ID: 1083593465

View in Genome Browser
Species Human (GRCh38)
Location 11:63908317-63908339
Sequence GAGCCAGCACTGGCCCTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 410}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083593460_1083593465 7 Left 1083593460 11:63908287-63908309 CCGAGTGGAGACGCTCAGGTGAG 0: 1
1: 0
2: 3
3: 10
4: 144
Right 1083593465 11:63908317-63908339 GAGCCAGCACTGGCCCTGCCCGG 0: 1
1: 0
2: 2
3: 37
4: 410
1083593458_1083593465 21 Left 1083593458 11:63908273-63908295 CCTGAAAGCAAAGACCGAGTGGA 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1083593465 11:63908317-63908339 GAGCCAGCACTGGCCCTGCCCGG 0: 1
1: 0
2: 2
3: 37
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083593465 Original CRISPR GAGCCAGCACTGGCCCTGCC CGG Intronic
900086383 1:899828-899850 GAGCCATCAGTGGACCTGTCTGG - Intergenic
900176436 1:1293432-1293454 GCCCCAGCACTGGGGCTGCCAGG + Exonic
900237883 1:1601095-1601117 GAGCCAGCTCTGGGTCTGCAGGG + Intergenic
900458224 1:2787531-2787553 GTGCCAGCACAGGGGCTGCCTGG + Exonic
900601118 1:3503066-3503088 GAGCCAGGATGTGCCCTGCCTGG + Intronic
900618054 1:3574152-3574174 GAGACATCAGTGGTCCTGCCTGG - Intronic
900653296 1:3741948-3741970 AAGTCAGCACTGGCACTGGCTGG + Intergenic
900793910 1:4696174-4696196 GAGCCAGCACTGCCTGGGCCAGG - Intronic
901072154 1:6526413-6526435 GAGCAAGCAGAGGCCCTCCCAGG - Intronic
901088419 1:6625734-6625756 GCTCCAGCACTCGCCCGGCCCGG + Intronic
901218827 1:7570693-7570715 GTGTCAGCACAGACCCTGCCTGG + Intronic
901234354 1:7659726-7659748 CAGGCAGTGCTGGCCCTGCCTGG - Intronic
901302333 1:8208915-8208937 GAGCCAGCGATGTCACTGCCAGG + Intergenic
901464680 1:9413599-9413621 CAGCCAGCTCTGGCACAGCCTGG + Intergenic
901768661 1:11519543-11519565 GACCCAGCGCTGCCTCTGCCAGG + Intronic
902268145 1:15283668-15283690 GAGCCAGCTACAGCCCTGCCTGG + Intronic
902613572 1:17611082-17611104 ACGCCAGCCCTGGCCCAGCCTGG + Intronic
902796687 1:18805001-18805023 AAGCCAGCCCTGGCCCTGCTAGG - Intergenic
903066350 1:20701815-20701837 GGGCCAGGACAGGGCCTGCCTGG + Intronic
903280764 1:22248669-22248691 GGGCCAGCAGTGGCCATGACGGG + Intergenic
903373269 1:22850424-22850446 GTACCAGGACTGGGCCTGCCAGG + Intronic
904116395 1:28164934-28164956 GACCCAGCTCTCGCCCTACCAGG - Intronic
904326432 1:29729646-29729668 GTCCCAGCTCTGGCGCTGCCTGG + Intergenic
904499807 1:30907584-30907606 TAGCCAACAGTGGCCCAGCCAGG + Intronic
904850268 1:33454103-33454125 GCGTGAGCAGTGGCCCTGCCTGG + Intergenic
905264591 1:36742739-36742761 GACCCAGAGCTGGCCCTGCCTGG - Intergenic
905302363 1:36994070-36994092 GGGCCAGCACTGTCCATGCATGG - Intronic
905302932 1:36997865-36997887 GAGCCAGAAGTGGCCATACCAGG + Intronic
905370948 1:37482458-37482480 GGGCCGGCACGGGCCCAGCCTGG + Exonic
905463904 1:38138785-38138807 CAGCCAGCACTGGGAATGCCGGG + Intergenic
905654760 1:39678895-39678917 GGGGCAGGACTGGGCCTGCCAGG - Exonic
905660714 1:39721904-39721926 GAGCCCACACTGGCCTGGCCTGG - Intronic
905876155 1:41433167-41433189 GAGCCAGCACTGGCCTTGTTGGG - Intergenic
906052562 1:42887358-42887380 CTCCCAGCACTGGCCCTGCAGGG + Intergenic
906372663 1:45267650-45267672 GAGCCATCACTTGCACTTCCAGG + Intronic
906791397 1:48661317-48661339 GAGCAGGCACAGGGCCTGCCAGG + Intronic
907281515 1:53350078-53350100 GAGCCAGGACTTTCCCTGCTGGG - Intergenic
907394068 1:54177454-54177476 AAGCCATCCCTGACCCTGCCTGG + Intronic
907498595 1:54861769-54861791 CAGGCAGCACTGGGCCTACCAGG - Intronic
908729852 1:67214859-67214881 AAACCAGGACTGGGCCTGCCTGG + Intronic
913403377 1:118461565-118461587 GTGCAAGCACTGACCCTGGCAGG + Intergenic
915540312 1:156561905-156561927 GACCCTGCCCTGGCCCTGCGAGG - Exonic
915561389 1:156690151-156690173 GAGCCAGCATTGTTCCTGCCTGG - Intergenic
915865604 1:159495014-159495036 GAGCCAGCTCCGGCCTTGGCTGG + Intergenic
915954322 1:160209923-160209945 GGCCCAGCAGTGGCCCTGCCAGG - Intronic
920230511 1:204466871-204466893 GAGCCAGCTCTGGAACTGGCTGG - Intronic
922604587 1:226881685-226881707 GAGGCAGCAGCGGCCTTGCCTGG - Intronic
922897199 1:229109438-229109460 GAGTCAGCACTGGCCTGGCTGGG + Intergenic
