGCTAGAGAGAGGCTGG - Intergenic
1121990409 14:98551661-98551683 CTGGTGGGCAAGTTGGAGGAGGG + Intergenic
1122147452 14:99700130-99700152 CTGCCTGGCCAGAGGCAGTAGGG + Intronic
1122287733 14:100661864-100661886 CAGCTGGCCCTGAGGAAGGAAGG + Intergenic
1122296582 14:100709397-100709419 CGGCGGGGCCCCAGGGAGGAGGG - Intergenic
1122631236 14:103108712-103108734 CTGGTGGGGCTGATGGAGGATGG - Intronic
1122975719 14:105169917-105169939 CTGCTGGGGCTGAGGGCTGAAGG + Intergenic
1123108032 14:105852119-105852141 CGGCTGTGGCACAGGGAGGAGGG - Intergenic
1124372156 15:29110128-29110150 TGGCTGGGCCCCAGGGAGGAGGG + Intronic
1124628939 15:31326507-31326529 CCCCTGGGCCGGTGGGAGGAGGG - Intergenic
1125084454 15:35714083-35714105 CTGCTGAGCCACAGTGGGGAAGG - Intergenic
1125599150 15:40906260-40906282 CTGGAGGGCCAGAGGGGGGTGGG + Intergenic
1126822803 15:52521484-52521506 ATGCTGGGCTAGAGGGAGACTGG - Intronic
1127608475 15:60614290-60614312 CTGCTGGGGAGGAGGAAGGAAGG + Intronic
1127919995 15:63486648-63486670 TTGCTGGGCCAGAGGTAGGAAGG - Intergenic
1127959831 15:63882525-63882547 CTGCCAGGCCTGAGGGAGGGAGG - Intergenic
1127964801 15:63915602-63915624 CTGCTGGGCCAGGAGGAGGGTGG - Intronic
1128524935 15:68406012-68406034 CTGCTGGGTCAGATGCAGGAAGG - Intronic
1128639212 15:69323461-69323483 CTCCTGGGCCAGAGGCAGGATGG + Intronic
1129152768 15:73699496-73699518 CTCCTGGACCAGAGTGGGGAAGG - Intronic
1129297621 15:74608621-74608643 CTGCTGGCCCAGGGGCAGGTGGG - Intronic
1129519741 15:76178142-76178164 CTGCTGGGACAGAGGAAGCCTGG + Intronic
1129801468 15:78418195-78418217 CTGCTGAGCAAAAGGGAGGCCGG - Intergenic
1129883914 15:79025632-79025654 CTGCAGGGCCAGATGGCTGAGGG + Intronic
1131074488 15:89486722-89486744 CAGGTGAGCCTGAGGGAGGAGGG - Intronic
1132186420 15:99805879-99805901 GTGCTGGGTCAAGGGGAGGAGGG + Intergenic
1132429258 15:101746831-101746853 GTGCTGGGTCAAGGGGAGGAGGG - Intergenic
1132554593 16:566950-566972 CAGCTGGGCCGGGTGGAGGAGGG - Intergenic
1132705966 16:1243615-1243637 GGGATGGGCCAGAGGGAGGAAGG - Intergenic
1132814063 16:1817615-1817637 CTGCTGGGGCCAAGGGAAGATGG - Intronic
1132881866 16:2165864-2165886 ATTCTGGTCTAGAGGGAGGACGG - Exonic
1132986097 16:2768407-2768429 ATGCTGGGGCAGGGGGCGGAGGG + Intronic
1133056762 16:3149310-3149332 CTGCAGGGCCAGTGGGAAGCTGG + Intronic
1133119731 16:3598619-3598641 AAGCTGGGCAAGAAGGAGGAGGG + Intronic
1133643537 16:7741032-7741054 GGGATGGGGCAGAGGGAGGAGGG - Intergenic
1133772994 16:8878480-8878502 CTGCTGAGCCAGAGTGAGGAAGG + Intergenic
1133816252 16:9199533-9199555 CTCCTGGGGCAGAGGCAGGAAGG - Intergenic
1134905763 16:17978341-17978363 GGGCAGGGCCAGAGGCAGGATGG - Intergenic
1135007497 16:18839592-18839614 CTGGAGGGACAGAGGAAGGAAGG + Intronic
1136236914 16:28919944-28919966 CTGGTGGGGGAGAGGGAGGGTGG + Intronic
1137946231 16:52735500-52735522 CTGGTGGGATAAAGGGAGGATGG - Intergenic
1137988728 16:53131334-53131356 CTGCTCGGCCGGTGGGGGGAGGG + Intronic
1139515549 16:67450452-67450474 CTGCTGGGGCAGAGCGGAGAAGG + Intronic
1139695660 16:68672632-68672654 GTGCTTGGCCAGTGGGAGGAAGG - Intronic
1139914582 16:70420166-70420188 CTTGTGGCCCAGTGGGAGGATGG + Intronic
1140890881 16:79284208-79284230 CTGCTGGGGTAGAAGGCGGATGG - Intergenic
1141191966 16:81831595-81831617 GTGCTGGGAAAGAGGGAGGCAGG + Intronic
1141706577 16:85668433-85668455 GTGCTGGGGAAGAGGGGGGAGGG + Intronic
1141749105 16:85946467-85946489 GTGGTGGCCCAGAGGGAGCAGGG - Intergenic
1141764512 16:86049564-86049586 GTGTTGGGCCAAGGGGAGGATGG - Intergenic
1141842651 16:86584049-86584071 CTGAGGGGGCAGAGGCAGGATGG - Intergenic
1141950555 16:87336499-87336521 CTGCTGGGTCGGAGGCAGCAGGG + Intronic
1142114737 16:88350712-88350734 CTTCTGGCCAAGAGGGAGGTTGG - Intergenic
1142128055 16:88419902-88419924 CTCCTCTGCCAAAGGGAGGAAGG + Intergenic
1142323303 16:89398961-89398983 CTGATGGGAGAGAGGGATGATGG - Intronic
1142715612 17:1745424-1745446 GGGCGGGGCTAGAGGGAGGAGGG + Intronic
1142963003 17:3563065-3563087 ATCCTGGGCCAGAGGGAGGTGGG - Intergenic
1143097294 17:4485105-4485127 CAGCTGGACCAGAGAGTGGAAGG + Intronic
1143371767 17:6444816-6444838 CGCCTGAGCCAGAGAGAGGAAGG + Intronic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1144758775 17:17695300-17695322 CTCCTGGGCTGGAGGGAGGCCGG - Intronic
1144878013 17:18412353-18412375 CTGCGGGGAGAGGGGGAGGAGGG + Intergenic
1144946192 17:18970740-18970762 CTGCTGGGCCAGCGGGACACTGG + Exonic
1145154217 17:20532072-20532094 CTGCGGGGAGAGGGGGAGGAGGG - Intergenic
1145231639 17:21177527-21177549 CTGCTGGGCGGGAGGGAGTGGGG - Intronic
1145275085 17:21424359-21424381 CTGCTCGACCTGAGGGAGGATGG + Intergenic
1145312939 17:21710259-21710281 CTGCTCGACCTGAGGGAGGATGG + Intergenic
1145866701 17:28246516-28246538 CTACTGGGCCAGAGATGGGAGGG - Intergenic
1146179263 17:30686911-30686933 CTGCTGGGTCCCAGGGAGCAAGG + Intergenic
1146183127 17:30709647-30709669 GTGCTGGGCCAGGGGAAGGAAGG + Intergenic
1146535582 17:33647809-33647831 CTGCTGAGCCAGAGGGCTGAGGG + Intronic
1146790287 17:35747067-35747089 CTGCGGGGTCTGGGGGAGGATGG + Exonic
1146946572 17:36877598-36877620 CTGCTATGCCAGAGGAAGGCCGG + Intergenic
1147770876 17:42867125-42867147 CTGCTGGTCAAGAGGAATGATGG - Intergenic
1148283753 17:46370063-46370085 CTCCTGGGCCAGGGGGAGGCAGG + Intergenic
1148305971 17:46587980-46588002 CTCCTGGGCCAGGGGGAGGCAGG + Intergenic
1148325949 17:46783617-46783639 CCTCTGGGCCAGAGGGTGCACGG + Intronic
1148894149 17:50830434-50830456 CTGCTGGGACACAGCGAGGGCGG - Intergenic
1149671515 17:58416964-58416986 TTGCTGAGGCAGAGGGAGGGGGG + Exonic
1150128526 17:62653734-62653756 CTGTTGGGGAGGAGGGAGGAGGG + Intronic
1150280986 17:63929530-63929552 CTGCTGGGCCAGGCTGGGGAGGG + Intronic
1150345208 17:64399267-64399289 CAGCTGGGCAAAAGGGAGGCAGG + Intronic
1150462424 17:65363910-65363932 GTGGTGGGGGAGAGGGAGGAGGG - Intergenic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151284346 17:73099174-73099196 CTGCAGGACAAGAGGGTGGATGG + Intergenic
1151293452 17:73166285-73166307 CTGCAGGCCCTGAGGGAGGCGGG + Intronic
1151427702 17:74041755-74041777 ATGCAGGGACAGAGAGAGGAAGG - Intergenic
1151827609 17:76531847-76531869 CGGCTTGGCCAGAGGGAGGAGGG - Intronic
1152028944 17:77830044-77830066 TTACTGGGGCAGAGGGAGAAGGG - Intergenic
1152225363 17:79090302-79090324 CTGCCGGGCAGGAGGGAGGTGGG + Intronic
1152328836 17:79658694-79658716 GTGCTGTGCCAAAGGGATGATGG - Intergenic
1152392327 17:80010211-80010233 CTGATGGGCGAGAGGCAGAAGGG + Exonic
1152451259 17:80381924-80381946 CTGCTTGCCCAGAGGCTGGAAGG + Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152667637 17:81580508-81580530 CTGCTGGGGTAGAGGTGGGAGGG - Intronic
1152684378 17:81686911-81686933 CTGCTGTCCCACAGGGAGGTGGG + Intronic
1152693594 17:81733046-81733068 CTCCTGGGCCGCAAGGAGGAGGG - Intergenic
1152911842 17:83009711-83009733 GTGCTGGGTGCGAGGGAGGAAGG + Intronic
1155320509 18:24614184-24614206 CTGCAGGGCCAGCTGTAGGAGGG + Intergenic
1157294577 18:46433418-46433440 GTGCAGGGCCTGAGGTAGGAAGG - Exonic
1157297246 18:46455273-46455295 CTGCTGGGCCTGAAAGTGGAGGG + Intronic
1157714823 18:49876847-49876869 ATGCTGGAGCAGAGGGTGGAGGG - Intronic
1157913192 18:51638776-51638798 CTACTGGGAGAGAGGTAGGAGGG - Intergenic
1158024264 18:52877346-52877368 CTATTGGTCTAGAGGGAGGAGGG + Intronic
1159005148 18:63004525-63004547 CCGATGGGCCAGAGGGAGTGAGG + Intergenic
1159583423 18:70260749-70260771 CTGCAGGTCCACAGGCAGGAAGG + Intergenic
1159837188 18:73352611-73352633 CTGCTGGGCCAGAATGGGGGAGG + Intergenic
1160014611 18:75130923-75130945 CTGCTGGGACAGTGAGATGATGG + Intergenic
1160406755 18:78651693-78651715 CTGCAGGGCCAGAGGGTGTGTGG + Intergenic
1160406770 18:78651748-78651770 CTGCAGGGCCAGAGGGTGTGTGG + Intergenic
1160488231 18:79312660-79312682 CTACTGGTCAAGTGGGAGGAGGG + Intronic
1160565932 18:79786580-79786602 CTGCTGGGGCAGGGCCAGGACGG + Intergenic
1160665304 19:325362-325384 GGGCTGGGTCAGAGGCAGGACGG + Intronic
1160970403 19:1765364-1765386 CTGCTGGCTGGGAGGGAGGATGG - Intronic
1160984589 19:1832452-1832474 CTGCAGGGACAGCGGGAGGCCGG + Intronic
1161060404 19:2211825-2211847 CTGCTGGGCCAGGAGAAGGTGGG + Exonic
1161076576 19:2288660-2288682 CTGCTGGGCTGTGGGGAGGACGG + Intronic
1161118540 19:2512698-2512720 CTGCCAGGGCAGAGGGAGGAGGG - Exonic
1161249220 19:3271315-3271337 CTGCTAGGCTGGAGGCAGGAGGG - Intronic
1161257297 19:3316485-3316507 TGGCTGGACCAGAGTGAGGAGGG + Intergenic
1161304031 19:3557195-3557217 CTGCTGGGCCAGGTGGCCGACGG - Exonic
1161321676 19:3644334-3644356 CTGGTGGGCCACAGGGACGTGGG - Intronic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161475685 19:4483559-4483581 CGGCCGGGCAAGAGGGAGCAGGG - Intronic
1161608601 19:5228816-5228838 CAGCGGGGCCAGAGTGGGGAAGG - Intronic
1161619216 19:5289594-5289616 CGGCTGGAGCAGAGGGAGGAGGG - Intronic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161684804 19:5697487-5697509 AGGCTGAGGCAGAGGGAGGAGGG + Intronic
1161720387 19:5899012-5899034 CTGCTGGGCCAGGAGCAGGTGGG - Intronic
1162131769 19:8530366-8530388 CTGCGGGGACAGAGGGTGGAGGG + Intronic
1162327068 19:10005816-10005838 CTGCTGGGGGAGGGGGCGGAAGG + Exonic
1162393075 19:10401395-10401417 GCTCTGTGCCAGAGGGAGGAGGG + Intronic
1162433687 19:10644121-10644143 CTGCTGGGCTGGAGGGAGTTAGG + Exonic
1162577677 19:11508186-11508208 CAAATGGGACAGAGGGAGGAGGG - Intronic
1162975667 19:14206127-14206149 GTGCTGGGCCAGGGGAAGGAAGG - Exonic
1163025823 19:14511341-14511363 CTTCAGGGCCAGGGGAAGGATGG + Intergenic
1163123834 19:15233456-15233478 CTGTTGGGCCAGCAGGAGGACGG - Intergenic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163721004 19:18898319-18898341 GTGCTGGCCGAGAGGGTGGAGGG - Intergenic
1163828535 19:19536961-19536983 AGGCTGGGTCAGATGGAGGAGGG + Intronic
1164061419 19:21678435-21678457 CTGCTGGTGCAGAGCGAGGCTGG - Intergenic
1164064801 19:21706598-21706620 CTACTGGTGCAGAGGGAGGCTGG - Intergenic
1164402342 19:27910819-27910841 CTGCTGGGGCCGGGGGAGGAGGG + Intergenic
1164534538 19:29075472-29075494 CTGCTCTAGCAGAGGGAGGAGGG + Intergenic
1165121595 19:33562576-33562598 TAGCTGGGCCAGAGGGAGAGTGG + Intergenic
1165135451 19:33665683-33665705 CTGCTGGACCAGGGTGAGGCTGG + Intronic
1165386558 19:35513591-35513613 CTGCAGACCCAGAGGGAGGGAGG - Exonic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165420481 19:35719827-35719849 CTGCTAGGCGAGGAGGAGGAAGG - Exonic
1165453125 19:35896607-35896629 CTCCTGGGGCTGAGGGGGGATGG - Intronic
1165453207 19:35896919-35896941 CTGCTGGCCCAGGATGAGGAGGG - Exonic
1165462848 19:35954222-35954244 CTTCTGTGCCTGAGGAAGGAGGG - Intergenic
1165833877 19:38743267-38743289 CTCCCGGGTCTGAGGGAGGAGGG - Intronic
1165833890 19:38743302-38743324 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1165833902 19:38743339-38743361 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1165833915 19:38743374-38743396 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1165833928 19:38743411-38743433 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1165833941 19:38743446-38743468 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1165833967 19:38743520-38743542 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1165833979 19:38743555-38743577 CTCCGGGGTCTGAGGGAGGAGGG - Intronic
1165834016 19:38743666-38743688 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1165834029 19:38743703-38743725 CTCTTGGGTCTGAGGGAGGAGGG - Intronic
1165834042 19:38743738-38743760 CTCCTGGGTCTGAGGGAGGAAGG - Intronic
1165834077 19:38743846-38743868 CTCCTGGGTCTGAGGAAGGAAGG - Intronic
1165843288 19:38802261-38802283 TTGTTGGGTCTGAGGGAGGAGGG + Intronic
1165906260 19:39196615-39196637 CTCCTGGATCTGAGGGAGGACGG + Intergenic
1165906285 19:39196688-39196710 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1165906297 19:39196725-39196747 TTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1165906311 19:39196762-39196784 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1165906323 19:39196799-39196821 TTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1165906337 19:39196836-39196858 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1165924454 19:39318628-39318650 CTCTTGGGTCAGAGGGAAGAGGG - Intergenic
1165938384 19:39403162-39403184 CCCCTGGGTCTGAGGGAGGAGGG + Intergenic
1165938489 19:39403420-39403442 GTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1166081057 19:40444330-40444352 CTGGTGGGCCAGAGGCCAGACGG - Exonic
1166296672 19:41893331-41893353 CTCCTGGGTTTGAGGGAGGAGGG + Intronic
1166296701 19:41893408-41893430 CGCCTGGGTCTGAGGGAGGAGGG + Intronic
1166296717 19:41893447-41893469 CGCCTGGGTCTGAGGGAGGAGGG + Intronic
1166296734 19:41893486-41893508 CGCCTGGGTCTGAGGGAGGAGGG + Intronic
1166296751 19:41893525-41893547 CGCCTGGGTCTGAGGGAGGAGGG + Intronic
1166296766 19:41893563-41893585 CGCCTGGGTCTGAGGGAGGAGGG + Intronic
1166296782 19:41893601-41893623 CGCCTGGGTCTGAGGGAGGAGGG + Intronic
1166296811 19:41893677-41893699 CTCCTGGGTCTGAGGGAGGAAGG + Intronic
1166296828 19:41893716-41893738 CGTCTGGGTCTGAGGGAGGAGGG + Intronic
1166296844 19:41893755-41893777 CGCCTGGGTCTGAGGGAGGAGGG + Intronic
1166296860 19:41893794-41893816 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166296875 19:41893832-41893854 CTCCTGGGTCTGAGGGAGGAAGG + Intronic
1166296891 19:41893870-41893892 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166296907 19:41893908-41893930 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166297081 19:41894725-41894747 CGCCTGGGTCTGAGGGAGGAGGG + Intronic
1166297108 19:41894798-41894820 CACCTGGGTCTGAGGGAGGAGGG + Intronic
1166297120 19:41894831-41894853 CTCCTGGGTCTGAGGGAGGAAGG + Intronic
1166297134 19:41894866-41894888 CCCCTGGGTCTGAGGGAGGAGGG + Intronic
1166297161 19:41894934-41894956 CTCCTGGGTCTGAGGGAGGGAGG + Intronic
1166297208 19:41895075-41895097 CCCCTGGGTCTGAGGGAGGAGGG + Intronic
1166297221 19:41895108-41895130 TTCCTGGGTCTGAGGGAGGAAGG + Intronic
1166297236 19:41895144-41895166 CCTCTGGGTCTGAGGGAGGAGGG + Intronic
1166297248 19:41895181-41895203 CTCCTGTGTCTGAGGGAGGAGGG + Intronic
1166297258 19:41895212-41895234 CTCCTGGGTCTGAGGGAGGAAGG + Intronic
1166305375 19:41934566-41934588 CTCCTGGGTCTGAGGGAGGATGG + Intergenic
1166305386 19:41934603-41934625 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1166305423 19:41934713-41934735 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1166305450 19:41934788-41934810 CTCCTGGGTGTGAGGGAGGAGGG + Intergenic
