ID: 1083592669

View in Genome Browser
Species Human (GRCh38)
Location 11:63904606-63904628
Sequence GTGGTGAGAAGGAAGTCTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083592669_1083592675 20 Left 1083592669 11:63904606-63904628 CCACGAGACTTCCTTCTCACCAC 0: 1
1: 0
2: 0
3: 14
4: 159
Right 1083592675 11:63904649-63904671 TTCCTTCTGTGTCCTCGTGATGG 0: 1
1: 0
2: 0
3: 18
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083592669 Original CRISPR GTGGTGAGAAGGAAGTCTCG TGG (reversed) Intronic
900815909 1:4845596-4845618 GCTGTGAGAAGGATGTCTGGAGG + Intergenic
903102231 1:21040560-21040582 GGGGTGGGAAGGCAGTCTAGAGG + Intronic
903273101 1:22204133-22204155 GGGGTGATGAGGAAGTCTCAAGG + Intergenic
903467493 1:23562134-23562156 GTGGGGAAAAAGAAGTCTCTTGG - Intergenic
904898877 1:33840439-33840461 GAGGTCTGAAGGAAGTCTTGAGG - Intronic
906291496 1:44622398-44622420 GTGGAGAGAAGGGGGTCTCCAGG + Intronic
907691347 1:56669801-56669823 GTGGTGAAAAGCAAGTTTAGGGG + Intronic
908323924 1:63004997-63005019 GTGGTGAAAAGAATGTCTGGTGG + Intergenic
909149208 1:71979462-71979484 GTGGTGAGAAGGAAATCAGATGG + Intronic
911567538 1:99480792-99480814 TTGGTTAGAAGGAAGTTTAGAGG - Intergenic
913288449 1:117249756-117249778 ATGGTGAGAAAGAAGCCTAGTGG + Intergenic
914227560 1:145733780-145733802 GGGGTGAGAAGTGAGTCTTGGGG - Intronic
914409858 1:147416316-147416338 ATTGTGAGAAGGAAGTTTAGAGG + Intergenic
915214473 1:154330653-154330675 GAGGAGAGAAGGGAGTCTCAAGG - Intronic
916212860 1:162372807-162372829 GGGGTGAGAAGCATGGCTCGAGG + Intronic
918079169 1:181192461-181192483 GTGGTGAGAAGCAAATAGCGTGG - Intergenic
919818045 1:201454227-201454249 TTGGTTAGAAGCAAGTCACGAGG + Intergenic
922582758 1:226710849-226710871 GTGGGGAGAAGGAAGTCAGGTGG + Intronic
923684768 1:236146391-236146413 ATGGTGGGAAGGAAGTCGTGGGG + Intronic
924388384 1:243523010-243523032 GTGGTGAGAAGGAAAGATAGGGG + Intronic
1062945230 10:1456334-1456356 GTGTTGAGAAGGAAGTGACTTGG - Intronic
1063280442 10:4623919-4623941 GTTGTGAGAAGTAACTCTCTTGG - Intergenic
1064380034 10:14833376-14833398 GTGGTACGAAGGAAGTCTAAAGG - Intronic
1065409321 10:25406213-25406235 GTGGTGAAATGGAAGTTTCCTGG + Intronic
1065555879 10:26915119-26915141 GTGGAGACAAGTAAGTCTCTAGG - Intergenic
1070949387 10:80418763-80418785 GTTGGGAGAAGGAAGGCTGGAGG + Intronic
1072432307 10:95384041-95384063 ATGGTGAGAAGGTAGTCAAGAGG - Exonic
1075563730 10:123487981-123488003 CTGGTGAGAAGGAAGGATCTGGG + Intergenic
1076591631 10:131587510-131587532 GTGGTGAGGAGGCAGCCTAGGGG - Intergenic