922985826 1:229865410-229865432 GAGCCAGCTCTGGCCTTGGCCGG - Intergenic
923534802 1:234840898-234840920 AACTCAGCACTGGCTCTGCCTGG + Intergenic
923841394 1:237675333-237675355 GAGACAGCACTGGGCCAGACGGG - Intronic
923934407 1:238745611-238745633 CAGCCAGCAGTGCCCCTGCCTGG - Intergenic
924112618 1:240714749-240714771 GAGCCAACACTCGCCCCTCCAGG - Intergenic
924426272 1:243952936-243952958 GAGGAATCAATGGCCCTGCCTGG + Intergenic
1062925382 10:1312355-1312377 GAGCCAGCCTGGGGCCTGCCGGG - Intronic
1062960838 10:1572796-1572818 GAGCCAGGACTTCCCCTGCGTGG + Intronic
1063558109 10:7099859-7099881 GTGCCAGCAATGGCATTGCCTGG - Intergenic
1064003849 10:11684782-11684804 GACCCGGGAGTGGCCCTGCCTGG + Intergenic
1065122744 10:22544515-22544537 GAGCCAGGCCAGGCCCTGCTCGG + Intronic
1066370203 10:34814213-34814235 GTGCCAGCGGTGGCCCTCCCGGG + Intronic
1066961777 10:42232513-42232535 GACACAGCCCTGGCCCTCCCTGG - Intergenic
1067223785 10:44362659-44362681 GTGCCAGCACAGGGGCTGCCAGG - Intergenic
1067497755 10:46774862-46774884 GGGCCTGCCCTCGCCCTGCCCGG - Intergenic
1067532182 10:47082114-47082136 GAAGAAGCTCTGGCCCTGCCTGG - Intergenic
1067596894 10:47565552-47565574 GGGCCTGCCCTCGCCCTGCCCGG + Intergenic
1067749274 10:48959481-48959503 AAGCAAGCACTAGCACTGCCTGG + Intronic
1069723157 10:70562190-70562212 GAGCCAGCACTGTGACTCCCTGG - Intronic
1069852395 10:71418345-71418367 GAGTCAGCTCAGGCCCTGACTGG - Intronic
1070785018 10:79157794-79157816 GAGCCAGCACTGGCCCGCCAGGG + Intronic
1071192667 10:83120464-83120486 GAGCCAGCACTGCACATGGCTGG - Intergenic
1072428634 10:95351807-95351829 TGGCCAGCCCTGGTCCTGCCAGG - Intronic
1072786241 10:98284926-98284948 GAGCCAGCACTGGAGAAGCCTGG - Intergenic
1073288821 10:102403333-102403355 GAGGCAGCACTGGCCCAGGCCGG - Exonic
1073327220 10:102649958-102649980 GAGCCAGAACTGGAGCTGGCCGG + Intronic
1073779036 10:106816826-106816848 CAGCAAGCACTGGCGCTGCAGGG + Intronic
1076637618 10:131892465-131892487 GCCTCAGCACTGGCTCTGCCTGG - Intergenic
1076763475 10:132617203-132617225 GAGCCAGGACAGACCCTGCTTGG + Intronic
1077055928 11:593126-593148 GCGCCTGCTCTGGCCCTGCGTGG + Intronic
1077129990 11:966724-966746 GAGCCAGCAGTGCCTCTGGCTGG + Intronic
1077364269 11:2155214-2155236 GAGCCAGCCCAGCCCTTGCCAGG - Intronic
1077463016 11:2720389-2720411 GAGCATGTGCTGGCCCTGCCTGG + Intronic
1077523726 11:3051362-3051384 GTGTCAGCACTGACACTGCCGGG + Intronic
1078083303 11:8219059-8219081 CAGCCAGCACAGGCCAGGCCCGG + Intergenic
1078351932 11:10602006-10602028 GATCTAGCTCAGGCCCTGCCTGG + Intronic
1078485593 11:11720297-11720319 GAGCCAGCTCTGCCCCTTTCAGG - Intergenic
1078642489 11:13109365-13109387 CAGCCTGCATTGTCCCTGCCTGG - Intergenic
1078913965 11:15760500-15760522 GAGGCAGCTCAGGACCTGCCTGG + Intergenic
1080105266 11:28505071-28505093 GAGCCAGGACTGGACCTGGTGGG + Intergenic
1082796391 11:57381071-57381093 GGGCCTACACTGGTCCTGCCTGG + Intronic
1083593465 11:63908317-63908339 GAGCCAGCACTGGCCCTGCCCGG + Intronic
1084326500 11:68403409-68403431 GAGCCAACCCGGACCCTGCCTGG - Intronic
1084470841 11:69358006-69358028 GATCCGGCTCTGGCCCTCCCTGG - Intronic
1084532218 11:69734235-69734257 GAGCTAGGTCTGGACCTGCCAGG - Intergenic
1084954638 11:72684811-72684833 TGGCCAGCACTGACCCTGGCTGG - Intergenic
1084964735 11:72738702-72738724 CAGCCAGCTCTGGCCAGGCCTGG + Intronic
1085052383 11:73386506-73386528 GAGCCCCCACTGGACTTGCCCGG - Intronic
1085172000 11:74457449-74457471 GCCCCAGCCCTGGCCCTGGCCGG + Exonic
1085347702 11:75778957-75778979 GGGCCAGCTCTGCCCTTGCCTGG - Intronic
1085403307 11:76247217-76247239 GGGCCAGCTCTGGGCCTGCAAGG + Intergenic
1087212021 11:95454304-95454326 GAGCCGGCATTGGCACTGCTGGG - Intergenic
1088875847 11:113935718-113935740 ATGCCAACACTGGGCCTGCCAGG + Intronic
1089359670 11:117877341-117877363 CATCCACCTCTGGCCCTGCCAGG + Intronic
1089730071 11:120513747-120513769 GAGGCAGCACTGGTCCCTCCGGG + Intronic
1089776780 11:120843237-120843259 CAGGGAGCTCTGGCCCTGCCTGG - Intronic
1090293857 11:125569465-125569487 GCGCCCGCACTGGGCATGCCCGG - Exonic