1166305464 19:41934825-41934847 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1166305476 19:41934862-41934884 CTGCTGGGTCTGAGAGAGGAGGG + Intergenic
1166305488 19:41934899-41934921 TTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1166306170 19:41938215-41938237 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166306261 19:41938516-41938538 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166306276 19:41938553-41938575 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166306291 19:41938590-41938612 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166306307 19:41938628-41938650 CTCCTGGGTCTGAGGAAGGAAGG - Intergenic
1166306389 19:41938888-41938910 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166306404 19:41938925-41938947 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166306431 19:41938998-41939020 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166306459 19:41939072-41939094 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166306474 19:41939109-41939131 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166306489 19:41939146-41939168 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166306504 19:41939183-41939205 CTCCTGGGTCTGAGGAAGGAAGG - Intergenic
1166306596 19:41939482-41939504 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166306610 19:41939519-41939541 CTAGTGGGTCTGAGGGAGGAGGG - Intergenic
1166306637 19:41939592-41939614 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166306652 19:41939629-41939651 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166306681 19:41939701-41939723 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166306696 19:41939738-41939760 CTCCTGGGTCTGAGGAAGGAGGG - Intergenic
1166306710 19:41939775-41939797 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166313439 19:41975959-41975981 CCCCTGGGTCTGAGGGAGGAAGG - Intronic
1166313451 19:41975996-41976018 CCTCTGGGTCTGAGGGAGGAGGG - Intronic
1166313477 19:41976071-41976093 CCCCTGGGTCTGAGGGAGGAGGG - Intronic
1166313510 19:41976145-41976167 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166313548 19:41976248-41976270 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166313576 19:41976322-41976344 TTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166315011 19:41984847-41984869 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166315221 19:41985705-41985727 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166315236 19:41985742-41985764 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166315680 19:41988235-41988257 CCCCTGGGTCTGAGGGAGGAGGG - Intronic
1166316255 19:41991776-41991798 CCCCTGGGTCTGAGGGAGGAAGG + Intronic
1166316268 19:41991813-41991835 ATCCTGGGTCTGAGGGAGGAGGG + Intronic
1166316282 19:41991849-41991871 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166316310 19:41991919-41991941 CCCCTGGGTCTGAGGGAGGAGGG + Intronic
1166316336 19:41991990-41992012 CTCCTGGATCTGAGGGAGGAGGG + Intronic
1166316349 19:41992026-41992048 CTCCTGGATCTGAGGGAGGAGGG + Intronic
1166316387 19:41992132-41992154 CTCCTGGATCTGAGGGAGGAGGG + Intronic
1166347775 19:42177037-42177059 CTGCGAGGGGAGAGGGAGGAAGG + Intronic
1166382574 19:42362644-42362666 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166382589 19:42362681-42362703 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166382603 19:42362718-42362740 CTCCTGGGTCTGAGGGAGAAGGG + Intronic
1166382617 19:42362755-42362777 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166382642 19:42362827-42362849 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166382657 19:42362864-42362886 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166382669 19:42362901-42362923 CTCTTGGGTCTGAGGGAGGAGGG + Intronic
1166382693 19:42362970-42362992 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166384020 19:42370411-42370433 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166384065 19:42370558-42370580 CTCCTGGATCTGAGGGAGGAGGG + Intronic
1166384091 19:42370632-42370654 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166387733 19:42391470-42391492 CCCCTGGGTCTGAGGGAGGAGGG + Intergenic
1166388645 19:42396693-42396715 CTCCTGGGTCAGAGGGAGGAGGG - Intergenic
1166391477 19:42411105-42411127 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166391805 19:42412647-42412669 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166502592 19:43353182-43353204 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1166502607 19:43353219-43353241 CTCCTGGGTCGGAGGGAGGAGGG + Intergenic
1166502633 19:43353292-43353314 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1166502661 19:43353366-43353388 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1166502675 19:43353403-43353425 CTCCTGGGTCTGAGGGCGGAGGG + Intergenic
1166502688 19:43353440-43353462 CTCCTGGGTCTGAAGGAGGAGGG + Intergenic
1166504270 19:43361629-43361651 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166504361 19:43361876-43361898 CTCCTGGGTCTGAGGTAGGAGGG + Intronic
1166504375 19:43361913-43361935 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166504402 19:43361986-43362008 CTCCTCGGTCTGAGGGAGGAGGG + Intronic
1166506176 19:43373092-43373114 CTCCTGGGTCTGAGGTAGGAGGG - Intergenic
1166506190 19:43373129-43373151 CTCCTGGGACTGAGGGAGAAGGG - Intergenic
1166521895 19:43486435-43486457 CTCCTGGGTATGAGGGAGGATGG + Intronic
1166521910 19:43486472-43486494 CTCCTGGGTCTGAGGGTGGAGGG + Intronic
1166523176 19:43495026-43495048 CTCCTGGGTCTGAGGGAGGTGGG + Intronic
1166523188 19:43495062-43495084 CTCCTGGGTCTGAGAGAGGAGGG + Intronic
1166523200 19:43495098-43495120 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1166523214 19:43495134-43495156 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166523225 19:43495170-43495192 CTCCTGCGTCTGAGGGAGGAGGG + Intronic
1166523938 19:43499327-43499349 CTCCTGGGTCAGAGGGAGGAGGG + Intronic
1166523972 19:43499437-43499459 CTCCTGGGACAGAGGGAGAAGGG + Intronic
1166525333 19:43507061-43507083 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166525347 19:43507098-43507120 CTCCTGGGTCTGAGGGAAGAGGG - Intronic
1166525361 19:43507135-43507157 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166525375 19:43507172-43507194 CTCCTGGGTCTGAGGAAGGAAGG - Intronic
1166525387 19:43507209-43507231 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166525401 19:43507246-43507268 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1166525412 19:43507283-43507305 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166525427 19:43507320-43507342 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166525441 19:43507357-43507379 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166525461 19:43507409-43507431 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166525475 19:43507446-43507468 CTCCTGGATCTGAGGGAGGAGGG - Intronic
1166525517 19:43507562-43507584 CTCCTGGGTCTGAAGGAGGAGGG - Intronic
1166525546 19:43507636-43507658 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1166525587 19:43507752-43507774 CTCCTGGGTCTAAGGGAGGAGGG - Intronic
1166525615 19:43507826-43507848 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166525630 19:43507863-43507885 CTCCTGGGTCTGAGAGAGGAGGG - Intronic
1166525640 19:43507900-43507922 CTTCTGGGTCTGAGAGAGGAGGG - Intronic
1166531532 19:43546246-43546268 CTCCTGGATCAGAGGGAGGAGGG - Intronic
1166531545 19:43546282-43546304 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166531556 19:43546318-43546340 CTCCTGTGTCTGAGGGAGGAAGG - Intronic
1166531566 19:43546354-43546376 CTTCTGGGTCTGAGGGAGGAGGG - Intronic
1166531582 19:43546391-43546413 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166531597 19:43546428-43546450 CTCCTGGGTCTGAGGGATGAGGG - Intronic
1166531619 19:43546501-43546523 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1166531630 19:43546537-43546559 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1166532651 19:43552330-43552352 CTGCTGGGTCTGAGGGAGGAGGG - Intronic
1166532663 19:43552366-43552388 TTGCTGGGTCTGAGGGAGGAGGG - Intronic
1166532696 19:43552439-43552461 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166532712 19:43552476-43552498 CTCCTGGGCCTGAGGGAGGAGGG - Intronic
1166532757 19:43552587-43552609 CCCCTGGGTCTGAGGGAGGAGGG - Intronic
1166532785 19:43552661-43552683 CCCCTGGGTCTGAGGGAGGAGGG - Intronic
1166532929 19:43553293-43553315 TTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166546106 19:43635675-43635697 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1166546116 19:43635713-43635735 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1166546127 19:43635751-43635773 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1166546137 19:43635789-43635811 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166546149 19:43635826-43635848 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1166546159 19:43635863-43635885 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1166546204 19:43636013-43636035 CTCCTGGGTCTGATGGAGGAGGG - Intronic
1166568692 19:43780317-43780339 CTCTTGGGTCTGAGGGAGGAGGG - Intronic
1166568717 19:43780391-43780413 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166568730 19:43780427-43780449 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166568744 19:43780464-43780486 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166568756 19:43780501-43780523 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166568768 19:43780538-43780560 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166568780 19:43780575-43780597 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166568809 19:43780649-43780671 CTCCTAGGTCTGAGGGAGGAGGG - Intronic
1166569491 19:43784766-43784788 CTCCTGGTTCTGAGGGAGGAGGG + Intergenic
1166569510 19:43784819-43784841 CTCCTGGGTCTGAGGAAGGAGGG + Intergenic
1166569532 19:43784891-43784913 CTCCTGGTTCTGAGGGAGGAGGG + Intergenic
1166569552 19:43784963-43784985 CTCCTAGGTCTGAGGGAGGAGGG + Intergenic
1166569572 19:43785035-43785057 CTCCTGAGTCTGAGGGAGGAGGG + Intergenic
1166569595 19:43785105-43785127 CCCCTGGGTCTGAGGGAGGAGGG + Intergenic
1166571854 19:43802172-43802194 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166571868 19:43802209-43802231 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166662120 19:44654096-44654118 CTCCTGGGACTGAGGGAGAAGGG + Intronic
1166662148 19:44654170-44654192 CTCCTGGGTCTGAGGGAAGAGGG + Intronic
1166662176 19:44654242-44654264 CCCCTGGGTCTGAGGGAGGAGGG + Intronic
1166679029 19:44756416-44756438 CTCCTGGGTCTGAGGGAGGGGGG + Intronic
1166679043 19:44756451-44756473 CCCCTGGGTCTGAGGGAGGAGGG + Intronic
1166679054 19:44756487-44756509 CTCCTGGGTCTGATGGAGGAGGG + Intronic
1166679078 19:44756558-44756580 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1166679090 19:44756594-44756616 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166679103 19:44756630-44756652 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166679647 19:44758911-44758933 CTCCTGGATCTGAGGGAGGAGGG - Intronic
1166679721 19:44759119-44759141 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166682689 19:44778380-44778402 TTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166682716 19:44778453-44778475 CCCCTGGGTCTGAGGGAGGAGGG - Intronic
1166682731 19:44778489-44778511 TTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166682760 19:44778562-44778584 CCCCTGGGTCTGAGGGAGGAGGG - Intronic
1166682775 19:44778598-44778620 TTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166682804 19:44778671-44778693 CCCCTGGGTCTGAGGGAGGAGGG - Intronic
1166682819 19:44778707-44778729 TTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166682849 19:44778781-44778803 CCCCTGGGTCTGAGGGAGGAGGG - Intronic
1166682863 19:44778817-44778839 TTTCTGGGTCTGAGGGAGGAGGG - Intronic
1166682893 19:44778890-44778912 CCCCTGGGTCTGAGGGAGGAGGG - Intronic
1166683358 19:44781430-44781452 TTCCTGGGTCTGAGGGAGGAAGG + Intronic
1166683371 19:44781466-44781488 CTCCTGGATCTGAGGGAGGAGGG + Intronic
1166683386 19:44781502-44781524 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166683400 19:44781539-44781561 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166683415 19:44781576-44781598 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166683430 19:44781614-44781636 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166683444 19:44781651-44781673 CTCCTGGGTCTGAGGGAGGAAGG + Intronic
1166683458 19:44781687-44781709 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166683472 19:44781723-44781745 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166683486 19:44781759-44781781 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166683499 19:44781797-44781819 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1166683529 19:44781872-44781894 CTCTTGGGTCTGAGGGAGGAGGG + Intronic
1166683542 19:44781908-44781930 TTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166683556 19:44781944-44781966 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166683570 19:44781980-44782002 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166683582 19:44782017-44782039 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1166683594 19:44782054-44782076 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166683606 19:44782091-44782113 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1166685463 19:44793728-44793750 CTCCTGGGTCTGAGGGAAGAGGG + Intronic
1166685485 19:44793800-44793822 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166686725 19:44800755-44800777 CTCCTGAGTCTGAGGGAGGAGGG - Intergenic
1166686734 19:44800791-44800813 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166686744 19:44800827-44800849 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166686755 19:44800863-44800885 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166686766 19:44800899-44800921 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166686776 19:44800935-44800957 CTCCTGGGTCTGAGGAAGGAGGG - Intergenic
1166686786 19:44800971-44800993 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166686796 19:44801007-44801029 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166686815 19:44801079-44801101 CTCCTGGGTCTGAGGGAGAAGGG - Intergenic