1076656315 10:132026060-132026082 GAGGTGAGAAGGAAGTGAGGTGG + Intergenic
1076850591 10:133090640-133090662 GTCTTGAGAAGGAAGCCTGGAGG + Intronic
1078894210 11:15583783-15583805 CTGGTGAGCAGGAAGTCTTGAGG - Intergenic
1079454047 11:20622029-20622051 ATGGTGAGAAGGATGCCTGGAGG + Intronic
1083592669 11:63904606-63904628 GTGGTGAGAAGGAAGTCTCGTGG - Intronic
1084266190 11:68006550-68006572 GTGGTGTGAAGGGAATCACGTGG - Intergenic
1085032401 11:73280703-73280725 GTGGGGAGAGGGAAGTCCAGTGG + Intronic
1088784012 11:113164433-113164455 GTGATGTGAGGGCAGTCTCGTGG - Intronic
1089292045 11:117443382-117443404 GTGCTGTGAAGGAAGGCTCTGGG - Intronic
1092286297 12:7130773-7130795 GGGGTGGGAAGGAGGTGTCGAGG + Intronic
1092343546 12:7696701-7696723 GTGGTGAGAAACAAGGCTGGCGG - Intergenic
1092912997 12:13164675-13164697 GTGGTGAGAAGGTGGGCTCTGGG + Intergenic
1094291514 12:28855705-28855727 TTGGGAAGAGGGAAGTCTCGAGG + Intergenic
1095744784 12:45645643-45645665 GCTGTGAAAAGGAAGTTTCGGGG + Intergenic
1098003740 12:65972516-65972538 GTGGTGAGGAGGAAGGCCTGTGG + Intergenic
1098081578 12:66791559-66791581 GTTGTAAGGATGAAGTCTCGAGG + Intronic
1101018273 12:100524926-100524948 GTGTTGAGGTGGAAGTCTTGGGG + Intronic
1103836855 12:123828662-123828684 GAGGAGAGGAGGAAGTCTCTTGG - Intronic
1104860879 12:131922819-131922841 GTGATGAGGAAGAAGTCACGGGG - Exonic
1106353468 13:28956748-28956770 CTGGTGGGAAGGAAGTGTGGCGG + Intronic
1106353508 13:28956928-28956950 CTGGTGGGAAGGAAGTGTTGGGG + Intronic
1108113277 13:47100969-47100991 GTGGTGAGAAGGGTGTCTGCTGG - Intergenic
1108373960 13:49796217-49796239 GAGGTGTTAAGGTAGTCTCGTGG - Intergenic
1115506949 14:34101853-34101875 GTGGCGAGAAGGAAGCCAGGAGG - Intronic
1117728924 14:58702052-58702074 TTAGTTAGAAGGAAGTCTCAGGG + Intergenic
1117844330 14:59895154-59895176 TTGGTTAGAAGGAAGTCTCAGGG - Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1125069257 15:35532393-35532415 GTGGTGAGAATGAAGTCAAGGGG + Intronic
1126262738 15:46713337-46713359 GTGTTGAGAAGAGAGTCTAGGGG + Intergenic
1126965425 15:54047408-54047430 GTGGGGAGAAGGAAGGGTAGGGG - Intronic
1131506666 15:93025617-93025639 GTGGTGAGAAGGAAAGCTACAGG + Exonic
1132045609 15:98560662-98560684 GAGGTGAGAAGGAAGAATGGGGG + Intergenic
1132320432 15:100920844-100920866 GTGAGGAGAAGGAGGTCTCCTGG - Intronic
1132348366 15:101121951-101121973 CTGGAGAGAAGGAAGTCCCCAGG + Intergenic
1132702513 16:1228166-1228188 GTGGGGAGAAGCCAGCCTCGGGG + Intronic
1132705811 16:1242702-1242724 GTGGGGAGAAGCCAGCCTCGGGG - Intergenic