1090364190 11:126192545-126192567 CAGCCCGTCCTGGCCCTGCCGGG - Intergenic
1091305376 11:134532812-134532834 GACCCTGCACCGGCTCTGCCTGG + Intergenic
1092471717 12:8787218-8787240 GAGCCGGCTCTGGCCTTGGCCGG - Intergenic
1097820834 12:64127901-64127923 TGGCCATCACTGGTCCTGCCAGG - Exonic
1097985917 12:65783129-65783151 GAGCCAGCAATAGCCTTGCCTGG + Intergenic
1099028123 12:77491539-77491561 GACCCAGCATTGTGCCTGCCTGG + Intergenic
1099035794 12:77585762-77585784 AAGCCAGTACTGGTCCAGCCTGG + Intergenic
1100338307 12:93654303-93654325 GAACTAGCACTGCCCCTTCCTGG - Intergenic
1101393967 12:104327620-104327642 GAGCCAGCAATCTTCCTGCCTGG - Exonic
1102458937 12:113088090-113088112 GGGCCAGGGCTGACCCTGCCAGG - Intronic
1103325327 12:120116557-120116579 GAGGCGGCGCGGGCCCTGCCGGG - Intronic
1103562053 12:121797978-121798000 GACCCAGCCCTGGCCCTCACAGG + Intronic
1103782246 12:123406705-123406727 GAGCCTGCACAGGCCCTGGGTGG - Intronic
1104745063 12:131205266-131205288 GTGCCAGCCCCGGCCCAGCCCGG - Intergenic
1104789335 12:131472133-131472155 GTGCCAGCCCCGGCCCAGCCCGG + Intergenic
1104891022 12:132140249-132140271 GTGGCAGCACCGGCCCTGCGGGG + Intronic
1105278838 13:18951610-18951632 AGGCCAGCCCTGGACCTGCCTGG + Intergenic
1105827731 13:24137310-24137332 GAGACAGCAAAGGCCCAGCCAGG - Intronic
1106104239 13:26719729-26719751 GCCTCAGCTCTGGCCCTGCCGGG + Intergenic
1107834995 13:44405844-44405866 GATCCAGCCTTGGCCCTGCTAGG - Intergenic
1112277189 13:98032332-98032354 GAGCCAGCAGAAGGCCTGCCTGG + Intergenic
1113275582 13:108725825-108725847 GAGCCAGCCCTGGTCAAGCCAGG + Intronic
1113469403 13:110533853-110533875 GAGCCAGCACAGGGCCTGGCTGG + Intronic
1113877652 13:113604689-113604711 CAGCCAGCCCGGGACCTGCCTGG + Intronic
1115564478 14:34613216-34613238 GAGGGAGAGCTGGCCCTGCCAGG + Intronic
1115661634 14:35500590-35500612 GAGCCAGTAATGGCTGTGCCTGG - Intergenic
1116916798 14:50532769-50532791 GAGACAGCCCAGGCCCTGCAAGG - Intronic
1117718014 14:58600430-58600452 GAACCTGCACTTGGCCTGCCAGG - Intergenic
1118012357 14:61622808-61622830 GGGCCAACACTGGCCATGCTGGG + Intronic
1118444374 14:65838261-65838283 GGGCCAGCCCAGTCCCTGCCAGG + Intergenic
1118854497 14:69610894-69610916 GAGCCAGGACTGGCAGAGCCCGG - Intergenic
1121014401 14:90539513-90539535 GCCTCAGCACTGACCCTGCCAGG - Exonic
1121177201 14:91899440-91899462 AGCCCAGCACTGCCCCTGCCAGG + Intronic
1121208819 14:92191083-92191105 GTGCCAGCACTCGCCCTTCTGGG - Intergenic
1121314667 14:92953744-92953766 TACCCAGCTCTGGCCCTTCCTGG - Intronic
1121338707 14:93092560-93092582 CAGCCAGCACTGGCCCTCAACGG + Intronic
1121600491 14:95199704-95199726 GAGGGAGCAATGGCTCTGCCTGG + Intronic
1121803871 14:96797524-96797546 GGGCCGGCACTGGGCCTTCCGGG + Intronic
1121833022 14:97068044-97068066 AAGCCAGCCCTGGCCCTGGATGG - Intergenic
1122044401 14:99012854-99012876 GAGGCAGCAATGGCCCTGACTGG + Intergenic
1122239029 14:100349647-100349669 GACCCAGCTCTGCCCCTGCCTGG - Intronic
1122822115 14:104352974-104352996 GAGCCTGCACTGGCCTTAACCGG - Intergenic
1123017874 14:105384187-105384209 AAGCCACCACTGCCCCTCCCTGG - Intronic
1123038605 14:105481378-105481400 GAGCCAGCCCAGGCCCCGCCAGG - Intergenic
1123043192 14:105498974-105498996 AAGCCTGCCCTGGCCCAGCCTGG + Exonic
1124556570 15:30731445-30731467 GGGCCAGCCCTGGGGCTGCCAGG - Intronic
1125450251 15:39800393-39800415 CAGCCAACACTGACCCTGACTGG + Intronic
1126880052 15:53084559-53084581 AATCCAGCAATGTCCCTGCCAGG + Intergenic
1127059989 15:55172538-55172560 GAGCCTGCACTGGACCTGAAAGG + Intergenic
1127932101 15:63603702-63603724 GAGTAAGCACTGCCCCAGCCCGG - Intergenic
1128753701 15:70166802-70166824 GGGCCAGCCATGGTCCTGCCTGG + Intergenic
1129194488 15:73955904-73955926 GAGCCAGCAGAGGCACTGCTAGG + Intergenic
1129222396 15:74138920-74138942 GAGCACTCACTGGCCCAGCCAGG - Intergenic
1129379234 15:75154919-75154941 CAGCCAGCCCTGACCCTGCTGGG + Intergenic
1129390724 15:75219558-75219580 AAGCCAGGCCTGGGCCTGCCTGG - Intergenic
1129694655 15:77733813-77733835 GAGGCTGCACTGGCCCTTGCAGG + Intronic