1166686828 19:44801115-44801137 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166686838 19:44801151-44801173 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166686849 19:44801187-44801209 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166686859 19:44801223-44801245 CTCCTGGGTCTGAGGGAGAAGGG - Intergenic
1166686872 19:44801259-44801281 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166686882 19:44801295-44801317 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166686893 19:44801331-44801353 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166686903 19:44801367-44801389 CTCCTGGGTCTGAGGAAGGAGGG - Intergenic
1166686912 19:44801403-44801425 CTCCTGGGTCTGAGGGAGAAGGG - Intergenic
1166686925 19:44801439-44801461 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166686935 19:44801475-44801497 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166686946 19:44801511-44801533 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166686956 19:44801547-44801569 CTCCTGGGTCTGAGGGAGAAGGG - Intergenic
1166686965 19:44801583-44801605 CTCCTGGGTCTGAGGAAGGAGGG - Intergenic
1166686974 19:44801619-44801641 CTCCTGGGTCTGAGGGAGAAGGG - Intergenic
1166686987 19:44801655-44801677 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166686997 19:44801691-44801713 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166687008 19:44801727-44801749 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166687018 19:44801763-44801785 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166687027 19:44801799-44801821 CTACTGGGTCTGAGGAAGGAGGG - Intergenic
1166687036 19:44801835-44801857 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166687050 19:44801871-44801893 CTCCTAGGTCTGAGGGAGGAGGG - Intergenic
1166687063 19:44801907-44801929 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166687077 19:44801944-44801966 CTCCTGGGTCTGAGGGAGAAGGG - Intergenic
1166687090 19:44801980-44802002 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166687104 19:44802017-44802039 CTCCTGGGTCTGAGGGAGAAGGG - Intergenic
1166687117 19:44802053-44802075 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1166688824 19:44810922-44810944 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166688838 19:44810958-44810980 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166688851 19:44810994-44811016 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166688862 19:44811030-44811052 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1166688876 19:44811067-44811089 TTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166688888 19:44811103-44811125 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166689196 19:44812609-44812631 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166695805 19:44851027-44851049 CTTCTGGGTCTGAGGGAGGCGGG - Intronic
1166695831 19:44851098-44851120 CTCCTGGGTCTGAGGGAAGAGGG - Intronic
1166695889 19:44851280-44851302 CCCCTGGGTCTGAGGGAGGAGGG - Intronic
1166695901 19:44851316-44851338 CTCCTGGGTCTGAGGGAGCAGGG - Intronic
1166699495 19:44874128-44874150 CTCCTGGATCTGAGGGAGGAGGG + Intronic
1166704441 19:44900903-44900925 CTCCTGGGTCTGAGGGAGGACGG + Intronic
1166712234 19:44944925-44944947 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1166712960 19:44948939-44948961 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166712972 19:44948975-44948997 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166712987 19:44949012-44949034 CTCCTGGGTCTGAGGGAGGACGG - Intronic
1166713001 19:44949049-44949071 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166713014 19:44949086-44949108 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1166752366 19:45170400-45170422 GTGCTGAGCCTGAGGGAAGAGGG + Intronic
1166794789 19:45419880-45419902 CTCCTGGGTCTAAGGGAGGAGGG - Intronic
1166794836 19:45419993-45420015 CTCCTGGGTCTGAGGCAGGAGGG - Intronic
1166794862 19:45420067-45420089 CTCCTGGGTCCGGGGGAGGAGGG - Intronic
1166849975 19:45755064-45755086 GAGCTAGGCCAGAGGGAGGGAGG + Intronic
1167152562 19:47718658-47718680 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167152575 19:47718693-47718715 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167152588 19:47718729-47718751 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167152600 19:47718765-47718787 CTCCTGGATCTGAGGGAGGAGGG + Intronic
1167152613 19:47718800-47718822 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167152628 19:47718837-47718859 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167152663 19:47718943-47718965 CTCCTGGGTCTGAGGTAGGAGGG + Intronic
1167157766 19:47749953-47749975 GTGCTGGGCCAGCAGGAGGCAGG - Intronic
1167248651 19:48389823-48389845 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167248665 19:48389860-48389882 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167248680 19:48389897-48389919 CTCCTGGATCTGAGGGAGGAGGG - Intronic
1167248693 19:48389934-48389956 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167248708 19:48389971-48389993 CTCCAGGGTCTGAGGGAGGAGGG - Intronic
1167248723 19:48390008-48390030 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167248737 19:48390045-48390067 CTCCTGGATCTGAGGGAGGAGGG - Intronic
1167248748 19:48390080-48390102 CTCTTGGGTCTGAGGGAGGAGGG - Intronic
1167248761 19:48390115-48390137 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167248774 19:48390152-48390174 CTTTTGGGTCTGAGGGAGGAAGG - Intronic
1167248789 19:48390189-48390211 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167248803 19:48390226-48390248 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167248828 19:48390300-48390322 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167248843 19:48390337-48390359 CTCCTAGGTCTGAGGGAGGAGGG - Intronic
1167249278 19:48392001-48392023 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1167249303 19:48392075-48392097 CTCCTGGATCTGAGGGAGGAGGG - Intergenic
1167249367 19:48392254-48392276 CTCCTGGGTCTGAGGGAGGAAGG - Intergenic
1167249392 19:48392328-48392350 CCCCTGGGTCTGAGGGAGGAGGG - Intergenic
1167249409 19:48392365-48392387 CCCCTGGGTCTGAGGGAGGAGGG - Intergenic
1167249426 19:48392402-48392424 CCCCTGGGTCTGAGGGAGGAGGG - Intergenic
1167249442 19:48392439-48392461 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1167249641 19:48393214-48393236 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167264804 19:48478203-48478225 CTCCTGGGGCTGAGGGAGGTGGG + Intronic
1167264896 19:48478604-48478626 CTCCTGGGCCTGATGGAGGAGGG + Intronic
1167264910 19:48478640-48478662 CTCCTGGGTCTGATGGAGGAGGG + Intronic
1167264949 19:48478748-48478770 CTCCTGGGTCTGACGGAGGAGGG + Intronic
1167264994 19:48478858-48478880 CTCCTGGGTCTGACGGAGGAGGG + Intronic
1167265010 19:48478895-48478917 CTCCTGGGTGTGAGGGAGGAGGG + Intronic
1167265026 19:48478932-48478954 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167265042 19:48478969-48478991 CTGCTGGGTCTGAGGGAGGAGGG + Intronic
1167265057 19:48479006-48479028 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167265072 19:48479047-48479069 CTCCTGGGTATGAGGGAGGAGGG + Intronic
1167265799 19:48482732-48482754 CTCCTGGGTCTGAGGGAAGAAGG - Intergenic
1167265812 19:48482769-48482791 CTTCTGGGTCTGAGGGAGGAGGG - Intergenic
1167265826 19:48482805-48482827 CTCCTGGGTCTGAGGGAGGAAGG - Intergenic
1167265840 19:48482842-48482864 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1167265867 19:48482916-48482938 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1167265882 19:48482953-48482975 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1167265909 19:48483027-48483049 CTCCCGGGTCTGAGGGAGGAGGG - Intergenic
1167265925 19:48483064-48483086 CTCCCGGGTCTGAGGGAGGAGGG - Intergenic
1167265941 19:48483101-48483123 CTCCCGGGTCTGAGGGAGGAGGG - Intergenic
1167265957 19:48483138-48483160 CTCCCGGGTCTGAGGGAGGAGGG - Intergenic
1167265973 19:48483175-48483197 CTCCCGGGTCTGAGGGAGGAGGG - Intergenic
1167265989 19:48483212-48483234 CTCCCGGGTCTGAGGGAGGAGGG - Intergenic
1167266005 19:48483249-48483271 CTCCCGGGTCTGAGGGAGGAGGG - Intergenic
1167266021 19:48483286-48483308 CTCCCGGGTCTGAGGGAGGAGGG - Intergenic
1167266048 19:48483359-48483381 CTCCTGGGTCTCAGGGAGGAGGG - Intergenic
1167266063 19:48483396-48483418 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1167266089 19:48483469-48483491 CTCCTGGATCTGAGGGAGGAGGG - Intergenic
1167266100 19:48483505-48483527 CTTCTGGGTCTGAGGGAGGAGGG - Intergenic
1167266114 19:48483548-48483570 TTTCTGGGTCTGAGGGAGGAAGG - Intergenic
1167276630 19:48543866-48543888 CTCCTGGGTCTGAGGGAGGAAGG - Intergenic
1167276639 19:48543895-48543917 CTCCTGGGTCTGAGAGAGGAGGG - Intergenic
1167276650 19:48543932-48543954 CCTCTGGGTCTGAGGGAGGAGGG - Intergenic
1167276678 19:48544004-48544026 CTCCTGGATCTGAGGGAGGAGGG - Intergenic
1167276714 19:48544113-48544135 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1167276729 19:48544150-48544172 CTCCTGGATCTGAGGGAGGAGGG - Intergenic
1167276767 19:48544259-48544281 CTCCTGGGTCTGAGAGAGGAGGG - Intergenic
1167276808 19:48544370-48544392 CTCCCGGGTCTGAGGGAGGAGGG - Intergenic
1167276823 19:48544407-48544429 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1167276849 19:48544481-48544503 CTCCTGGGTCTGAGAGAGGAGGG - Intergenic
1167276874 19:48544555-48544577 CTCCCGGGTCTGAGGGAGGAGGG - Intergenic
1167276925 19:48544703-48544725 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1167286098 19:48599629-48599651 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167286135 19:48599741-48599763 CTCCCGGGTCTGAGGGAGGAGGG + Intergenic
1167286185 19:48599889-48599911 CCCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167288215 19:48610707-48610729 CTGCTGGGCCAGTTCCAGGAAGG + Exonic
1167298285 19:48664397-48664419 CTCCTGGGTCTGAGGGAAGAGGG - Intronic
1167298299 19:48664434-48664456 ACTCTGGGCCTGAGGGAGGAGGG - Intronic
1167298328 19:48664507-48664529 CTCCTGGGGCTGAGGGAGGAGGG - Intronic
1167308096 19:48720286-48720308 TTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167314278 19:48754967-48754989 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167314291 19:48755004-48755026 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167314314 19:48755078-48755100 CTCCTGGGTCTGAGGGAGTAGGG - Intronic
1167314323 19:48755115-48755137 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167314337 19:48755153-48755175 CTCCTGGATCTGAGGGAGGAGGG - Intronic
1167314347 19:48755188-48755210 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167314363 19:48755225-48755247 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167314374 19:48755261-48755283 CTTCTGTGTCTGAGGGAGGAGGG - Intronic
1167314655 19:48756524-48756546 TTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167314671 19:48756561-48756583 CCCCTGGGTCTGAGGGAGGAGGG + Intronic
1167314685 19:48756598-48756620 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167314700 19:48756635-48756657 CCCCTGGGTCTGAGGGAGGAGGG + Intronic
1167314714 19:48756670-48756692 CCCCTGGGTCTGAGGGAGGAGGG + Intronic
1167314925 19:48757577-48757599 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167314941 19:48757614-48757636 CCCCTGGGTCTGAGGGAGGAGGG + Intronic
1167322961 19:48807576-48807598 CTCCAGGGTCTGAGGGAGGAGGG - Intronic
1167322984 19:48807647-48807669 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167323910 19:48812588-48812610 CATCTGGATCAGAGGGAGGAGGG - Intergenic
1167327289 19:48834463-48834485 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167327312 19:48834536-48834558 CTCCTGGGTCTGAGGGAGGAAGG + Intronic
1167327338 19:48834610-48834632 CTCCTGGGTCTGAGGGAGGAAGG + Intronic
1167327364 19:48834684-48834706 CTCCTGGGTCTGAGGGAGGAAGG + Intronic
1167327377 19:48834721-48834743 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167327390 19:48834758-48834780 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167327403 19:48834795-48834817 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167327418 19:48834832-48834854 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167327442 19:48834905-48834927 CTCCTGGGTCTGAGGGAGGAAGG + Intronic
1167327455 19:48834942-48834964 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167327470 19:48834979-48835001 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167327506 19:48835089-48835111 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167327521 19:48835126-48835148 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167327557 19:48835236-48835258 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167327572 19:48835273-48835295 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167327587 19:48835310-48835332 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167327600 19:48835347-48835369 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167327632 19:48835456-48835478 CTCCTGGGTCTGAGGGAAGAGGG + Intronic
1167327670 19:48835566-48835588 CTTCTGGGTCTGAGGGAGGAGGG + Intronic
1167327696 19:48835640-48835662 CTCCTAGGTCTGAGGGAGGAGGG + Intronic
1167327732 19:48835750-48835772 CCTCTGGGTCTGAGGGAGGAAGG + Intronic
1167327951 19:48836743-48836765 CTCCCGGGTCTGAGGGAGGAGGG - Intergenic
1167327964 19:48836780-48836802 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1167327978 19:48836816-48836838 CTCCCGGGTCTGAGGGAGGAGGG - Intergenic
1167327990 19:48836853-48836875 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1167328187 19:48837615-48837637 GTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167328200 19:48837652-48837674 CTCCTGGGTCTGATGGAGGAGGG - Intronic
1167328214 19:48837689-48837711 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167328229 19:48837726-48837748 CTCCTGGATCTGAGGGAGGAGGG - Intronic
1167333844 19:48872733-48872755 GTCCTGAGCCTGAGGGAGGAGGG + Intronic
1167342067 19:48922083-48922105 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167354351 19:48994001-48994023 CTCCTGGGTCTGAGGGAGGGGGG + Intronic
1167367884 19:49064432-49064454 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167367897 19:49064473-49064495 CTTCTGGGTCTGAGAGAGGAGGG - Intronic
1167367909 19:49064511-49064533 CTCCTGGGTCTGAGGGAGAAGGG - Intronic