1133211053 16:4263740-4263762 GCGGTGAGAAGGCAGCCTGGGGG + Intronic
1133584957 16:7184195-7184217 GTGGAGAGAAGGAAGTGGAGAGG + Intronic
1136081917 16:27857699-27857721 ATGGAGAGAAAGAAGTCTCAGGG - Intronic
1139341197 16:66269204-66269226 GTGGTGAAGAGGATGTCTCTGGG - Intergenic
1141300631 16:82812375-82812397 GTGGTCAGCAGGAAGCCTTGAGG + Intronic
1143097046 17:4483659-4483681 GGGGTGAGAAGGAAGTCCTTGGG + Intronic
1151200875 17:72467331-72467353 GTGATGAGAAGGAGGTGTCTGGG + Intergenic
1152101707 17:78305338-78305360 GTGGTGAGATAGAAGCTTCGAGG + Intergenic
1152498880 17:80695003-80695025 GTAGTGAGCAGGAAGCCTGGGGG + Intronic
1153137578 18:1934255-1934277 TGGGTGAAAAGGAAGTCTGGGGG - Intergenic
1153940233 18:9970438-9970460 AGGGTGAGAAAGAAGTTTCGAGG - Intergenic
1154354343 18:13613640-13613662 GTGGTGAGAAGTAATTGTAGTGG + Intronic
1156879367 18:42058435-42058457 CTAGGGAGAAGGAAGTCTCCAGG - Intronic
1159927017 18:74278516-74278538 GTGGTGAGAAGGGGGTCCCTTGG - Intronic
1162119280 19:8452561-8452583 GTGGTGTGAAGCCAGTCTTGTGG + Intronic
1162615550 19:11798062-11798084 CTGGTGAAAATGAAGTCTAGGGG + Intronic
925649220 2:6071404-6071426 GTGGAGAAATGGAAGTCTCCAGG - Intergenic
925841176 2:7993964-7993986 CTGGTGTGAGGGCAGTCTCGTGG - Intergenic
925904807 2:8534150-8534172 GTGTTGAGAAGGAAGCCACATGG - Intergenic
928332721 2:30369917-30369939 GGGGTGAGAAGGAGGGCTAGGGG + Intergenic
929573226 2:43036489-43036511 GTGGTGTGAAGGAAAGCTTGGGG + Intergenic
929594773 2:43169291-43169313 GTGGTGGGAGGGAGGTTTCGGGG + Intergenic
935050710 2:99522777-99522799 GAGGTGGGAAGAAAGTCTCTTGG - Intergenic
937869927 2:126779470-126779492 CTGGTGAGAAGCAACTCTCAGGG - Intergenic
941970236 2:171342215-171342237 TTGATGGGAAGGAAGTCTTGTGG - Intronic
942929448 2:181472020-181472042 GTGGAGAGAAAGAAGTTTCAGGG + Intronic
946827988 2:223698512-223698534 GTGGAGAGAAGGTAGTCATGGGG - Intergenic
947806078 2:232969007-232969029 GTTGTGTGAAAGAAGTCTAGAGG - Intronic
1169323526 20:4655503-4655525 GTGGTGAGAAGGGAGTCAGTTGG + Intergenic
1175382660 20:58574578-58574600 GTGGTGAGATGGATGTTTGGTGG - Intergenic
1177854974 21:26390535-26390557 CTGGTGAGAGGAAAGTCTCTCGG - Intergenic
1182416607 22:30225329-30225351 TTGCTGAGAAGGAAGTGTCCGGG + Intergenic
1183736573 22:39647988-39648010 GTGCTGAGAAGGAAGTCGGCAGG + Intronic
1184018102 22:41800846-41800868 GTGGTGGGGAGGGAGTTTCGTGG + Intronic
1184519916 22:44987302-44987324 GAGGTGAGAAGGAAGGCCAGTGG + Intronic
1184622348 22:45690917-45690939 GTGGTGACAGGGAAGCCTGGAGG - Intronic