1129737362 15:77973806-77973828 GAGTCAGCACTGGGGCAGCCAGG + Intergenic
1129848710 15:78779819-78779841 GAGTCAGCACTGGGGCAGCCAGG - Intronic
1130093231 15:80838290-80838312 GGGCCAGCAGGGTCCCTGCCAGG - Intronic
1130253209 15:82314127-82314149 GAGTCAGCACTGGGGCAGCCAGG + Intergenic
1130378355 15:83350530-83350552 GGGCCAGCACTGGCCCACCCTGG + Intergenic
1131003218 15:88954960-88954982 GGGCCACCACAGGACCTGCCAGG + Intergenic
1131033153 15:89203406-89203428 GACCAAGCACTGGCTCAGCCAGG + Intergenic
1131093615 15:89642067-89642089 GCTCCAGCCCTGGCCCTGCAGGG - Intronic
1131360355 15:91785078-91785100 GGGCCTGCCCTGGCCCTCCCTGG - Intergenic
1131512435 15:93056694-93056716 GGGCCAGCACAGGCCCTGAAGGG + Intronic
1132284473 15:100651958-100651980 GACCCAGCACTGGGCCTTCTTGG + Intergenic
1132699787 16:1217475-1217497 GGCCCAGCCCTGCCCCTGCCGGG + Intronic
1132713939 16:1281385-1281407 AAGCCAGAACTGGCTCTGGCGGG + Intergenic
1132798939 16:1741996-1742018 GAACCTGCTCTGGCCATGCCTGG - Intronic
1132842584 16:1985343-1985365 GAGCCAGCACTGGCCCTTGCAGG + Intronic
1132873655 16:2126384-2126406 GGCCCAGCCCTGGCCCAGCCTGG - Intronic
1133111216 16:3549385-3549407 GAGCCAGTGCTGGGCCAGCCAGG + Intronic
1133222081 16:4323174-4323196 CAGACAGCCCAGGCCCTGCCAGG - Intronic
1133267752 16:4594888-4594910 GAGCCAGCACTATCCCTGACCGG + Intronic
1133366731 16:5216190-5216212 GAGTCAGCTCTATCCCTGCCTGG - Intergenic
1134552743 16:15145558-15145580 GGCCCAGCCCTGGCCCAGCCTGG - Intergenic
1135521651 16:23182721-23182743 GAGCCCGCGGTGGCGCTGCCAGG + Exonic
1137744885 16:50813191-50813213 GAGTGGGCACTGTCCCTGCCTGG - Intergenic
1138110825 16:54322513-54322535 GGCCCAGCACTGGCCCTCCAGGG - Intergenic
1138185179 16:54971247-54971269 AAGCCAGCACTGCCCTGGCCGGG + Intergenic
1138490213 16:57372264-57372286 GAGGCTGGACTGGGCCTGCCTGG - Intergenic
1138627716 16:58265847-58265869 AGGCCATCACTGGCTCTGCCGGG - Intronic
1139469262 16:67169687-67169709 GGCCCAGCCCTGGGCCTGCCTGG + Exonic
1140640514 16:76966740-76966762 TAGCCAGCACTTCCCATGCCTGG - Intergenic
1141139336 16:81487126-81487148 GAACCAGAACAGGCCCTGCAGGG + Intronic
1141159172 16:81617693-81617715 TAACCAGCTCTGGCCCAGCCAGG + Intronic
1141553337 16:84820685-84820707 GTTCCAGCCCTGGCTCTGCCCGG - Intronic
1141619509 16:85229284-85229306 GAGCCAGCTCTGGCCTTGGCAGG + Intergenic
1142027932 16:87824386-87824408 GAGGCAACAGTGGCTCTGCCTGG - Intergenic
1142743128 17:1942078-1942100 GAGCCACCCCTGGCCCACCCAGG - Intronic
1142849330 17:2696669-2696691 GAGCCCGGGCTGGCCCTGCCAGG - Intronic
1143017047 17:3896428-3896450 CACCCAGCACTGACCCTGCTGGG + Intergenic
1143492442 17:7292329-7292351 CAGACAGCTCTGCCCCTGCCGGG + Intronic
1143653129 17:8276697-8276719 GAGCTAGCACTGTTTCTGCCTGG - Intergenic
1144479019 17:15613680-15613702 GAGCCAGCACTGGGCCGCCATGG - Exonic
1144919285 17:18750050-18750072 GAGCCAGCACTGGGCCGCCATGG + Exonic
1146281768 17:31549621-31549643 GAGCCCCCACGGACCCTGCCCGG + Intergenic
1146544682 17:33728045-33728067 GAGGCAGCACATGCTCTGCCTGG + Intronic
1146933310 17:36793366-36793388 GAGCCCACACTGGCCCAGGCTGG + Intergenic
1146950185 17:36900203-36900225 GTGCCAGCCCTGGCCCCGCTGGG - Intergenic
1147204943 17:38830422-38830444 GAGCCACCACTGTGCCTGACAGG + Intergenic
1147319865 17:39639683-39639705 GAGCCAGCAGGGACCATGCCTGG + Intronic
1147556248 17:41481024-41481046 GAGCCCCCACTGGCCCCTCCTGG + Exonic
1147968489 17:44206976-44206998 AAGCCAGCACCGGACCAGCCTGG - Exonic
1148051686 17:44772734-44772756 GAGCTGGCACTGTCCCTGGCTGG + Intronic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1149638022 17:58185733-58185755 GTGGCAGGCCTGGCCCTGCCTGG - Intergenic
1150419498 17:65019291-65019313 GATCCAGCAATGGCACTGCTAGG + Intronic
1150492662 17:65585088-65585110 CAGCCAGCACTGTCCCTGCCAGG - Intronic
1151404572 17:73878151-73878173 GAGCCAGGACAGGGCCTGCTGGG - Intergenic
1151448071 17:74180421-74180443 CTGCCTGCTCTGGCCCTGCCGGG + Intergenic
1151658986 17:75508761-75508783 TACCCAACACTGGCTCTGCCAGG + Intronic
1151661587 17:75521875-75521897 GCCCCAGCCCTGGCCCGGCCAGG + Exonic