1167367938 19:49064596-49064618 CTCCTGGGTCTGAAGGAGGAGGG - Intronic
1167367963 19:49064672-49064694 CTCCTGGGTCTGAGAGAGGAGGG - Intronic
1167368148 19:49065295-49065317 GTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1167385021 19:49157977-49157999 TTCCTGGGTCAGACGGAGGAGGG + Intronic
1167387383 19:49171828-49171850 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167413768 19:49360163-49360185 CCACTGGGTCTGAGGGAGGAGGG + Intronic
1167413801 19:49360270-49360292 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1167425438 19:49427667-49427689 CTCCTGGGTCCGAGGGAGGAGGG + Intronic
1167425454 19:49427704-49427726 CTCCTGGGTGCGAGGGAGGAGGG + Intronic
1167425469 19:49427741-49427763 CTCCTGGGTCCGAGGGAGGAGGG + Intronic
1167425496 19:49427814-49427836 CTCCTGGGTCTGAGGGAGAAGGG + Intronic
1167425798 19:49429078-49429100 CCCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167425825 19:49429149-49429171 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167425892 19:49429331-49429353 CTCCTCGGTCTGAGGGAGGACGG + Intergenic
1167426955 19:49434370-49434392 CTCTTGGGTCTGAGGGAGGAGGG - Intronic
1167426970 19:49434407-49434429 CTCCTGGGTCTGAGAGAGGAGGG - Intronic
1167432113 19:49461118-49461140 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1167432124 19:49461154-49461176 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432137 19:49461190-49461212 TTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432150 19:49461226-49461248 CTCCTGGGTGTGAGGGAGGAGGG + Intronic
1167432163 19:49461262-49461284 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432176 19:49461298-49461320 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432189 19:49461334-49461356 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432200 19:49461370-49461392 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432211 19:49461406-49461428 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432225 19:49461441-49461463 CTCCGGGGTCTGAGGGAGGAGGG + Intronic
1167432238 19:49461478-49461500 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1167432249 19:49461514-49461536 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432263 19:49461551-49461573 TTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432573 19:49462813-49462835 CTCCTGGGTCCAAGGGAGGAGGG + Intronic
1167432596 19:49462886-49462908 CTCCTGGGTCTGAAGGAGGAGGG + Intronic
1167432621 19:49462957-49462979 TTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432635 19:49462993-49463015 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432661 19:49463064-49463086 TTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432676 19:49463100-49463122 TTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432690 19:49463137-49463159 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432715 19:49463211-49463233 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432730 19:49463248-49463270 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432755 19:49463319-49463341 TTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432769 19:49463355-49463377 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432783 19:49463392-49463414 TTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432810 19:49463466-49463488 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432825 19:49463503-49463525 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432850 19:49463574-49463596 TTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432864 19:49463610-49463632 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432878 19:49463647-49463669 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432905 19:49463721-49463743 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167432920 19:49463758-49463780 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167435497 19:49476319-49476341 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167435511 19:49476354-49476376 CTGCTGGGTCTGAGGGAGGAGGG - Intronic
1167441703 19:49512907-49512929 ACGCTGGGTCTGAGGGAGGAGGG + Intronic
1167441723 19:49512953-49512975 CTCCTGGGTCCGAGGGAGGAGGG + Intronic
1167441782 19:49513101-49513123 CTCCGGGGTCTGAGGGAGGAGGG + Intronic
1167460148 19:49620748-49620770 CTCCTGGGTCTGAGGGAGGAAGG + Intronic
1167460163 19:49620785-49620807 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167460220 19:49620959-49620981 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167460233 19:49620995-49621017 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167460246 19:49621031-49621053 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167460260 19:49621067-49621089 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167460273 19:49621103-49621125 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167460294 19:49621155-49621177 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167460308 19:49621191-49621213 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167460320 19:49621228-49621250 CTCTTGGGTCAGAGAGAGGAGGG + Intronic
1167460357 19:49621339-49621361 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167460369 19:49621376-49621398 CTCCTGGGTCCGAAGGAGGAGGG + Intronic
1167464128 19:49641189-49641211 CTCCTGAGTCGGAGGGAGGAGGG + Intergenic
1167474492 19:49691995-49692017 CTTCTGGGTCTGAGGGAGGAGGG + Intronic
1167474518 19:49692068-49692090 CTTCTGGGTCTGAGGGAGGAGGG + Intronic
1167478219 19:49713131-49713153 ATCCTGGGTCTGAGGGAGGAGGG - Intronic
1167478233 19:49713167-49713189 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167478249 19:49713204-49713226 CTCCCGGGTCTGAGGGAGGAGGG - Intronic
1167478265 19:49713241-49713263 CTCCCGGGTCTGAGGGAGGAGGG - Intronic
1167489153 19:49781843-49781865 CTTCTGGTTCTGAGGGAGGAGGG + Intronic
1167489234 19:49782199-49782221 CTCCTGGGTATGAGGGAGGAGGG + Intronic
1167489248 19:49782238-49782260 CTGCTGGGTCTGAGGGAGGAGGG + Intronic
1167489283 19:49782346-49782368 CTCGTGGGTCTGAGGGAGGAGGG + Intronic
1167489298 19:49782384-49782406 CTTGTGGGTCTGAGGGAGGAGGG + Intronic
1167495899 19:49818630-49818652 CTCCTGGGCCTGAGGGAGGAGGG + Intronic
1167495967 19:49818816-49818838 TTCCTGGGTCCGAGGGAGGAGGG + Intronic
1167496013 19:49818963-49818985 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167539333 19:50075271-50075293 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167560805 19:50225836-50225858 CCCCTGGGTCTGAGGGAGGAGGG + Intronic
1167560833 19:50225910-50225932 CCTCTGGGTCTGAGGGAGGAGGG + Intronic
1167560873 19:50226021-50226043 CCCCTGGGTCTGAGGGAGGAGGG + Intronic
1167560889 19:50226059-50226081 CCCCTGGGTCTGAGGGAGGAGGG + Intronic
1167560917 19:50226133-50226155 CCCCTGGGTCTGAGGGAGGAGGG + Intronic
1167560945 19:50226207-50226229 CCTCTGGGTCTGAGGGAGGAGGG + Intronic
1167560985 19:50226318-50226340 CCCCTGGGTCTGAGGGAGGAGGG + Intronic
1167561001 19:50226356-50226378 CCCCTGGGTCTGAGGGAGGAGGG + Intronic
1167561030 19:50226430-50226452 CCCCTGGGTCTGAGGGAGGAGGG + Intronic
1167593114 19:50415037-50415059 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167596899 19:50432688-50432710 CACCTGGGTCTGAGGGAGGAGGG - Intergenic
1167597398 19:50434978-50435000 CTCTTGGGTCTGAGGGAGGAGGG + Intronic
1167597412 19:50435015-50435037 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167597427 19:50435052-50435074 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167597660 19:50435901-50435923 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167600482 19:50451678-50451700 CTGTAGGGTCTGAGGGAGGAGGG + Intronic
1167600496 19:50451715-50451737 CTACTGGGTCTGAGGGAGGAGGG + Intronic
1167603425 19:50467398-50467420 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167630374 19:50622587-50622609 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167630865 19:50625640-50625662 CCTCTGGGTCTGAGGGAGGAGGG - Intronic
1167630886 19:50625685-50625707 CTCTTGGGCCTGAGGAAGGAGGG - Intronic
1167630911 19:50625758-50625780 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167630937 19:50625832-50625854 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167630951 19:50625868-50625890 GTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167631635 19:50629593-50629615 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167631651 19:50629630-50629652 CTCCCGGGTCTGAGGGAGGAGGG - Intronic
1167631667 19:50629667-50629689 CTCCCGGGTCTGAGGGAGGAGGG - Intronic
1167631683 19:50629704-50629726 CTCCCGGGTCTGAGGGAGGAGGG - Intronic
1167634839 19:50648654-50648676 TTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167662710 19:50805170-50805192 CCCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167668844 19:50838531-50838553 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167668901 19:50838702-50838724 CTGGGGGGTCTGAGGGAGGAGGG + Intergenic
1167668924 19:50838776-50838798 CTCCTGGGTCTGAGGGAGGTGGG + Intergenic
1167668964 19:50838910-50838932 CTCCTGGGTCTGAGAGAGGAGGG + Intergenic
1167668995 19:50838995-50839017 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167669053 19:50839155-50839177 CTCCTGGGTCGGTGGGAGGAGGG + Intergenic
1167669118 19:50839397-50839419 CTCTTGGGTCTGAGGGAGGAGGG + Intergenic
1167669169 19:50839569-50839591 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167669182 19:50839606-50839628 CTCCTGGGTCTGAAGGAGGAGGG + Intergenic
1167669194 19:50839630-50839652 CTGGGGGGTCTGAGGGAGGAGGG + Intergenic
1167671900 19:50858383-50858405 CTCCTAGGTCTGAGGGAGGAGGG + Intronic
1167678715 19:50906479-50906501 CCGCTGGGTCTGAGGGAGGAGGG + Exonic
1167678757 19:50906589-50906611 CCCCTGGGTCTGAGGGAGGAGGG + Exonic
1167678773 19:50906627-50906649 CTCCTGGGTCTGAGGGAGGAGGG + Exonic
1167678783 19:50906656-50906678 CTCCTGGGTCTGAGGGAGGAGGG + Exonic
1167678798 19:50906694-50906716 CTCCTGGGTCTGAGGGAGGAGGG + Exonic
1167678808 19:50906723-50906745 CTCCTGGGTCTGAGGGAGGAGGG + Exonic
1167678823 19:50906761-50906783 CTCCTGGGTCTGAGGGAGGAGGG + Exonic
1167678850 19:50906834-50906856 CTCCTGGGCCTGAGGGAGGAGGG + Exonic
1167688090 19:50968962-50968984 CTCCTGGGTCTGAGGGAGGAGGG + Exonic
1167688103 19:50969000-50969022 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1167688139 19:50969108-50969130 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167688162 19:50969179-50969201 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167688173 19:50969215-50969237 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167689077 19:50974789-50974811 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167689110 19:50974873-50974895 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167689127 19:50974916-50974938 CTCCTGGGTCTGAGGAAGGAGGG + Intergenic
1167689143 19:50974956-50974978 CTCCTGGGCCTGAGGGAGGAGGG + Intergenic
1167689159 19:50974996-50975018 TTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167689174 19:50975043-50975065 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167689188 19:50975083-50975105 CTCCTGGGTCTGAGGAAGGAGGG + Intergenic
1167689203 19:50975123-50975145 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167689223 19:50975169-50975191 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167689236 19:50975209-50975231 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167689252 19:50975250-50975272 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167689268 19:50975291-50975313 TTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167689283 19:50975333-50975355 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167689296 19:50975373-50975395 TTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167689313 19:50975417-50975439 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167689328 19:50975457-50975479 TTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167689343 19:50975501-50975523 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167689357 19:50975541-50975563 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167689372 19:50975581-50975603 TTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167689385 19:50975618-50975640 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167689400 19:50975658-50975680 TTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167689415 19:50975696-50975718 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167690087 19:50979997-50980019 CTCCTGGTTCCGAGGGAGGAGGG + Intronic
1167690102 19:50980034-50980056 CTGCTGGGTCTGAGGGAGGAGGG + Intronic
1167690114 19:50980070-50980092 CTCCCGGGTCTGAGGGAGGAGGG + Intronic
1167690130 19:50980107-50980129 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167690142 19:50980143-50980165 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167690157 19:50980180-50980202 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167690674 19:50982559-50982581 CCCCTGGGTCTGAGGGAGGAGGG - Intronic
1167690702 19:50982632-50982654 TTTCTGGGTCTGAGGGAGGAGGG - Intronic
1167690729 19:50982744-50982766 CTCCTGGGTCTGAGGGAGGAAGG - Intronic
1167690743 19:50982781-50982803 CTCCTAGGTCTGAGGGAGGAGGG - Intronic
1167690766 19:50982854-50982876 CTCCTGAGCCTGAGGGAGGAGGG - Intronic
1167690778 19:50982890-50982912 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167690816 19:50983000-50983022 CTCCTGAGCCTGAGGGAGGAGGG - Intronic
1167690828 19:50983036-50983058 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167690842 19:50983072-50983094 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167690867 19:50983145-50983167 CTCCTAGGTCTGAGGGAGGAGGG - Intronic
1167690877 19:50983181-50983203 CTCCTGGGCCTGAGGGAGGAGGG - Intronic
1167690891 19:50983217-50983239 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167690905 19:50983253-50983275 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167690919 19:50983289-50983311 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167690933 19:50983325-50983347 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167690947 19:50983361-50983383 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167690971 19:50983433-50983455 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167690986 19:50983470-50983492 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167690999 19:50983507-50983529 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167691014 19:50983544-50983566 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167693275 19:51000310-51000332 CTCCTGGGTCTGAAGGAGGAGGG - Intronic