1184859503 22:47165192-47165214 GTGGTGAGGAGGATGTGTCAGGG + Intronic
950258953 3:11529961-11529983 GGAGTGAGAAGGAAGTCTCTGGG - Intronic
954048902 3:47956596-47956618 ATGGTGACAAGGAAATCTGGGGG + Intronic
954366955 3:50151363-50151385 GTGGGGAGAGGGAAGCCTGGAGG - Intergenic
956340735 3:68221089-68221111 GTGGCCAGAGGGAAGTCTTGAGG - Intronic
956886946 3:73569766-73569788 GTGAAGAGAAGGAACTCTCGAGG + Intronic
959426616 3:106197636-106197658 GTGGTGAGAAATAAGACTAGAGG - Intergenic
964724093 3:159796203-159796225 GTGGTGAGAATGCATTCTAGTGG + Intronic
969370162 4:6726940-6726962 GAGGAGAGAAGGAAGACTGGGGG + Intergenic
969576493 4:8039015-8039037 GTGTGGGGAAGGAAGCCTCGAGG - Intronic
969875155 4:10130891-10130913 GTTGGGAGAAGGAAGCCTCCTGG + Intergenic
974793969 4:66724931-66724953 GTGATGAGAAGGAAGCTTTGTGG + Intergenic
976298570 4:83496365-83496387 GAGGTGAGGAGAAAGTCTCTTGG - Intronic
976669083 4:87631763-87631785 GTGGTAGGAAGGAAGTCTCAAGG + Intergenic
984231037 4:177099348-177099370 GTGATGAGAAGGAGGTATGGGGG - Intergenic
985626562 5:991917-991939 GTGGGGAGCAGGAAGTATCTGGG - Intergenic
986062976 5:4209252-4209274 GAGGTGAGAAGGCAGGGTCGGGG + Intergenic
986255551 5:6100299-6100321 GGGGTGAGAAGGAGGTCCCCGGG - Intergenic
987610228 5:20193567-20193589 TTGGGGAGTAGGAAGTCTAGAGG - Intronic
987967744 5:24897339-24897361 TTGTTGTGAAGGAAGTCTCTAGG - Intergenic
988563260 5:32299761-32299783 ATGGTGAGAGAGAAGTCTTGAGG - Intronic
991028728 5:62059668-62059690 GTGGTGAGAAGGAAAGATGGAGG - Intergenic
991527700 5:67580175-67580197 TTGGAGATAAGGAAGTCTAGGGG + Intergenic
1002971678 6:2029364-2029386 GTGGTGAGAAGGAATTTGAGGGG - Intronic
1003270840 6:4606480-4606502 GGGGTGAGAAGCAAGTGTCTCGG - Intergenic
1004110477 6:12713330-12713352 GTGTGGAGAAAGAAGTCTCAGGG - Intergenic
1005194813 6:23270720-23270742 ATGGTGAGAGGGCAGTCTTGGGG - Intergenic
1005880955 6:30060691-30060713 GTGGTGAGAGTGAAGGCCCGAGG - Intronic
1007995308 6:46301713-46301735 GTGGTGAGAAAGACCTCTCTTGG + Intronic
1009882483 6:69585641-69585663 GAAGTGAGAGGGAAGTCTCGCGG - Intergenic
1009895360 6:69742938-69742960 GTGGTGAGAAATAAGTCTCTAGG - Intronic
1009968165 6:70599326-70599348 GTGGTGAAAAGGATGTCACTGGG - Intergenic
1011692254 6:89881037-89881059 GTGGTGAGAAAGAAGGCTATGGG - Intergenic
1014125447 6:117771802-117771824 TTTGTTAGAAGGAAGTCTCTAGG + Intergenic
1015871323 6:137779277-137779299 GTGGTGAGAAGGATGGAGCGTGG + Intergenic
1017552750 6:155526831-155526853 GTTGTGAGAAGGAGGTATCTTGG - Intergenic
1019660317 7:2220334-2220356 GTGGTCAGGAGGAAGCCTGGCGG - Intronic