1151713679 17:75820584-75820606 GGGCCAGCCCTGGGCCTCCCTGG - Intronic
1151718543 17:75843547-75843569 GAGCCTGCTCTGGGCCTCCCGGG - Intronic
1151931503 17:77234942-77234964 CAGCCGGCCCTGGCCCTCCCTGG - Intergenic
1152068980 17:78125912-78125934 GAGGGAGGCCTGGCCCTGCCCGG - Intronic
1152515694 17:80822524-80822546 GTGTCAGCGCTGGCCCTGACCGG + Intronic
1152888064 17:82864342-82864364 GAGCCGGCACTCGATCTGCCTGG - Intronic
1153705047 18:7736801-7736823 AAACCAGGCCTGGCCCTGCCTGG - Intronic
1154176930 18:12092061-12092083 GTGACAGCCCTGGCCCTGCAGGG + Intergenic
1155182053 18:23356390-23356412 GGGCCAGCTTGGGCCCTGCCAGG - Intronic
1157180295 18:45491867-45491889 CAGCCAGCACCAGCTCTGCCAGG + Intronic
1158557878 18:58490333-58490355 GAGCCACCACTGCCCCTCCCTGG + Intronic
1160554964 18:79718961-79718983 GATCCAGCACTGTCCCTGCGTGG + Intronic
1160672637 19:373565-373587 CAGAGAGCCCTGGCCCTGCCCGG + Intronic
1160888892 19:1366500-1366522 GAGACCTCACTAGCCCTGCCCGG - Intronic
1160991758 19:1863101-1863123 GAGCCACCGCTGTCCCTTCCCGG - Exonic
1161295915 19:3520147-3520169 GGGCCAGCACTGGCCATCCCAGG - Intronic
1162574488 19:11491091-11491113 GGGACTGCACTGGCCCTGGCAGG - Intronic
1163020212 19:14477579-14477601 CAGGAAGCTCTGGCCCTGCCTGG + Intergenic
1163153881 19:15429702-15429724 AAGACACCACTGGCCCTGGCGGG - Intronic
1163556617 19:17997044-17997066 CACCCAGGACTGTCCCTGCCTGG + Intronic
1163559521 19:18010471-18010493 GTGCCAGCTCTGGGGCTGCCAGG - Intronic
1163710045 19:18840982-18841004 GAGCCTGCACTCGCTCTGCAAGG - Intronic
1163831981 19:19551351-19551373 GAGGCAGCACTGACTCAGCCAGG + Intergenic
1163934174 19:20426467-20426489 CAGGCAGCCCTGGGCCTGCCTGG - Intergenic
1163934718 19:20432464-20432486 AAACCAGCCCTGGGCCTGCCTGG - Intergenic
1165787217 19:38468958-38468980 GTGCCAGCGCTGGCCCTGTGAGG - Exonic
1166290886 19:41862748-41862770 CAGCCCACAGTGGCCCTGCCTGG + Intronic
1167160478 19:47764323-47764345 GAGACAGCAGTGCCCCTGCTGGG + Intergenic
1167296251 19:48651875-48651897 CAGCAAGCACTGACCCAGCCTGG - Intergenic
1167528813 19:50002057-50002079 GAGCCAGCTCTGCCACTCCCCGG - Intronic
1167743649 19:51339043-51339065 GAGGCAGCAGGGGCCCCGCCGGG + Exonic
1168125142 19:54278756-54278778 GACTCTGCACAGGCCCTGCCGGG - Intronic
1168327149 19:55544288-55544310 GAGCCACAGCTGGACCTGCCAGG + Exonic
925100302 2:1238676-1238698 GTGGCAGGACTGGCCGTGCCTGG + Intronic
926007161 2:9381278-9381300 CAGGCAGCCCTGGCCTTGCCGGG + Intronic
927076966 2:19588480-19588502 GAGGCAGCCATGGCCCAGCCTGG + Intergenic
927246136 2:20958401-20958423 GAGCCAGAGCAGGCCCAGCCGGG + Intergenic
927670687 2:25066240-25066262 GAGCAAGCCCTGACCCTCCCAGG - Intronic
927721011 2:25382138-25382160 GAGCCAGCAGCAGCCCTCCCAGG - Intronic
927992757 2:27459815-27459837 GAGCCAGCTCTACCGCTGCCAGG + Exonic
928316395 2:30249930-30249952 GAGCCAGCACAGTGCCTGACAGG - Intronic
929994788 2:46818491-46818513 CAGCCATCACTGTCTCTGCCTGG + Intronic
930024280 2:47020876-47020898 AAGCCAGTGCTGCCCCTGCCCGG - Intronic
930947075 2:57087556-57087578 GATCCAGCAATGTCACTGCCAGG - Intergenic
932416212 2:71575241-71575263 AAGCCAGCAGTGGCCCTGAGAGG + Intronic
933089625 2:78104456-78104478 CAGCCAGCAATGCCCCTGCTTGG - Intergenic
933844071 2:86311232-86311254 GAGCCTGCACCAGTCCTGCCAGG + Intronic
934141404 2:89051061-89051083 GCGCCAGGCCTGGGCCTGCCTGG + Intergenic
934227838 2:90149483-90149505 GCGCCAGGCCTGGGCCTGCCTGG - Intergenic
936055416 2:109258596-109258618 CAGCCAGCTGTGGCCCGGCCTGG - Intronic
936066069 2:109333072-109333094 GAGGCAGCACTGGAGCTGCAGGG - Intronic
940861171 2:158771833-158771855 CAGCCAGCACCGGCCCTGAGAGG + Intergenic
942980128 2:182070853-182070875 GAGCCAGCACTTTCCATGGCTGG + Intronic
943717695 2:191170322-191170344 GGGTCACCACTGGCCCTGCCTGG + Intergenic
944681690 2:202083409-202083431 GAGCCAGCCTTGGGGCTGCCAGG - Intronic
944843520 2:203646293-203646315 TAGCCAGCCATGCCCCTGCCTGG + Intergenic
946228422 2:218277168-218277190 GAGGCAGCACTGGGACTCCCTGG - Intronic
946433547 2:219638075-219638097 TTGCCATCTCTGGCCCTGCCTGG - Intronic