1167693673 19:51002003-51002025 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167693688 19:51002044-51002066 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167705133 19:51077575-51077597 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167705161 19:51077648-51077670 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167705174 19:51077683-51077705 TTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167705189 19:51077720-51077742 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167705202 19:51077756-51077778 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167705217 19:51077793-51077815 CTCCCGGGTCTGAGGGAGGAGGG + Intronic
1167705232 19:51077829-51077851 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1167705247 19:51077866-51077888 CTCCCGGGTCTGAGGGAGGAGGG + Intronic
1167705263 19:51077903-51077925 CTCCTGGGTCTGAGGGAGGAGGG + Exonic
1167705491 19:51079020-51079042 CTCCTGGGTCGGAAGGAGGAGGG - Intronic
1167705517 19:51079092-51079114 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167705531 19:51079129-51079151 CTCCCGGGTCTGAGGGAGGAGGG - Intronic
1167705544 19:51079166-51079188 CTTCTGGGTCTGAGGGAGGAGGG - Intronic
1167705588 19:51079309-51079331 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167705601 19:51079344-51079366 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1167708837 19:51098245-51098267 CTCCTGGGTCTCAGGGAGGAGGG - Exonic
1167738200 19:51310415-51310437 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167738216 19:51310453-51310475 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167738231 19:51310490-51310512 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167738246 19:51310527-51310549 CTCCAGGGTCTGAGGGAGGAGGG + Intergenic
1167738261 19:51310564-51310586 CTCCAGGGTCTGAGGGAGGAGGG + Intergenic
1167738274 19:51310601-51310623 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167738300 19:51310675-51310697 CTCCTGGGCCTGAGGGAGGAGGG + Intergenic
1167738314 19:51310712-51310734 CTCCTGGCTCTGAGGGAGGAGGG + Intergenic
1167738342 19:51310786-51310808 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167738356 19:51310823-51310845 CTCCTGGGTCTGAGGGACGAGGG + Intergenic
1167738372 19:51310860-51310882 CTCCAGGGTCTGAGGGAGGAGGG + Intergenic
1167738387 19:51310897-51310919 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167738402 19:51310934-51310956 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167738418 19:51310971-51310993 CTCCAGGGTCTGAGGGAGGAGGG + Intergenic
1167738433 19:51311008-51311030 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167738448 19:51311045-51311067 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167738464 19:51311082-51311104 CTCCAGGGTCTGAGGGAGGAGGG + Intergenic
1167738479 19:51311119-51311141 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167738506 19:51311191-51311213 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167738536 19:51311264-51311286 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167738551 19:51311301-51311323 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1167738566 19:51311338-51311360 CTCCAGGGTCTGAGGGAGGAGGG + Intergenic
1167738579 19:51311375-51311397 CTCCTGGGTCTGAGAGAGGAGGG + Intergenic
1167741000 19:51325118-51325140 CTCCTGGGTCTGAGGGAGAAGGG + Intronic
1167741020 19:51325192-51325214 CTCCCGGGTCTGAGGGAGGAGGG + Intronic
1167741047 19:51325269-51325291 CTCCTGGGTCTGAAGGAGGAAGG + Intronic
1167743357 19:51337642-51337664 CTCTTGGGTCTGAGGGAGGAGGG + Intronic
1167743382 19:51337717-51337739 CTCCTGGGTCTGAGGGAAGAGGG + Intronic
1167746233 19:51353358-51353380 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746247 19:51353395-51353417 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746261 19:51353432-51353454 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746276 19:51353469-51353491 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746291 19:51353506-51353528 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746306 19:51353543-51353565 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746321 19:51353580-51353602 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746336 19:51353617-51353639 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746375 19:51353728-51353750 CCCCTGGGTCTGAGGGAGGATGG - Intronic
1167746398 19:51353802-51353824 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746452 19:51353950-51353972 CTCCTGGGTCTGAGGAAGGAGGG - Intronic
1167746476 19:51354024-51354046 CCCCTGGGTCTGAGGGAGGATGG - Intronic
1167746499 19:51354098-51354120 CTCCTGGGTCTGACGGAGGAGGG - Intronic
1167752780 19:51390740-51390762 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1167752821 19:51390886-51390908 CTTCCGGGTCTGAGGGAGGAGGG - Intergenic
1167752836 19:51390923-51390945 CTCCCGGGTCTGAGGGAGGAGGG - Intergenic
1167752870 19:51391035-51391057 CTTCCGGGTCTGAGGGAGGAGGG - Intergenic
1167781562 19:51601901-51601923 CTTCTGGCTCTGAGGGAGGAGGG + Intergenic
1167792985 19:51692297-51692319 CTGCCTGGCCGGAGGGAGGAGGG + Intergenic
1167795309 19:51704700-51704722 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1167795321 19:51704737-51704759 ATCCTGGGTCTGAGGGAGGAGGG - Intergenic
1167795360 19:51704851-51704873 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1167795398 19:51704964-51704986 CTCCTGGTTCTGAGGGAGGAGGG - Intergenic
1167798605 19:51726573-51726595 CTCCTGGGCCTGAGAGAGGAAGG - Intergenic
1167798614 19:51726611-51726633 ATCCTGGGTCTGAGGGAGGAGGG - Intergenic
1167798627 19:51726648-51726670 CTCCTGGGTCTGAAGGAGGAGGG - Intergenic
1167798647 19:51726721-51726743 CTCCTGGGTCTCAGGGAGGAGGG - Intergenic
1167798661 19:51726758-51726780 CTTCTGGGTCTGAGGGAGGTGGG - Intergenic
1167798686 19:51726831-51726853 CTCCTGGGTCTGAGGGAGGCGGG - Intergenic
1167798700 19:51726867-51726889 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1167798714 19:51726903-51726925 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1167798728 19:51726939-51726961 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1167798752 19:51727012-51727034 CTCCAGGGTCTGAGGGAGGAGGG - Intergenic
1167798771 19:51727055-51727077 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1167799431 19:51730531-51730553 CTCCTGGATCTGAGGGAGGAGGG + Intergenic
1167799444 19:51730567-51730589 CTTCTGGGTCTGAGGGAGGAGGG + Intergenic
1167799468 19:51730639-51730661 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1168056595 19:53868147-53868169 CTCCGGGGTCTGAGGGAGGAGGG + Intronic
1168056625 19:53868222-53868244 CTCCTGGGTCCGAGGGAGGAGGG + Intronic
1168056648 19:53868294-53868316 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1168057086 19:53869861-53869883 CTCCGGGGTCCGAGGGAGGAGGG + Intronic
1168057103 19:53869898-53869920 CTCCGGGGTCCGAGGGAGGAGGG + Intronic
1168057119 19:53869935-53869957 CTCCTCGGTCCGAGGGAGGAGGG + Intronic
1168057141 19:53869980-53870002 CTCCTGGGTCCGAGGGAGGAGGG + Intronic
1168057158 19:53870017-53870039 CTCCTGGGTCCGAGGGAGGAGGG + Intronic
1168057174 19:53870054-53870076 CTCCGGGGTCCGAGGGAGGAGGG + Intronic
1168057187 19:53870090-53870112 CTCCTGGGTCCGAGGAAGGAGGG + Intronic
1168057200 19:53870126-53870148 CTCCTGGGTCCGAGGAAGGAGGG + Intronic
1168057217 19:53870163-53870185 CTCCTGGGTCCGAGGGAGGAGGG + Intronic
1168057231 19:53870199-53870221 CTCCTGGGTCCGAGGGAGGAGGG + Intronic
1168057245 19:53870235-53870257 CTCCTGGGTCCGAGGGAGGAGGG + Intronic
1168057262 19:53870272-53870294 CTCCGGGGTCCGAGGGAGGAGGG + Intronic
1168057279 19:53870309-53870331 CTCCGGGGTCCGAGGGAGGAGGG + Intronic
1168057293 19:53870345-53870367 CTCCTGGGTCCGAGGGAGGAGGG + Intronic
1168057310 19:53870382-53870404 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168057326 19:53870419-53870441 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168077702 19:53990430-53990452 CTCCTGGATCTGAGGGAGGAGGG - Intergenic
1168077717 19:53990468-53990490 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168077730 19:53990503-53990525 CTCCTGGGTCTGAGGGAGGAAGG - Intergenic
1168077745 19:53990540-53990562 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168077761 19:53990577-53990599 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168077777 19:53990614-53990636 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168077792 19:53990651-53990673 CTCCTGGGTCTGAAGGAGGAGGG - Intergenic
1168077802 19:53990687-53990709 CTTCTGGGTCTGAGGGAGGAGGG - Intergenic
1168077817 19:53990724-53990746 CTCCTGAGTCTGAGGGAGGAGGG - Intergenic
1168077831 19:53990761-53990783 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168077845 19:53990797-53990819 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168077859 19:53990834-53990856 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168077875 19:53990871-53990893 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168077890 19:53990908-53990930 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168077905 19:53990945-53990967 CTCCTGGGTCTGAAGGAGGAGGG - Intergenic
1168077915 19:53990981-53991003 CTTCTGGGTCTGAGGGAGGAGGG - Intergenic
1168077928 19:53991017-53991039 CTCCTGAGTCTGAGGGAGGAGGG - Intergenic
1168077940 19:53991052-53991074 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168077953 19:53991088-53991110 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168077967 19:53991125-53991147 CTCCTGAGTCTGAGGGAGGAGGG - Intergenic
1168092594 19:54095683-54095705 CTCCTGGATCTGAGGGAGGAGGG + Exonic
1168092608 19:54095720-54095742 ATCCTGGGTCTGAGGGAGGAGGG + Exonic
1168095927 19:54114857-54114879 CTTCTGGGTCTGAGGGAGGAGGG - Intronic
1168097669 19:54124730-54124752 CAGCTGGGCCAGATGGTGGGTGG - Intronic
1168106618 19:54169412-54169434 CTCCTGGGTTTGAGGGAGGAGGG - Intronic
1168106631 19:54169447-54169469 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168107081 19:54172168-54172190 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168107207 19:54172501-54172523 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168107245 19:54172611-54172633 CTCCTGGGCCTGAGGGAGGAGGG - Intronic
1168107723 19:54174517-54174539 CTTCTCGGTCTGAGGGAGGAGGG - Intronic
1168107734 19:54174552-54174574 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168107748 19:54174588-54174610 CTCCTGGGTCTGAGGGAGGAAGG - Intronic
1168107759 19:54174624-54174646 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168107772 19:54174661-54174683 CTCCTGGATCTGAGGGAGGAGGG - Intronic
1168107783 19:54174698-54174720 CTCCTGGATCTGAGGGAGGAGGG - Intronic
1168107795 19:54174735-54174757 CTCCTGGATCTGAGGGAGGAGGG - Intronic
1168149224 19:54435957-54435979 CGCCTGGGTCTGAGGGAGGAGGG + Intronic
1168149239 19:54435993-54436015 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168155529 19:54471880-54471902 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168155543 19:54471917-54471939 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168155556 19:54471953-54471975 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168155571 19:54471991-54472013 CTCCTGGGTCTGAGGGAGGAAGG - Intronic
1168155585 19:54472028-54472050 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168155600 19:54472065-54472087 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168155614 19:54472102-54472124 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168155629 19:54472139-54472161 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168155655 19:54472214-54472236 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168155669 19:54472251-54472273 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168155684 19:54472288-54472310 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168155710 19:54472363-54472385 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168155724 19:54472400-54472422 TTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168155738 19:54472436-54472458 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168155752 19:54472474-54472496 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168155778 19:54472553-54472575 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168155793 19:54472590-54472612 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168155807 19:54472627-54472649 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168155822 19:54472664-54472686 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168155837 19:54472701-54472723 TTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168155851 19:54472737-54472759 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168155904 19:54472885-54472907 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168155929 19:54472960-54472982 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168155943 19:54472997-54473019 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168236024 19:55063599-55063621 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168236039 19:55063636-55063658 CTCCTGGGTCCAAGGGAGGAGGG + Intronic
1168236052 19:55063673-55063695 CTTCTGGGTCCGAGGGAGGAGGG + Intronic
1168236063 19:55063709-55063731 CTGCTGAGTCTGAGGGAGGAGGG + Intronic
1168237310 19:55071503-55071525 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168237324 19:55071540-55071562 CTCTTGGGTCTGAGGGAGGAGGG - Intergenic
1168238078 19:55076036-55076058 CTCCCGGGTCTGAGGGAGGAGGG + Intronic
1168238092 19:55076073-55076095 CTCCTAGGTCTGAGGGAGGAGGG + Intronic
1168238128 19:55076183-55076205 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168238153 19:55076255-55076277 CTTCTGGGTCTGAGGGAGGAGGG + Intronic
1168238167 19:55076292-55076314 CTCCTGGGCCTGAGGGAGGAGGG + Intronic
1168238521 19:55078266-55078288 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238559 19:55078377-55078399 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238573 19:55078414-55078436 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238587 19:55078451-55078473 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238601 19:55078488-55078510 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238615 19:55078525-55078547 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238629 19:55078562-55078584 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238640 19:55078599-55078621 CTCCTGAGTCAGAGGGAAGAGGG + Intronic