1019887488 7:3918166-3918188 GTGTTGAGAGGGAAGACACGTGG - Intronic
1019913097 7:4113447-4113469 GGGGTGAGAAGGGAGGCTGGAGG + Intronic
1020014069 7:4820865-4820887 GTGGTGAGAGGGAGGTGGCGGGG - Intronic
1020799405 7:12715648-12715670 GCGGTGGGAAGGAACTCTAGTGG - Intergenic
1021555732 7:21915889-21915911 GTGGTTAGAAGGAGGTCTACTGG + Intronic
1021952710 7:25790802-25790824 GATGTGAGAAGGTACTCTCGGGG - Intergenic
1023908922 7:44540465-44540487 GTGGGGAGTAGGAAGCCTCCTGG + Intronic
1030361574 7:108600414-108600436 CTTGGGAGAAGGAAGTCTTGAGG + Intergenic
1031577859 7:123437844-123437866 TTGGTGATAAGGAATTCTAGGGG - Intergenic
1032362371 7:131267845-131267867 GTGGTGAAAATGAAGTCTTTGGG - Intronic
1032879835 7:136077333-136077355 TTGGTGTGCAGGAAGTCTAGTGG + Intergenic
1033286094 7:140041702-140041724 GTGGTGAGGATGAAGTGTGGAGG + Exonic
1035065982 7:156105431-156105453 GTGATGAGAAGGAAGCCGCGCGG + Intergenic
1035348716 7:158227521-158227543 GTGGCGAGGAAGAAGTGTCGGGG + Intronic
1045934897 8:107668041-107668063 GTGAAGAGAAGTAATTCTCGTGG - Intergenic
1049604244 8:143521660-143521682 GTGGTGAGAATGAAGTAAGGCGG - Intronic
1058715790 9:107721082-107721104 GGGGAGAGAAGGATGTCTCTAGG + Intergenic
1058816385 9:108686435-108686457 TTGGTGAGAAGAAAGTCACAGGG - Intergenic
1059976996 9:119728377-119728399 ATGGTGAGAAGGAAGAGTGGAGG - Intergenic
1185432721 X:18928-18950 GTGGTGAGCGGGAGGTCTCGAGG - Intergenic
1185440786 X:226632-226654 GTGGTGAGCGGGAGGTCTCGAGG - Intergenic
1185442072 X:231750-231772 GTGGTGAGCGGGAGGTCTCGAGG - Intergenic
1186269056 X:7865299-7865321 GTGGTGGGAGGGAAGTCATGTGG + Intergenic
1187538276 X:20164230-20164252 GGGGAGAGAAGGAAGGCTAGAGG + Intronic
1189270182 X:39746085-39746107 GTGGGGAGAAGGAAGTGAAGAGG + Intergenic
1190413378 X:50158682-50158704 GTTGTAAGAAGGAAGTCGTGAGG + Intergenic
1190988620 X:55522790-55522812 CTGCTGGGAAGGAAGTCTGGAGG - Intergenic
1194022248 X:88705557-88705579 GTGGTCACAAGGATGTCTTGAGG + Intergenic
1198015355 X:132604855-132604877 GTGGTCAGAAGCAAGTCAAGAGG - Intergenic
1198111226 X:133504207-133504229 GTGGAGGGAAGGAAGTCTTGGGG - Intergenic
1199984087 X:152937986-152938008 CTGGTGAGAAGGCAGCCTGGAGG + Intronic
1202110219 Y:21409662-21409684 AGGGTGAGAAGCAAGTCTCAAGG + Intergenic
1202164712 Y:21974961-21974983 GTGGTGACATAGAAGTCTCCAGG + Intergenic
1202226644 Y:22611413-22611435 GTGGTGACATAGAAGTCTCCAGG - Intergenic
1202316477 Y:23584249-23584271 GTGGTGACATAGAAGTCTCCAGG + Intergenic
1202554287 Y:26085809-26085831 GTGGTGACATAGAAGTCTCCAGG - Intergenic