947167801 2:227280443-227280465 GAACCAGCAGTAGCCATGCCTGG + Exonic
947715979 2:232339036-232339058 GGGCCAGCACTGACCCTTCAGGG - Intronic
947767310 2:232645982-232646004 GTGCCAGCCAAGGCCCTGCCTGG - Intronic
948055248 2:235005841-235005863 AAGCCAGCCCTGGCCGTCCCAGG + Intronic
948252862 2:236544519-236544541 GTGCGAGCACAGGCCCTGCAAGG + Intergenic
948830372 2:240595652-240595674 GAGCTGGGACTGGCCCTGACAGG - Intronic
949027160 2:241771755-241771777 CAGGCAGCTCTGGCCCTGCCTGG - Intergenic
1169205789 20:3739789-3739811 GAGGGAGCACAGGGCCTGCCTGG + Intronic
1170150427 20:13221483-13221505 GAGCAAGCCCCGGCGCTGCCTGG - Intergenic
1170699102 20:18687238-18687260 CACCCAGCACTGGCCCTCTCTGG - Intronic
1170861017 20:20103718-20103740 GCCGCAGCACTGGCCCTGCCTGG + Intronic
1171359549 20:24577427-24577449 GCCCCAGCACTGGCCCTGCAAGG + Intronic
1171857661 20:30361945-30361967 AACCCTGCGCTGGCCCTGCCGGG + Intergenic
1172009787 20:31839913-31839935 GAGGCAGCCCTGGCCTTTCCCGG + Intergenic
1172165107 20:32894132-32894154 GAGCCAGCACTGTGCATGCAAGG - Intronic
1172176791 20:32977360-32977382 GAGTGAGCTCTGGCCCTGCTAGG - Intergenic
1173468295 20:43301912-43301934 GAACCAGCTCAGCCCCTGCCTGG - Intergenic
1173646021 20:44633646-44633668 GGGCCACCACTGCCCCTCCCTGG - Intronic
1174043183 20:47714502-47714524 AAGCCACCACTGCCTCTGCCTGG + Intronic
1174178266 20:48658382-48658404 GAGTGAGCACTGGCTCTGCCAGG - Intronic
1174396564 20:50250491-50250513 GAGCCAGCACAGGGTCTGTCTGG - Intergenic
1174538484 20:51271101-51271123 GACCCTGCAAAGGCCCTGCCTGG + Intergenic
1175309400 20:58001213-58001235 GAAACAGCACTGACCATGCCAGG + Intergenic
1175551301 20:59819689-59819711 GGGACAGCACTGGCCCAACCAGG - Intronic
1175551327 20:59819789-59819811 GGGACAGCACCGGCCCAGCCAGG - Intronic
1175768496 20:61607683-61607705 AAGACAACACTGGCCCTGGCAGG - Intronic
1176151638 20:63594455-63594477 GACTCAGCACTGAACCTGCCAGG + Intronic
1178355467 21:31907602-31907624 GAGCCAGCACGGGGCATACCTGG + Intronic
1181165385 22:20980350-20980372 CCCACAGCACTGGCCCTGCCTGG - Intronic
1181439878 22:22930286-22930308 GACCCAGGCCTGGCCGTGCCTGG + Intergenic
1182422766 22:30256563-30256585 GACCCAGGACTGGCCCACCCCGG + Intergenic
1183311460 22:37112147-37112169 GGCCCAGCCCTGGCTCTGCCTGG - Intergenic
1183608536 22:38882001-38882023 AAGCCATATCTGGCCCTGCCAGG + Intergenic
1183739724 22:39662946-39662968 GCGCCACCAATGGCCTTGCCTGG - Intronic
1183953703 22:41367159-41367181 GAGCCATAACTGGGGCTGCCAGG - Intergenic
1183991578 22:41600530-41600552 GCTCCAGCACTGGCCTTGCTTGG + Exonic
1184037634 22:41926241-41926263 GAGGCGGCGCTGCCCCTGCCCGG - Exonic
1184043493 22:41958082-41958104 GAGCAAGCCCTGGGCCAGCCAGG - Intergenic
1184321730 22:43747071-43747093 TACCCAGCATTGGCCCAGCCTGG - Intronic
1184694524 22:46132025-46132047 GAGCCATCAGTGCCCATGCCCGG + Intergenic
1185048116 22:48539233-48539255 AAGACAGGACTGGCCCAGCCAGG + Exonic
1185115979 22:48938450-48938472 GAGCCAGCACTGCCGATGCCTGG + Intergenic
1185204781 22:49531632-49531654 CAGCCAGGGCTGCCCCTGCCTGG - Intronic
1185285039 22:49996324-49996346 GTGCCAGCTCTGACCCTTCCTGG + Exonic
949539175 3:5018888-5018910 GTGCCAGCATTACCCCTGCCTGG + Intergenic
949936369 3:9119291-9119313 AGGCCATCACTGTCCCTGCCTGG + Intronic
950436835 3:12985303-12985325 GAGGCAGCCCTGGCCCTCTCTGG - Intronic
951581000 3:24162343-24162365 CAGCCAGCACTGGCCCCGTGAGG + Intronic
952838102 3:37621410-37621432 CTGCCATCCCTGGCCCTGCCTGG + Intronic
952873219 3:37920541-37920563 GAGGCTGCAGAGGCCCTGCCAGG + Intronic
954121977 3:48504759-48504781 GCGCCAGCGCTGAGCCTGCCAGG - Intronic
954199586 3:49016393-49016415 GCCCCAACACTGGCCCTGTCAGG + Intronic
954635605 3:52069176-52069198 GAGCTGGCACTGTCCCTGCTGGG - Intergenic
955860576 3:63325579-63325601 AGGCCAGCAGGGGCCCTGCCAGG - Intronic
960714739 3:120563763-120563785 CATCCATCACTGGACCTGCCTGG + Intergenic
960997029 3:123347045-123347067 GAGCCAGCAGTGGTACAGCCAGG - Intronic
961436523 3:126922572-126922594 CAGCCAGCACTGGGACAGCCAGG - Intronic
961531207 3:127541519-127541541 GAGCAAGAGCTGGCTCTGCCTGG + Intergenic