1168238654 19:55078636-55078658 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238668 19:55078673-55078695 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238682 19:55078710-55078732 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238696 19:55078747-55078769 CTCCTGGGTCAGAGGGAGGAGGG + Intronic
1168238710 19:55078784-55078806 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238725 19:55078821-55078843 CTCCTGGGTTTGAGGGAGGAGGG + Intronic
1168238739 19:55078858-55078880 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238767 19:55078932-55078954 CTCCTGGGTCTGATGGAGGAGGG + Intronic
1168239940 19:55083879-55083901 TTCCTGGGCCTAAGGGAGGAAGG + Intronic
1168242052 19:55093282-55093304 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242067 19:55093318-55093340 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242081 19:55093354-55093376 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242093 19:55093391-55093413 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242107 19:55093427-55093449 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242119 19:55093464-55093486 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242133 19:55093500-55093522 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242145 19:55093537-55093559 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242160 19:55093573-55093595 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242172 19:55093610-55093632 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242186 19:55093646-55093668 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242201 19:55093682-55093704 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242215 19:55093718-55093740 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242230 19:55093754-55093776 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242244 19:55093790-55093812 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242258 19:55093826-55093848 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242270 19:55093863-55093885 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242284 19:55093899-55093921 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242298 19:55093935-55093957 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242313 19:55093971-55093993 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242327 19:55094007-55094029 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242339 19:55094044-55094066 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242353 19:55094080-55094102 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242368 19:55094116-55094138 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242382 19:55094152-55094174 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242394 19:55094189-55094211 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242408 19:55094225-55094247 TTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242423 19:55094262-55094284 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242437 19:55094298-55094320 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168242854 19:55096008-55096030 CTCCTGGGTCCGAGGGAGGAGGG - Intronic
1168246172 19:55114083-55114105 CTCGTGGGTCTGAGGGAGGAGGG - Intronic
1168246187 19:55114119-55114141 CTCCTGGGTCCGAGGGAGGAGGG - Intronic
1168246201 19:55114156-55114178 CTCCTGGGTCTGAGGGTGGAGGG - Intronic
1168246216 19:55114192-55114214 CTCCTGGGTCCGAGGGAGGAGGG - Intronic
1168250198 19:55137516-55137538 ATCCTGGGTCTGAGGGAGGAGGG - Intronic
1168250211 19:55137553-55137575 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168250225 19:55137590-55137612 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168250257 19:55137695-55137717 CGCCTGGGTCTGAGGGAGGAGGG - Intronic
1168250284 19:55137768-55137790 CGCCTGGGTCTGAGGGAGGAGGG - Intronic
1168250308 19:55137840-55137862 TTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168252138 19:55147228-55147250 CTCCTGGGTGTGAGGGAGGAGGG + Intronic
1168252175 19:55147351-55147373 CTCCTGGGTCTGAGGAAGGAGGG + Intronic
1168252190 19:55147388-55147410 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168252214 19:55147460-55147482 CTCCTGGGTCTGAGGAAGGAGGG + Intronic
1168252228 19:55147496-55147518 CTTCTGGGTCTGAGGGAGGAGGG + Intronic
1168252238 19:55147533-55147555 CTCCTGGATCTGAGGGAGGAGGG + Intronic
1168252253 19:55147569-55147591 TTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168252279 19:55147652-55147674 CACCTGGGTCTGAGGGAGGAGGG + Intronic
1168252291 19:55147688-55147710 CTCCTGGATCTGAGGGAGGAGGG + Intronic
1168252306 19:55147725-55147747 CGCCTGGGTCTGAGGGAGGAGGG + Intronic
1168252320 19:55147762-55147784 CGCCTGGGTCTGAGGGAGGAGGG + Intronic
1168252364 19:55147910-55147932 CTCCTGCGTCTGAGGGAGGAGGG + Intronic
1168253531 19:55154887-55154909 CTCCTGGGTCTGAGGGAGAAGGG + Intronic
1168253587 19:55155038-55155060 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168253612 19:55155111-55155133 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168253625 19:55155147-55155169 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168253639 19:55155183-55155205 CTTCAGGGTCTGAGGGAGGAGGG + Intronic
1168253651 19:55155219-55155241 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168253665 19:55155255-55155277 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1168253691 19:55155327-55155349 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1168253729 19:55155435-55155457 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1168253743 19:55155471-55155493 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1168253756 19:55155507-55155529 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168253770 19:55155543-55155565 CTTCAGGGTCTGAGGGAGGAGGG + Intronic
1168253783 19:55155579-55155601 CTTCAGGGTCTGAGGGAGGAGGG + Intronic
1168253796 19:55155615-55155637 CTTCAGGGTCTGAGGGAGGAGGG + Intronic
1168253820 19:55155688-55155710 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168253834 19:55155724-55155746 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1168253849 19:55155761-55155783 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1168253863 19:55155797-55155819 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1168253877 19:55155833-55155855 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1168253903 19:55155905-55155927 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168253917 19:55155941-55155963 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1168254414 19:55157878-55157900 CTCCAGGATCAGAGGGAGGAGGG - Intronic
1168254483 19:55158097-55158119 CTCTTGGGTCTGAGGGAGGAGGG - Intronic
1168254507 19:55158170-55158192 CTCTTGGGTCTGAGGGAGGAGGG - Intronic
1168254521 19:55158206-55158228 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168254537 19:55158243-55158265 CCCCTGGGTCTGAGGGAGGAGGG - Intronic
1168254873 19:55159751-55159773 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168254903 19:55159825-55159847 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168255269 19:55161480-55161502 CTCCTGGGTCTGAGGGAGGCTGG - Intronic
1168255282 19:55161517-55161539 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168255295 19:55161554-55161576 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1168255308 19:55161586-55161608 CCCCTGGGTCTGAGGGAGGAGGG - Intronic
1168263082 19:55207661-55207683 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1168263095 19:55207697-55207719 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168263118 19:55207770-55207792 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1168263132 19:55207807-55207829 TTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168263155 19:55207880-55207902 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1168263167 19:55207916-55207938 CTCCTGGGTCTGAGGGAGTAGGG + Intronic
1168263181 19:55207953-55207975 TTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168263195 19:55207990-55208012 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168263218 19:55208063-55208085 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1168263231 19:55208099-55208121 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168263272 19:55208209-55208231 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1168263285 19:55208245-55208267 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168263299 19:55208282-55208304 TTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168263313 19:55208319-55208341 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168263336 19:55208392-55208414 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1168263349 19:55208428-55208450 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168263362 19:55208465-55208487 CTCCTGGGCCTGAAGGAGGAGGG + Intronic
1168263387 19:55208539-55208561 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1168263414 19:55208612-55208634 CTCCCGGGTCTGAGGGAGGAGGG + Intronic
1168263428 19:55208648-55208670 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168263441 19:55208685-55208707 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1168263454 19:55208721-55208743 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168263467 19:55208758-55208780 CTCCTGGGCCTGAAGGAGGAGGG + Intronic
1168263492 19:55208832-55208854 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1168263519 19:55208905-55208927 CTCCCGGGTCTGAGGGAGGAGGG + Intronic
1168263533 19:55208941-55208963 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168263548 19:55208978-55209000 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168266120 19:55224909-55224931 CTCCTGAGTCTGAGGGAGGAGGG - Intergenic
1168266131 19:55224945-55224967 CTCCTGCGTCTGAGGGAGGAGGG - Intergenic
1168266156 19:55225011-55225033 CTTCTGGGTCTGGGGGAGGAGGG - Intergenic
1168266172 19:55225048-55225070 CTCCTGAGTCTGAGGGAGGAGGG - Intergenic
1168266184 19:55225085-55225107 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168266198 19:55225122-55225144 CTCCTGAGTCTGAGGGAGGAGGG - Intergenic
1168266209 19:55225157-55225179 CTCCTGAGTCTGAGGGAGGAGGG - Intergenic
1168266220 19:55225192-55225214 CTCCTGAGTCTGAGGGAGGAGGG - Intergenic
1168266242 19:55225262-55225284 CTTCTGAGTCTGAGGGAGGAGGG - Intergenic
1168266255 19:55225299-55225321 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168277246 19:55284792-55284814 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168277257 19:55284828-55284850 CTCCTAGGTCTGAGGGAGGAGGG + Intronic
1168277317 19:55285011-55285033 CTCCAGGGTCTGAGGGAGGAGGG + Intronic
1168277331 19:55285048-55285070 CTTCTGGGTCTGAGGGAGGAGGG + Intronic
1168277375 19:55285196-55285218 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168277386 19:55285233-55285255 CTCCTGGGTCTGAAGGAGGAGGG + Intronic
1168277399 19:55285270-55285292 CTCCTGAGTCTGAGGGAGGAGGG + Intronic
1168277600 19:55286052-55286074 GTGCTGGGTCTGAGGGAGGAGGG + Intronic
1168277614 19:55286089-55286111 GTGCTGGGTCTGAGGGAGGAGGG + Intronic
1168277627 19:55286126-55286148 GTGCTGGGTCTGAGGGAGGAAGG + Intronic
1168277643 19:55286165-55286187 TTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168277655 19:55286201-55286223 CTCCTGGGTCTGAGGGAGGATGG + Intronic
1168277669 19:55286238-55286260 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168280372 19:55302415-55302437 CTCCTGGATCCGAGGGAGGAGGG + Intronic
1168283813 19:55320736-55320758 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168283827 19:55320774-55320796 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168283841 19:55320811-55320833 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168283867 19:55320886-55320908 TTTCTGGGTCTGAGGGAGGAAGG - Intronic
1168283881 19:55320923-55320945 CTCCTGGGTCTGAGGGTGGAGGG - Intronic
1168291565 19:55360057-55360079 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1168291577 19:55360093-55360115 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1168291590 19:55360130-55360152 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168291605 19:55360167-55360189 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1168291628 19:55360240-55360262 CTCCTGAGTCTGAGGGAGGAGGG - Intronic
1168291707 19:55360495-55360517 CTTCTGTGTCTGAGGGAGGAGGG - Intronic
1168291731 19:55360568-55360590 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168292003 19:55361615-55361637 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168292038 19:55361718-55361740 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168292047 19:55361754-55361776 CTCCTGGGTCTGAGGGTGGAGGG - Intronic
1168292060 19:55361792-55361814 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168292073 19:55361824-55361846 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168292105 19:55361934-55361956 CTCCTGGGTCTGAGGGAGGAGGG - Intronic
1168293671 19:55369087-55369109 CTCCTAGGTCTGAGGGAGGAAGG + Intronic
1168294735 19:55373134-55373156 CTCCCGGGTCTGAGGGAGGAGGG - Intergenic
1168294786 19:55373281-55373303 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168294808 19:55373353-55373375 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168294839 19:55373427-55373449 CTCCCGGGTCTGAGGGAGGAGGG - Intergenic
1168294867 19:55373499-55373521 CTCCCGGGTCTGAGGGAGGAGGG - Intergenic
1168294889 19:55373569-55373591 CTCCTGGGTGTGAGGGAGGAGGG - Intergenic
1168294904 19:55373606-55373628 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168294917 19:55373643-55373665 CTCCTGGGTCTGAGGGAGGAAGG - Intergenic
1168295222 19:55374797-55374819 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168295264 19:55374926-55374948 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168295279 19:55374963-55374985 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168295309 19:55375039-55375061 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168295342 19:55375121-55375143 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168295359 19:55375160-55375182 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168295374 19:55375197-55375219 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168295387 19:55375233-55375255 CTCCTGGGTCTGAGGGAGAAGGG - Intergenic
1168295401 19:55375272-55375294 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168295416 19:55375309-55375331 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168295428 19:55375345-55375367 CTCCCGGGTCTGAGGGAGGAGGG - Intergenic
1168295443 19:55375382-55375404 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168295846 19:55377115-55377137 CTCCTGGATCTGAGGGAGGACGG + Intronic
1168295860 19:55377149-55377171 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168295899 19:55377257-55377279 CTCCTGGGTGTGAGGGAGGAGGG + Intronic
1168295913 19:55377293-55377315 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168295939 19:55377362-55377384 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168295965 19:55377431-55377453 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168306268 19:55437934-55437956 CTCCTGGGTCTGAGGGAGGCGGG - Intronic
1168306283 19:55437971-55437993 CGCCTGGGTCTGAGGGAGGAGGG - Intronic
1168306295 19:55438008-55438030 CGCCTGGGTCTGAGGGAGGAGGG - Intronic
1168306310 19:55438045-55438067 CGCCTGGGTCTGAGGGAGGAGGG - Intronic
1168306325 19:55438082-55438104 ATCCTGGGTCTGAGGGAGGAGGG - Intronic
1168306335 19:55438115-55438137 CGCCTGGGTCTGAGGGAGGAGGG - Intronic
1168306349 19:55438152-55438174 CTGCTGGGTCTGAGGGAGGAGGG - Intronic
1168310113 19:55455904-55455926 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168310126 19:55455939-55455961 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168310140 19:55455976-55455998 CTCCTGGGTGTGAGGGAGGAGGG + Intronic
1168325411 19:55536367-55536389 CTCCTGGGTCTGAGGGAGGAGGG + Intronic
1168325655 19:55537285-55537307 CTCCTGGGTCTGAAGGAGGAGGG - Intergenic
1168325704 19:55537434-55537456 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168325752 19:55537581-55537603 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168325763 19:55537618-55537640 TTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168325774 19:55537655-55537677 CTCCTAGGTCTGAGGGAGGAGGG - Intergenic
1168325787 19:55537692-55537714 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168325801 19:55537728-55537750 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168325814 19:55537764-55537786 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168325900 19:55538105-55538127 CTCCTGGGCCTGATGGAGGAGGG + Intergenic
1168325913 19:55538143-55538165 CTCCTAGGTCTGAGGGAGGAGGG + Intergenic
1168325927 19:55538181-55538203 CTCCTGGGCCTGAGGGTGGAGGG + Intergenic
1168325941 19:55538219-55538241 CTCCTGGGCCTGAGGGAGGAGGG + Intergenic
1168325955 19:55538257-55538279 CTCCTGGGTCTGAGGGAGGAGGG + Intergenic
1168327751 19:55546754-55546776 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168327765 19:55546791-55546813 CTCCTGGGTCTGAGGGAGGAAGG - Intergenic
1168327777 19:55546828-55546850 CTCCTGGGTGTGAGGGAGGAGGG - Intergenic
1168327802 19:55546901-55546923 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168327846 19:55547047-55547069 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
1168327859 19:55547084-55547106 CTCCTGGGTCTGAGGGAGAAGGG - Intergenic
1168327878 19:55547150-55547172 CTCCTGGGTCTGAGGGAGGAGGG - Intergenic
925880111 2:8345373-8345395 AGGCTGGGTCAGGGGGAGGAAGG + Intergenic
926076980 2:9950499-9950521 CTGGTGGGGCACAGGGAGGCGGG - Intergenic
926126868 2:10277426-10277448 GTGGTGGACCAGATGGAGGACGG + Intergenic
926242283 2:11097426-11097448 CTCCTGAGCCACAGGGAGGATGG - Intergenic
926308549 2:11657894-11657916 TGGCTTGGCCAGAGGCAGGAGGG + Intergenic
926605871 2:14897950-14897972 TGGCTGGGCCAGAGTGAGGTGGG + Intergenic
927517280 2:23679862-23679884 CTGCTTGGCCAGATGGAGGAAGG + Intronic
927589444 2:24340572-24340594 CTGGTGGGACAGAGGCTGGAAGG - Intronic
927715913 2:25352734-25352756 CTGCTTCTCCAGAGGGAAGAGGG + Intergenic
927864593 2:26580449-26580471 CTGCTGGGGCAGGGGTGGGACGG + Intergenic
927865155 2:26583395-26583417 GTGCTGGGACAGAGTGGGGAGGG + Intronic
928006911 2:27570733-27570755 CTCCAGGGCCAGAGGGGGAAGGG + Intergenic
929561624 2:42959949-42959971 CTCCTGGGCCAGAGGCCAGATGG - Intergenic
929565107 2:42979086-42979108 ATTCTAGGCCAGAGGGAAGAGGG + Intergenic
930049842 2:47206477-47206499 TTACTGGGCAAGAGGGAGGTGGG + Intergenic
930103570 2:47621214-47621236 CTCCTGGGCCAGTGGCAAGATGG - Intergenic
930313764 2:49772591-49772613 CTTCCGAGCCTGAGGGAGGAAGG + Intergenic
930415844 2:51090347-51090369 CTGTTGGGACATAGGGAGAAAGG - Intergenic
930929204 2:56860460-56860482 CTGCTGTGCCAGAGGGACTGAGG + Intergenic
932448383 2:71794466-71794488 CTGCAGGGCCAGAGTGGGGAGGG + Intergenic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
933360500 2:81276784-81276806 TTGCTGGGGCAGAGGGAAGCAGG + Intergenic
933719117 2:85385658-85385680 ATGATGGGCCAGAGGGCGCAGGG + Intronic
933841790 2:86292830-86292852 CTGCTGTGTGAGAGCGAGGAGGG - Intronic
934752044 2:96799753-96799775 TGGCTGGGGCAGAGGGAGGCTGG + Intronic
935203843 2:100881176-100881198 CTGTTGGGGCCGAGGTAGGATGG - Intronic
935676265 2:105597224-105597246 CTGCTGGGGAAGAGAGAGGCAGG + Intergenic
935946166 2:108288641-108288663 CTTCGAGGCCAGTGGGAGGAGGG + Exonic
936071384 2:109374064-109374086 CTCATGGCCCTGAGGGAGGAGGG - Intronic
936076943 2:109407539-109407561 CTGCCAGGCCTGAGGCAGGAAGG - Intronic
936370874 2:111901192-111901214 CTGAAGGGCCAGGGAGAGGATGG + Intronic
936885747 2:117308779-117308801 CTCCTGGGGCAGAGGCAGGGAGG - Intergenic
937098005 2:119248222-119248244 CTGAGTTGCCAGAGGGAGGAAGG - Intronic
937869148 2:126775413-126775435 GTGCTGCACCAGAGGGACGAGGG + Intergenic
937904528 2:127046391-127046413 CTGCGGATCCAGAGGGAGGGAGG - Intergenic
937984995 2:127634413-127634435 CTGCTGGGACAGAGGTAGGTGGG + Intronic
938192340 2:129295125-129295147 GTAGTGGGGCAGAGGGAGGAGGG + Intergenic
938392615 2:130917113-130917135 CTGCTGGGCCCGAGGGCTGCCGG - Intronic
938779825 2:134575091-134575113 ATGGGAGGCCAGAGGGAGGAAGG + Intronic
938902055 2:135806882-135806904 TTGCAGGGCCAGATGGAGCAGGG - Intronic
939979393 2:148760130-148760152 CTACTGAGGCTGAGGGAGGAGGG + Intronic
941987459 2:171522888-171522910 CGGCTGGGCGGGAGGGAGGCTGG + Intronic
942089101 2:172471351-172471373 CTTCTGAGCAGGAGGGAGGACGG - Intronic
942961039 2:181829937-181829959 CTGTTGGGAGAGAAGGAGGAGGG - Intergenic
943529904 2:189066390-189066412 CTCCAGGGCCAGTGGGAGAAAGG - Exonic
946167991 2:217877125-217877147 CTCCTGGGCCAGGAGGAGGGGGG - Intronic
946179629 2:217941775-217941797 CTGGTGGGTCAGCAGGAGGATGG - Intronic
946347131 2:219119584-219119606 GTGCTGGGCCAGGGGCAGGGTGG - Intronic
946555270 2:220849377-220849399 CTACAGGGCTAGAGGGTGGAGGG + Intergenic
946893862 2:224303159-224303181 CTGCTGGGCTAAAGGGCTGAAGG + Intergenic
947404858 2:229764593-229764615 CTGCTAAGCCAGAAGGAAGACGG + Intronic
947761111 2:232604571-232604593 CTGCTGGGCCTGAAGGGGAAGGG - Intergenic
948143659 2:235692646-235692668 GTGCTGGGCCTGAGGGCTGAGGG - Intronic
948205562 2:236161115-236161137 CCGCTGGGGCAGAGGGAGGGTGG - Intergenic
948365037 2:237449246-237449268 TGGCTGGGTCTGAGGGAGGATGG - Intergenic
948456425 2:238106589-238106611 CTGGAGGGGCAAAGGGAGGATGG - Intronic
948695151 2:239729521-239729543 CGGGTGGGGCAGAGGGAGGCGGG + Intergenic
948795492 2:240400262-240400284 TTGCGGGGCTAGAGAGAGGAGGG + Intergenic
948814361 2:240502357-240502379 ATGTTGGGCCAGAGGGGAGAAGG - Intronic
948901241 2:240957857-240957879 CTGCTGGGCCAGTGGTCGGGAGG - Intronic
949032212 2:241802549-241802571 AGGCGGGGCCAGAGGGAGGCCGG + Intronic
949037148 2:241821127-241821149 CAGCTGGGGCAGTGGCAGGAGGG - Intergenic
1168788090 20:557106-557128 CTGCTGGGCCAGGAGCAGGGAGG + Intergenic
1169117007 20:3072296-3072318 CTCCGGGGCCAGGGGGAGGCGGG + Intronic
1169346901 20:4835899-4835921 GGGCTGGGCCAGGGGCAGGAAGG - Intergenic
1169423474 20:5477952-5477974 GAGCTGGGACAGAGGGAAGAAGG - Intergenic
1169427525 20:5508326-5508348 GAGCTGGGACAGAGGGAAGAAGG + Intergenic
1169935624 20:10880461-10880483 TTGCAGGGCCTGAGGCAGGATGG + Intergenic
1170545033 20:17428632-17428654 CTGCTGGGACAGTGCGAGTATGG - Intronic
1171455565 20:25270067-25270089 CTGCTGAGGGAGAGGGATGATGG - Intronic
1172046562 20:32084565-32084587 CCACAGGGCCAGAGGGTGGAGGG + Intronic
1172273578 20:33667891-33667913 CTGCTGGGCCAGGCTGAGCAGGG + Exonic
1172284821 20:33732840-33732862 CTGCTGGGCGTCGGGGAGGAAGG + Intronic
1172875876 20:38164182-38164204 GAGCTGGGCCCGAGGGAGGCAGG + Intronic
1172884533 20:38222395-38222417 CTCCTGGGCCAGAAACAGGATGG + Intronic
1173099724 20:40074432-40074454 CTTCTGTGCTAGAGGCAGGAAGG - Intergenic
1173222028 20:41138409-41138431 CCTCTGGGGGAGAGGGAGGAAGG + Intronic
1173643167 20:44617464-44617486 CTGCTGGTCCAGTGGGTGGCAGG + Intronic
1173684945 20:44916736-44916758 CACCTGGGCCACAGGGAGGAAGG - Exonic
1173686085 20:44924330-44924352 CTGCTGGGCGAGAGGGTGGAGGG - Intronic
1174421865 20:50404575-50404597 CTGCTGGGCTGGTGGCAGGATGG - Intergenic
1175191375 20:57214297-57214319 CTGCTGGGGCAGGGGGAGTGCGG - Intronic
1175348118 20:58297614-58297636 CTGCTGTCCATGAGGGAGGAGGG - Intergenic
1175901362 20:62361145-62361167 CTGCTGTGCCAGAGAGATGAGGG + Intronic
1175957590 20:62619150-62619172 ATGCTGGGCCAGTCGGGGGATGG + Intergenic
1176047226 20:63099247-63099269 CAGGTGGGTCTGAGGGAGGAAGG - Intergenic
1176357860 21:5967278-5967300 CTGCGTGGACAGAGGGCGGAGGG + Intergenic
1178416662 21:32410742-32410764 GAGCTGAGCCCGAGGGAGGAAGG - Intergenic
1178699307 21:34819855-34819877 CTGGCGGGCCAGAAGCAGGATGG - Intronic
1178989540 21:37341376-37341398 CTGCTGGGTTTGAGGGTGGAGGG - Intergenic
1179474314 21:41633495-41633517 CTGCTGGGGAAGAGGAAAGAGGG + Intergenic
1179727460 21:43348409-43348431 CTGATGTGGCAGAGGCAGGAAGG - Intergenic
1179765658 21:43571273-43571295 CTGCGTGGACAGAGGGCGGAGGG - Intronic
1180033515 21:45229050-45229072 CTGCTTGGCCAGAAGGCAGAAGG - Intergenic
1180062480 21:45392787-45392809 CTGCTGGGCCTGTGGGCAGAGGG + Intergenic
1180631474 22:17233094-17233116 GCGCTGAGACAGAGGGAGGAAGG + Intergenic
1180926120 22:19556165-19556187 CTGCAGGGCCAGAGGCAAGATGG - Intergenic
1181439184 22:22927067-22927089 CTGCTGGGCTTGAGGCAGGAAGG - Intergenic
1181467388 22:23117519-23117541 ATGCTGGGACAGAGGGAAGCAGG + Intronic
1181689030 22:24548133-24548155 CTCTTGGGCCAGTGGGTGGAGGG - Intronic
1181781650 22:25198081-25198103 CAGCTGGGACAGAAGGAGGAAGG - Intergenic
1182275391 22:29185279-29185301 CTGCTGAGCCCGAGGGAGTAGGG + Intergenic
1182283509 22:29231401-29231423 CTGCTGGGCCTGGAGGAGGGAGG - Intronic
1182354198 22:29714945-29714967 CTGCTGGGAGAGAAGGAGGAGGG + Intergenic
1182357987 22:29730817-29730839 CTGCTGGTCCCAAGGGAGAAGGG + Exonic
1182796671 22:32995992-32996014 CAGCTGCACCAGAAGGAGGAGGG + Intronic
1183058607 22:35321845-35321867 CAGGTGGGGCACAGGGAGGATGG + Intronic
1183779648 22:39990564-39990586 TTGCTGGGCCGGAGGGTGGAAGG + Intergenic
1184067239 22:42127799-42127821 GTGCAGGGGCCGAGGGAGGAAGG - Intronic
1184259762 22:43307932-43307954 TTGCTGGGCCAGAAGGGGGCTGG + Intronic
1184325739 22:43782935-43782957 CTGTTGGGGCAGGGGGAGGCAGG - Intronic
1184332213 22:43834154-43834176 CTGCTGGGCAAGAGGGCGACAGG + Intronic
1184364213 22:44039199-44039221 TTGCTGGGTCATAGGAAGGATGG - Intronic
1184368777 22:44069351-44069373 CTGCGGCCCCAGAGGGATGAGGG + Intronic
1184488403 22:44795474-44795496 CAGCTGGCCCAGAGGGTAGAGGG - Intronic
1185227581 22:49661630-49661652 CTGCTGGGCGAGTGGGAGGAGGG - Intergenic
949534771 3:4987168-4987190 CTGCTGGGCGCGAGGGAGGGGGG - Intergenic
950007029 3:9697999-9698021 CTGCTGGACCCGAGGTATGAAGG + Intronic
950138665 3:10600667-10600689 CTGCCGGGCCAGGGGCAGGGAGG - Intronic
950422419 3:12906747-12906769 CTGCTGGGCCCTGGGGCGGATGG + Intronic
951208414 3:19947623-19947645 CTGCTGCGCGTGAGGGAGAAGGG - Intronic
952494447 3:33903617-33903639 CTGCTGTGGCAGAAGGTGGAAGG + Intergenic
952590255 3:34944314-34944336 CAGATGGGACAGAGAGAGGAAGG - Intergenic
953108374 3:39908183-39908205 AGGCTGGGCCAGGGGAAGGAAGG + Intronic
953415193 3:42711736-42711758 CGGATGGGCCAGGGGGAGGCGGG + Intronic
953521179 3:43644783-43644805 CTGAAGGGCAAGTGGGAGGAAGG - Intronic
954332083 3:49896509-49896531 GTGCTGGCCAGGAGGGAGGAAGG - Intronic
954412067 3:50375101-50375123 CTTGTGGGTCAGAGGGAGGTTGG - Intronic
954425852 3:50442775-50442797 CAGCTGGGGTAGAGGGAGGAGGG + Intronic
954466242 3:50656787-50656809 CTCACGGGCTAGAGGGAGGAGGG - Intergenic
954578700 3:51691347-51691369 CTGCTCTGGCACAGGGAGGAGGG + Intronic
954659897 3:52221448-52221470 CTGCTGGGCCAGCAGGAAGCTGG + Exonic
955467249 3:59250194-59250216 CTGCTGGCACAGAGGAAGGAGGG + Intergenic
956048513 3:65222259-65222281 CTGCCGGGGCAGGGGGAGAATGG - Intergenic
956484040 3:69702706-69702728 CTCCTGGAGCAGAGGGTGGAGGG - Intergenic
959664135 3:108902688-108902710 CAGCTGGTCCAGGAGGAGGACGG - Intergenic
959925201 3:111913299-111913321 CTCCTGGAACACAGGGAGGAGGG - Exonic
960319895 3:116221736-116221758 CTCCAGGGCGAGAGTGAGGATGG - Intronic
960554806 3:119016134-119016156 TGGCTGGGCCAGAGCCAGGAAGG + Intronic
960997556 3:123349993-123350015 CTGCTGGGACAGCAGGTGGAAGG - Intronic
961159421 3:124710322-124710344 TGGCAGGGACAGAGGGAGGAAGG + Intronic
961182486 3:124887387-124887409 CTGGCGGGCCGGAGGGAGGAAGG - Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961567043 3:127771282-127771304 GAGCAGGACCAGAGGGAGGATGG - Intronic
961824776 3:129593259-129593281 CGGGTGGGGCAGAGGGAGGAGGG - Intronic
961869768 3:129978857-129978879 CTTTTGGGGCAGAGGGAGGCAGG + Intergenic
962434820 3:135356790-135356812 CTCCTTGGGCAGAAGGAGGAAGG - Intergenic
963001739 3:140688027-140688049 CTGGTGGACCAGATCGAGGACGG + Exonic
963913015 3:150830986-150831008 CGGATGGGACGGAGGGAGGAAGG - Intergenic
964405920 3:156349305-156349327 GGGCTGGGCCAGAGACAGGAAGG - Intronic
964726894 3:159822904-159822926 CTGTTTGGCAAGAGGGAGGTGGG + Intronic
964730671 3:159861204-159861226 GGGCTGGGCCAGAGGCAGGAAGG + Intronic
966848008 3:184145386-184145408 CACCTGGGGGAGAGGGAGGACGG + Intronic
966937367 3:184719809-184719831 CTGTTGGGCCAGAAGGTGGTTGG - Intergenic
967784528 3:193476741-193476763 CTGTTGGGTCACAGGGAGTAGGG + Intronic
967972274 3:195008004-195008026 CTGCTCGGCAGGAAGGAGGACGG + Intergenic
968226564 3:196976059-196976081 CAGCTGGGCCAGAGAAAAGAAGG - Intergenic
968229575 3:196997418-196997440 GTGCAGGGCCAGAGGGACGGGGG + Intronic
968266579 3:197367665-197367687 CTGCTGGGCCACAGACAGGAGGG + Intergenic