964641798 3:158916266-158916288 GAGCCATCACTTTCCCTGGCAGG - Intergenic
969021327 4:4142302-4142324 GGGCCAGCCCTGGGCCTGCTGGG + Intergenic
969113206 4:4856295-4856317 GGGCCAGCCCTGCCCTTGCCAGG + Intergenic
969398303 4:6937593-6937615 GGGGCAGCAAGGGCCCTGCCAGG + Intronic
969471883 4:7394006-7394028 TCTCCAGCACTGGCCCTTCCTGG + Intronic
969526048 4:7704629-7704651 GCTGCAGCACTGGCCCTGCCCGG + Intronic
969600698 4:8174262-8174284 GAGCTGGCACTGGCCTTGCAGGG + Intergenic
969683481 4:8656244-8656266 CAGCCAGCGCTGGGGCTGCCAGG + Intergenic
972274700 4:37546304-37546326 AAACCAGGACTGGGCCTGCCTGG + Intronic
972838897 4:42908131-42908153 GAAGGAACACTGGCCCTGCCAGG - Intronic
974987753 4:69050974-69050996 AAACCAGCCCTGGGCCTGCCTGG + Intronic
974988332 4:69056973-69056995 AAACCAGCCCTGGGCCTGCCTGG + Intronic
975278071 4:72526019-72526041 TAGCCAGCACTAGCCCTTCAAGG + Intronic
976246703 4:83012515-83012537 GGCCGAGCGCTGGCCCTGCCGGG + Intronic
985090457 4:186357748-186357770 GAGACTGCATTGGGCCTGCCTGG - Intergenic
985524116 5:393204-393226 GTGCCGGCACAGGCCCTGCTGGG - Intronic
985531909 5:438802-438824 GAGCCTGCGCAGCCCCTGCCAGG + Intergenic
985578241 5:683602-683624 GAGCCAGCATGGCCCCTGCCAGG - Intronic
985585493 5:731085-731107 GAGCCAGCACTCCCACTCCCAGG - Intronic
985586541 5:741127-741149 AAGCCAGCCCTGGCCCTGTTGGG + Intronic
985593168 5:775742-775764 GAGCCAGCATGGCCCCTGCCAGG - Intergenic
985599008 5:815404-815426 GAGCCAGCACTCCCACTCCCAGG - Intronic
985599932 5:822512-822534 GAGCCAGCACTCCCACTCCCAGG - Intronic
985601129 5:833306-833328 AAGCCAGCCCTGGCCCTGTTGGG + Intronic
985704625 5:1393187-1393209 CAGCCATGACTGGCCCTGCACGG + Exonic
986329108 5:6704447-6704469 GAGGCCTCACAGGCCCTGCCAGG - Intergenic
991088187 5:62667649-62667671 CAGCCAGCTCTGGCCCCACCAGG - Intergenic
992989900 5:82273607-82273629 AAACCAGCCCTGGGCCTGCCTGG - Exonic
994591798 5:101783432-101783454 GTGCCTGCCCTGCCCCTGCCAGG + Intergenic
996871476 5:128198119-128198141 CAGCCACCACTTGCCATGCCTGG + Intergenic
997282189 5:132656274-132656296 CAGCCGGCCCTTGCCCTGCCTGG + Intronic
997641921 5:135455031-135455053 GCTCCAGCACTGGCTCTTCCTGG + Intergenic
998162948 5:139823603-139823625 GGGCAAGCACTGGCCCTCTCTGG + Intronic
999330443 5:150670458-150670480 GAGCCCGCTCTGGCCTTTCCTGG + Intronic
1000195376 5:158952098-158952120 GAGGCCGGCCTGGCCCTGCCTGG - Intronic
1001605657 5:172958353-172958375 GAGAGAGCACGGGACCTGCCTGG + Intergenic
1001688834 5:173616780-173616802 GAGCAAGCACGAACCCTGCCGGG - Intergenic
1002691920 5:181055858-181055880 TAGCCAGCAGGGGTCCTGCCTGG - Intronic
1010263484 6:73842592-73842614 GATCCAGCAATGGCACTGCTGGG - Intergenic
1013080182 6:106805718-106805740 GAGCCGGCTCTGGCCTTGGCCGG - Intergenic
1013705907 6:112833612-112833634 TTGTCAGGACTGGCCCTGCCTGG + Intergenic
1014844451 6:126258296-126258318 GAGCCACCACTGCCCCGCCCTGG + Intergenic
1015411981 6:132903922-132903944 GAATCAGCACTGTCCCTTCCTGG + Intergenic
1016454852 6:144220222-144220244 GAGACAGTTCTGGCCCTGGCTGG - Intergenic
1018390071 6:163335461-163335483 GAGCAAACCCTCGCCCTGCCAGG + Intergenic
1018911574 6:168103564-168103586 TCGGCAGCAATGGCCCTGCCTGG + Intergenic
1019433207 7:1009195-1009217 GTGGGGGCACTGGCCCTGCCTGG - Intronic
1019514484 7:1433731-1433753 GAACCTGCTCTGGCCCTGCTGGG + Intronic
1019603836 7:1898716-1898738 GAGCCAGCACAGTCACTGCCAGG + Intronic
1022196609 7:28073683-28073705 CAGCCAGCACTGCCCCGGGCAGG - Intronic
1022238663 7:28488010-28488032 GAGTGAGCACAGGCCCTGCTTGG - Intronic
1022706885 7:32810259-32810281 CAGCCAGCAGCGCCCCTGCCTGG + Intergenic
1022811199 7:33870504-33870526 AAGCCATCCCTGGCCCTCCCAGG - Intergenic
1023856836 7:44189199-44189221 CGCCCAGCAATGGCCCTGCCTGG - Intronic
1023904587 7:44513266-44513288 GAGCCATCAGTGGTGCTGCCTGG + Exonic
1024696374 7:51860396-51860418 GAGCCAGCAATTGCTCTGCAGGG - Intergenic
1025022284 7:55489170-55489192 GATCCAGCCCTGGACCTGACAGG + Intronic
1026280181 7:68915239-68915261 GAACCAGCACTGGCCCGCCATGG + Intergenic