968518115 4:1023360-1023382 CTGCAGGCCCCGGGGGAGGAGGG - Intronic
968787891 4:2637621-2637643 CTGCTGAGCTAGAGGCAGAAAGG - Intronic
969276698 4:6140535-6140557 CTGCAGGGTCAGAGGGAAGTCGG + Intronic
969286768 4:6207343-6207365 TTCCAGGGCAAGAGGGAGGATGG + Intergenic
969299648 4:6290443-6290465 CTGCTGGGGCAGAGCGTGCAAGG + Intronic
969431950 4:7160531-7160553 GTGCTGCCCCAGAGGGAGGCTGG + Intergenic
969439270 4:7207911-7207933 CTGCTCGGCCACAGGCAAGATGG - Intronic
969523851 4:7694129-7694151 CTGCAGGGGCAGAGGAAGGATGG + Intronic
969871166 4:10106088-10106110 CTGCTGGGGGTGAGGGTGGAAGG + Intronic
970594391 4:17586633-17586655 CTGCAGGATCAGAGGGATGAGGG + Intronic
972418306 4:38863973-38863995 TGGCTGGAGCAGAGGGAGGATGG - Intergenic
972639391 4:40911886-40911908 GTGTAGGGGCAGAGGGAGGAGGG - Intronic
973650193 4:52991460-52991482 CAACTGGGCTAGGGGGAGGATGG + Intronic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
974087802 4:57279668-57279690 CTGGTGGAGGAGAGGGAGGATGG + Intergenic
977290317 4:95158964-95158986 CTGATGGGCCAGAGGAGGGAAGG + Intergenic
977290371 4:95159423-95159445 CTGATGGACCAGAGGAGGGAAGG + Intergenic
978802277 4:112766650-112766672 CTGCTGGGCTTGAGGGTAGAGGG - Intergenic
978823702 4:112994755-112994777 CTACTGGGGCAGAGGAAAGAAGG - Intronic
979495139 4:121374972-121374994 CGGCACAGCCAGAGGGAGGATGG - Intronic
979997025 4:127443539-127443561 CGGCTGGGCCTGAAGAAGGAAGG - Intergenic
980423896 4:132600035-132600057 CTGCTGGGACAGATGGAGGTTGG - Intergenic
981049812 4:140298647-140298669 CTGATTGGCCACAGGAAGGAAGG - Intronic
982081368 4:151793452-151793474 ATGGTGGGTCAGAGAGAGGAAGG + Intergenic
982265658 4:153536209-153536231 CTGATGGGGCAGAGGGAGTGAGG + Intronic
982265966 4:153538615-153538637 CTGCTTGCCCTGAGGGAGGCGGG - Intronic
982360297 4:154512232-154512254 CTGGAGGGCTGGAGGGAGGATGG + Intergenic
982485810 4:155964531-155964553 CTGCTGGGCTGGAGGGAGTGGGG - Intergenic
984040649 4:174728854-174728876 GTGTTGGGACAGAGGGAGGATGG + Intronic
984097431 4:175449624-175449646 CAGCTGGACCAGAGGGAGAAAGG + Intergenic
985044039 4:185922273-185922295 GGGCTGGGACAGAGAGAGGAAGG - Intronic
985551919 5:538092-538114 TTGGTGGGCCAGTGGGAGGCTGG + Intergenic
985778830 5:1859049-1859071 CTGCAGGGCCACAGGGTTGAGGG - Intergenic
985798650 5:1985862-1985884 CTGCTGGGCTAGGTGGAGGCAGG - Intergenic
986687380 5:10286631-10286653 CAGTTGGGCCAGAGGTAGTAAGG - Intronic
988067315 5:26237665-26237687 CTGCTTGGCCACAGGAAGGAAGG - Intergenic
988545927 5:32157277-32157299 CTGGTGGGAAAAAGGGAGGAAGG - Intronic
989163158 5:38410672-38410694 CTCCTGGGCCATAGGGAGGTTGG + Intronic
990010628 5:50993530-50993552 CTGCAGGGACAAAGGTAGGAGGG + Intergenic
990205981 5:53430176-53430198 ATGAGGGGCCAGAGGCAGGAGGG - Intergenic
991092508 5:62706624-62706646 GAGCTGGGCCTGAAGGAGGAAGG + Intergenic
992120525 5:73587598-73587620 CAGATGGGCCAGAGCCAGGAAGG - Intergenic
992151610 5:73909829-73909851 CTGCTGGGCCACTGGAAGCACGG + Exonic
992324942 5:75651380-75651402 ATGCTGGGCCATTTGGAGGATGG + Intronic
992614201 5:78534060-78534082 ATGCTGGGGCAGGGAGAGGAGGG + Intronic
994300619 5:98142702-98142724 CAGCTGGGACAGAGTGAGCATGG - Intergenic
997361464 5:133297900-133297922 CTGCTGGTCCAGATGAGGGATGG - Intronic
997377598 5:133408473-133408495 CTGGTGGAGCAGAGGGAGAAGGG + Intronic
997529674 5:134574091-134574113 CTGCTGGTGCTGAGGCAGGAAGG + Intronic
997734407 5:136202876-136202898 CTGCTGAGCCAGAGGGAGAGTGG + Intergenic
998253846 5:140570175-140570197 TGGCAGGGCCAGTGGGAGGAGGG - Intronic
999193080 5:149763148-149763170 CTGCAGGGCCAGAGTGGGGAGGG - Intronic
999341132 5:150774009-150774031 CTGATGGGCCAGTGGGAACAAGG + Intergenic
999879688 5:155848122-155848144 CTTCTGTTCCAGAGGGAGGGAGG + Intergenic
1000048439 5:157541113-157541135 CTGCTGTCCCACAGAGAGGAGGG + Intronic
1001299064 5:170520704-170520726 ATGGTGGGCGAGAGTGAGGAGGG - Intronic
1001573096 5:172743682-172743704 CAGGTGGTCCAGAGGAAGGAGGG + Intergenic
1001840600 5:174873159-174873181 CTGCTGGGCCGGTGGCAGGTGGG + Intergenic
1002133126 5:177093309-177093331 CTGTCGGGCCAGAGGGAAGCGGG - Exonic
1002334284 5:178467327-178467349 CTGCTGGCCAAGGGGGTGGAAGG - Intronic
1002813498 6:657037-657059 CTGGGGGGCCGGAGGGAGGGCGG - Intronic
1003522079 6:6866882-6866904 TTGCTGGGGCTGGGGGAGGAGGG + Intergenic
1004287901 6:14339613-14339635 CAGGTGGGTCAGGGGGAGGAGGG - Intergenic
1005134852 6:22556318-22556340 CTGCTGGAGTAGAGGAAGGATGG - Intergenic
1006038113 6:31229962-31229984 GTGCTGGGGCAGAGGCAGGTGGG - Intergenic
1006093668 6:31642910-31642932 CTGCAGGGCCAGGGGCTGGAGGG - Exonic
1006300505 6:33191496-33191518 CTGGCTGGCCAGAGGGAGGAGGG + Intronic
1006419426 6:33924059-33924081 TTCCTGGGCCACAGGCAGGAAGG + Intergenic
1006498148 6:34438995-34439017 CTGCTGGGGCAGAGAAAGGGAGG - Intergenic
1006511692 6:34525149-34525171 CGGGTGGGTGAGAGGGAGGACGG - Intronic
1007359570 6:41345465-41345487 CTTCTTGGCAAGAGTGAGGAGGG + Intronic
1007396277 6:41579510-41579532 CTGCTGACCCAGGGGTAGGAGGG + Intronic
1007403061 6:41615586-41615608 CAGCTAATCCAGAGGGAGGAGGG + Intergenic
1007757140 6:44107220-44107242 CTGATGGGTCAGAGGGAGGCAGG - Intergenic
1007768652 6:44176624-44176646 CTGCTGCACAAGACGGAGGACGG + Exonic
1010656586 6:78518534-78518556 CTGCTATGGCAGAGGGAGGTGGG - Intergenic
1013317675 6:108957632-108957654 GTGCAGGGCTAGAGGGAGGTAGG - Intronic
1014047686 6:116912179-116912201 CTGCTGGGGAAGGGGGAAGAGGG + Intronic
1014159613 6:118152771-118152793 CTGCTCTGCCAAAGGGAGGCAGG - Intronic
1016010898 6:139135974-139135996 GTGCCGGGCCGAAGGGAGGAAGG + Intronic
1016384464 6:143516856-143516878 GGGCTGGGCAAGAGGGAGAAAGG + Intergenic
1016395302 6:143617631-143617653 CTGCTAGACTGGAGGGAGGAAGG - Intronic
1016841924 6:148533517-148533539 CTGCAGGGCAGGAGGGTGGAGGG + Intronic
1016852505 6:148635531-148635553 GTGCTGACCCAGAGGCAGGAAGG + Intergenic
1016986158 6:149897542-149897564 CAGCTGGGGCAGGGAGAGGACGG - Intronic
1017631225 6:156397757-156397779 CTGCTAGCCCAGAGGGAGGAAGG + Intergenic
1017960025 6:159213484-159213506 CTGCTGGGCCCTGGGGAGGATGG - Intronic
1018028283 6:159822464-159822486 CAGCTGGGCCACAGGGAGAGGGG - Intergenic
1019315062 7:380518-380540 CAGCTCGGACAGAGGGAGGGAGG + Intergenic
1019549162 7:1593700-1593722 CTGCTGGCCAAGGGGAAGGAAGG + Intergenic
1019575202 7:1734453-1734475 CTGCGAGCCCAGAGGTAGGATGG + Intronic
1019609336 7:1929081-1929103 CTGCTCGGCCTCAGGGAGGAGGG - Intronic
1019637881 7:2086100-2086122 CTGCTGGCCAGGAGGGAGGGAGG - Intronic
1019925719 7:4190888-4190910 ATGCTGGGCCGGAGGGTGGAGGG + Intronic
1020106043 7:5422770-5422792 CTGATGGGAGAGAGGGAGGGAGG - Intronic
1020211126 7:6158870-6158892 CAGCTGGTCCAGCGGGAGGGAGG + Intronic
1022464884 7:30646957-30646979 CTGAATGGCCAGAGGGAGTACGG + Intergenic
1022470001 7:30676296-30676318 CTGCTGGGAGAGAGGGAAGGTGG - Intronic
1023221419 7:37922965-37922987 CTGCTGGTCCAGGGGGATGCAGG + Intronic
1023659946 7:42460903-42460925 CTGCAGGCCCAGTGCGAGGAAGG + Intergenic
1023838831 7:44084179-44084201 CTGCTGGCACAAGGGGAGGATGG - Intergenic
1024561561 7:50649266-50649288 GTGCTGTGTCAGAGGGAGGCTGG + Intronic
1024633479 7:51268069-51268091 CTGCAGGGCAGGAGGGAGGAAGG - Intronic
1024693296 7:51826627-51826649 CTGCTGGGGCAGGGGGACGAGGG + Intergenic
1025029487 7:55545505-55545527 ATACTGGGCCAGAAAGAGGATGG - Intronic
1026737596 7:72959057-72959079 CTGCTGCGCAAGGGTGAGGACGG + Intergenic
1026788629 7:73317856-73317878 CTGCTGCGCAAGGGTGAGGAGGG + Intronic
1027106137 7:75406011-75406033 CTGCTGCGCAAGGGTGAGGACGG - Intronic
1027211128 7:76149944-76149966 CAGCTGGGGCCGTGGGAGGAAGG - Intergenic
1027269951 7:76513668-76513690 CTGCTGGGCTCCAGGGAGCAGGG + Intronic
1028504601 7:91557349-91557371 ATTCTGGGCAAGAGGCAGGAGGG - Intergenic
1029121421 7:98270676-98270698 GGGCTGGGCCAGAGAGAGGATGG + Intronic
1029172967 7:98643778-98643800 CTGCTGTGCCAGGTGGAGAAGGG + Intergenic
1029692201 7:102189962-102189984 CTGCTGAGCCAGAGGGCAGGGGG - Intronic
1029744039 7:102506869-102506891 CTGGTGGGGCTGAGGGTGGAGGG - Intronic
1029762029 7:102606032-102606054 CTGGTGGGGCTGAGGGTGGAGGG - Intronic
1030451588 7:109719534-109719556 CTGCAAGGCCACAGTGAGGATGG + Intergenic
1031117910 7:117688043-117688065 TTGCTGGGGCAGAGGGAGGGTGG + Intronic
1031135755 7:117882429-117882451 GTGCTGGGGCAGAGGGAAGTGGG + Intergenic
1031886107 7:127247585-127247607 TTGGTGGGGCAGAGTGAGGATGG + Intronic
1032163310 7:129526879-129526901 CTGCTGGGCTAGTGGGAGTGCGG + Intergenic
1032870218 7:135977168-135977190 CCGCCGGGCGAGAGGGAGGCAGG + Exonic
1033339219 7:140479083-140479105 CTGCGGCGCGGGAGGGAGGAGGG - Intronic
1033643815 7:143286245-143286267 CTACAGGGAGAGAGGGAGGATGG - Intronic
1034337141 7:150330885-150330907 CTGCTGGCCCAGAGGGAGAAGGG + Exonic
1034538445 7:151740377-151740399 CTGCTGTGCCTGAAGGATGAAGG - Intronic
1034560580 7:151877152-151877174 TTTCTGGGCGAGAGGGAGGGCGG + Intergenic
1035297650 7:157876254-157876276 CTGCTGGGCCTGAGGTAAGGCGG + Intronic
1036391727 8:8329794-8329816 CTGCTGCTCCACAGGGAGGAGGG + Intronic
1036616853 8:10394706-10394728 CTGCTGGGGCAGAGTGCAGAAGG - Intronic
1036662303 8:10716178-10716200 CTGCTGGGACAGGGCGGGGAAGG + Intergenic
1036950013 8:13132080-13132102 TTCCTGGGCCGGAGAGAGGAAGG - Intronic
1037780026 8:21861587-21861609 CTGCTGTGCCAAAGGGTGGTGGG - Intergenic
1037833254 8:22201313-22201335 CTGTCCGGCCAGAGGGAGGTGGG - Intronic
1037889884 8:22618499-22618521 GTGCTGGGGCAGAGGAAAGAAGG - Intronic
1037936307 8:22917237-22917259 CTTCTGGGCCTGATGGAGAAGGG - Intronic
1038307895 8:26421167-26421189 CTGGTGGTCCAGAAGGAGGGTGG + Intronic
1038818276 8:30928996-30929018 CTTATAGGCCAGAGGGAGTATGG - Intergenic
1039877859 8:41602887-41602909 CTCCTGCGGCAGAGGGATGAGGG + Intronic
1040928861 8:52714027-52714049 CCGCTGTGCCAGATGGGGGAAGG + Intronic
1042110244 8:65374016-65374038 CTACTGGGCAGGAGGGAGGGAGG + Intergenic
1042351321 8:67780569-67780591 CTGGTAGGCCTGAGGGAAGAAGG - Intergenic
1042420662 8:68584881-68584903 CTGTGGAGCCAGAGGGAGAAGGG - Intronic
1042824429 8:72965716-72965738 CTGCGAGGCCAGAAGCAGGATGG + Intergenic
1044625769 8:94234281-94234303 CTGAAGCGCCAGAGGGCGGATGG - Intergenic
1044818984 8:96143424-96143446 ATGGTGGGCCTCAGGGAGGATGG - Exonic
1045796420 8:106050466-106050488 CTGCTGGGACCCAGGGAGGAGGG - Intergenic
1045826967 8:106409261-106409283 TTGTGGGGCCAAAGGGAGGATGG + Intronic
1046064573 8:109181282-109181304 CTCCTAGGCCTGAAGGAGGAAGG - Intergenic
1046791449 8:118326601-118326623 TTGGGGGGCTAGAGGGAGGATGG - Intronic
1048571838 8:135663225-135663247 AGGCTGGGCCAGAGGGTGAAGGG - Intergenic
1048861448 8:138727175-138727197 GTGCTGGAGCTGAGGGAGGAGGG - Intronic
1049203237 8:141351837-141351859 CTGCTGGGCCAGTGGGGCGGGGG + Intergenic
1049212814 8:141394538-141394560 AGGCTGGGCTAGAGGCAGGAGGG + Intronic
1049412146 8:142478173-142478195 CTGCCCGGCCCGGGGGAGGAAGG - Exonic
1050388139 9:5111644-5111666 CTGCTGGGCGGGAGGGACGAGGG - Intronic
1050847416 9:10239819-10239841 CTGAGGGGCAAGAGGCAGGAGGG - Intronic
1051206911 9:14697620-14697642 CTCCTAGGCAAGAGGGAGGAAGG - Intergenic
1052989172 9:34508646-34508668 CTGCTTGGCTTGAGGAAGGAAGG - Intronic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053309197 9:37005161-37005183 CTGCTGGGCTAGGGTGAAGAGGG - Intronic
1053379445 9:37636539-37636561 CAGATGGGCCAGAGGGAGATGGG + Intronic
1053449324 9:38180004-38180026 CTGCTGGGCCAGCAGGGAGATGG + Intergenic
1053860769 9:42384707-42384729 CTGCAGGGCATGCGGGAGGACGG - Intergenic
1056571993 9:87824681-87824703 CTGCTGGGCCCGGCGGAGGCGGG + Intergenic
1056751737 9:89356931-89356953 CTGGTGCACCAGAGAGAGGATGG - Intronic
1057083294 9:92188489-92188511 CTGCTGGGGCCCAGGGAGGGAGG + Intergenic
1058633339 9:107011637-107011659 CTGCTGGGCAAGATGGTGAATGG + Exonic
1059336528 9:113572559-113572581 CTGCAGGCCCTGAAGGAGGAGGG + Intronic
1059392410 9:114007521-114007543 TTTCTGGGTAAGAGGGAGGAGGG - Intronic
1059672808 9:116507552-116507574 ATTGTGGTCCAGAGGGAGGATGG - Intronic
1059937141 9:119322579-119322601 ATTCTGGGCCAGAGGTAGAAGGG + Intronic
1060427569 9:123519325-123519347 CTGTTAGGCTAGAGAGAGGAGGG - Intronic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061196447 9:129109721-129109743 CTACGGGGCCAGAGGGCGGAGGG - Intronic
1061277714 9:129579026-129579048 TTGTTGGGGGAGAGGGAGGATGG - Intergenic
1061371790 9:130201538-130201560 GGGCTGGGCCTGGGGGAGGAGGG + Intronic
1061505951 9:131032025-131032047 CTCCTGGGGCAGAGGGGAGAGGG - Exonic
1061680771 9:132241509-132241531 TTGCGGGGACAGAGGGAGGGAGG + Intronic
1061716332 9:132520778-132520800 CTCCTGGGCCAGGGGGCAGAAGG - Intronic
1061792988 9:133068312-133068334 TTGCTGGGCCTGAAGCAGGAAGG - Intronic
1061795592 9:133084096-133084118 TTGCTGGGCCTGAAGCAGGAAGG - Intronic
1061887367 9:133598592-133598614 CTGGTGGGAGAGAGGGAGGGAGG + Intergenic
1062235094 9:135504059-135504081 CTGCAGGGCCAGAAGGAGCCCGG + Exonic
1062432294 9:136531611-136531633 CTGCTGGGCGGGAGGAAGGAAGG - Intronic
1062480329 9:136748059-136748081 CTGCTGGGCTGGAGGCTGGAGGG - Intronic
1062538523 9:137031409-137031431 CCGCTGGGCCAGGGGCAGGTGGG + Exonic
1062614407 9:137389493-137389515 CTGCTGGGAAAGCGGGATGAGGG + Intronic
1062669352 9:137697900-137697922 ATTCTGGTCCAAAGGGAGGATGG + Intronic
1186511764 X:10134994-10135016 TTTCTGGGCCAGAGGGTGGATGG + Intronic
1186814325 X:13221183-13221205 CTGCTGGTCCAGAGAGAGTGAGG - Intergenic
1189328691 X:40129653-40129675 CTGCGGGGCCTTAGGGAGGTGGG + Intronic
1190321490 X:49182468-49182490 CTGCTGGCGCAGAGTGAGCAAGG - Intronic
1190745799 X:53321184-53321206 CGGCTGGGCCCGGGGGAGGGTGG - Exonic
1191775377 X:64807902-64807924 CTGCTGGTCCAAAGGGACTATGG - Intergenic
1195922994 X:110001845-110001867 ATGGTAGGCCAGTGGGAGGAAGG - Intergenic
1197277132 X:124492804-124492826 CTGGTGGGGCAGTGGGAGGCAGG + Intronic
1197726398 X:129779849-129779871 CTGCCGGCCCCTAGGGAGGAAGG - Intergenic
1198074668 X:133182913-133182935 CTGCTAGGCCAGAGGCAGCTAGG + Intergenic
1198320296 X:135513334-135513356 CAGAGGGGCCAGAGAGAGGATGG - Intergenic
1198839213 X:140838713-140838735 CTAGTGGGCCAGATGGAGTATGG - Intergenic
1199697635 X:150354317-150354339 TTCCTGGGCCTCAGGGAGGAGGG + Intergenic
1200053971 X:153449105-153449127 CTGCTGGGGGAGGGGGATGATGG - Intronic
1200088537 X:153623682-153623704 CGGCTGGGCCAGGAGGAGGGAGG + Intergenic
1200088684 X:153624384-153624406 GGGCTGGGCCACCGGGAGGAAGG + Intergenic
1200780335 Y:7209897-7209919 CTGCTGGCCCTGAGGAAGGTGGG + Intergenic
1201378073 Y:13343328-13343350 CTGATGGGGCAGAGGGGGCATGG + Intronic