1028502828 7:91538046-91538068 GAGCCAGCTCTGAGGCTGCCTGG - Intergenic
1029195326 7:98801780-98801802 GGGCCAGCATTGTCCCTGCCTGG - Intergenic
1029454109 7:100658944-100658966 GAGCCACCACATGCCCTGCCTGG - Intergenic
1030664297 7:112257471-112257493 GAGCCTGCAAGGGACCTGCCAGG + Intronic
1030687854 7:112505026-112505048 GAACCACCACTTACCCTGCCTGG + Intergenic
1032195783 7:129787553-129787575 TAGCTAGCAATGGCCATGCCTGG + Intergenic
1033523117 7:142182241-142182263 GGTCCAGCACTGGCTCTGCTGGG + Intronic
1034203405 7:149296130-149296152 CAGCCAGCCCAGGCCCTTCCGGG - Intronic
1034798683 7:154037212-154037234 GAGCCAGCTTTGACCCTGCGAGG + Intronic
1034971742 7:155423748-155423770 CAGCCGGCACTGGCCATGCAGGG + Intergenic
1035099819 7:156387659-156387681 AAATCAGCAGTGGCCCTGCCGGG + Intergenic
1035121029 7:156567267-156567289 GAGCCAGCGCTGGGCCATCCTGG + Intergenic
1036773047 8:11592127-11592149 GAGCCAGGGCTGGGCCTCCCAGG - Intergenic
1038294104 8:26275180-26275202 GAGCAAAAACTGGCCATGCCGGG + Intergenic
1038942755 8:32323540-32323562 AAGCCAGCAATGGTCCTGCAGGG + Intronic
1040278575 8:46026208-46026230 GACCCAGCACAGGGGCTGCCGGG + Intergenic
1042856552 8:73273416-73273438 GAGCGAGCACACGCCCAGCCAGG - Intergenic
1043486123 8:80701031-80701053 GAGCCACCAGTGGACCTGGCGGG - Intronic
1043812131 8:84753683-84753705 GAGCCAGCACTTCACCTGGCTGG - Intronic
1045649412 8:104328398-104328420 TCCCCAGCTCTGGCCCTGCCTGG + Intergenic
1047419423 8:124694242-124694264 TAGTCAGCACTGGCCCATCCCGG + Intronic
1048892206 8:138958337-138958359 AAACCAGCACTGGCCCTTCATGG + Intergenic
1049258220 8:141625093-141625115 GAGTGATCACTGCCCCTGCCAGG - Intergenic
1049379128 8:142303308-142303330 GAGCAGTCACTGGCCCTGCCTGG + Intronic
1050231191 9:3526870-3526892 GAGCAAGAAATTGCCCTGCCCGG + Intergenic
1055757559 9:79572440-79572462 GAGCCCGCACTTTCCCGGCCGGG + Intronic
1056679387 9:88704031-88704053 GTGCTGCCACTGGCCCTGCCTGG - Intergenic
1057182131 9:93035902-93035924 GAGGCAGCATGGGCACTGCCAGG + Exonic
1057196201 9:93116665-93116687 CATCCAGCACTTGCCCAGCCAGG - Intergenic
1057274131 9:93667278-93667300 GGGCCAGCCCTGGGCCTGCCTGG - Intronic
1058411987 9:104743690-104743712 GGGCCAGCACTGGCATTACCTGG + Intergenic
1058599653 9:106655476-106655498 CACCCAGCACTGACCCTGACTGG + Intergenic
1059720760 9:116958298-116958320 GAGCCAACACTGGCCGGGCGTGG + Intronic
1060105765 9:120872324-120872346 TAGCCAGAACTGCCCCTTCCGGG - Intronic
1060527833 9:124330528-124330550 GAGGCAGCACGGGCCCTGCATGG - Intronic
1060823004 9:126672165-126672187 CAGCCAGTACTGGGCCAGCCAGG - Intronic
1061247127 9:129406253-129406275 GAGCCAGCACTGGATGTGTCAGG + Intergenic
1061278240 9:129581816-129581838 AAGACAGCCATGGCCCTGCCTGG + Intergenic
1061389815 9:130311240-130311262 CAGCCAGCCCTGGCCCAGCCTGG - Intronic
1061431378 9:130533413-130533435 GAGCCAGCACTGGGGCTGGGTGG + Intergenic
1061773122 9:132943529-132943551 GAGCCAGGACTGGAACTGCTGGG - Intronic
1062170078 9:135129817-135129839 GAGCCAGCACCTGAGCTGCCTGG - Intergenic
1062172141 9:135140715-135140737 GAGCCAGCTCTGGCTGAGCCTGG - Intergenic
1062235815 9:135507072-135507094 CAGCCAGCACTGGCCCTTGTTGG - Intergenic
1062284131 9:135765571-135765593 GAGCCAGCCCCTGCCCCGCCCGG - Intronic
1062297398 9:135840003-135840025 GAGTCAGCACTGGTCTTGGCAGG - Intronic
1062629010 9:137455323-137455345 GAGTCAGCACTGCCCTTGGCCGG + Intronic
1189056058 X:37700591-37700613 GTGAGAGCACTGGCCCTGGCGGG + Intronic
1192184988 X:68940716-68940738 AAGTCAGCATGGGCCCTGCCTGG + Intergenic
1192251351 X:69416741-69416763 GAGCCAGCTCCGGCCTTGGCTGG - Intergenic
1192503751 X:71668797-71668819 GCACCAGAACTGGCCCTGCGGGG + Intergenic
1192522513 X:71814849-71814871 GCACCAGAACTGGCCCTGCGGGG + Intergenic
1193234066 X:79085181-79085203 CAGCCACCACTGGCCTTTCCAGG + Intergenic
1198047084 X:132913655-132913677 CAGCCAGCGATGGCCATGCCTGG - Intronic
1198987608 X:142473889-142473911 AAGCCAGCAGTGGTCCTCCCTGG - Intergenic
1200115959 X:153769812-153769834 CCGCCCGCACTGGCCCTTCCGGG - Exonic
1201730478 Y:17197308-17197330 AACCAAGCACTGGCCCTTCCAGG - Intergenic