ID: 1083594017

View in Genome Browser
Species Human (GRCh38)
Location 11:63910485-63910507
Sequence GGTTTGGGGCGCTTGGCTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 216}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083594007_1083594017 3 Left 1083594007 11:63910459-63910481 CCTCAGTGGCCAGTGTGGGCGTG 0: 1
1: 0
2: 1
3: 16
4: 255
Right 1083594017 11:63910485-63910507 GGTTTGGGGCGCTTGGCTGGTGG 0: 1
1: 0
2: 0
3: 14
4: 216
1083594011_1083594017 -6 Left 1083594011 11:63910468-63910490 CCAGTGTGGGCGTGGGCGGTTTG 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1083594017 11:63910485-63910507 GGTTTGGGGCGCTTGGCTGGTGG 0: 1
1: 0
2: 0
3: 14
4: 216
1083594003_1083594017 15 Left 1083594003 11:63910447-63910469 CCAGCTTGCTACCCTCAGTGGCC 0: 1
1: 0
2: 0
3: 16
4: 159
Right 1083594017 11:63910485-63910507 GGTTTGGGGCGCTTGGCTGGTGG 0: 1
1: 0
2: 0
3: 14
4: 216
1083594002_1083594017 16 Left 1083594002 11:63910446-63910468 CCCAGCTTGCTACCCTCAGTGGC 0: 1
1: 0
2: 0
3: 9
4: 216
Right 1083594017 11:63910485-63910507 GGTTTGGGGCGCTTGGCTGGTGG 0: 1
1: 0
2: 0
3: 14
4: 216
1083594006_1083594017 4 Left 1083594006 11:63910458-63910480 CCCTCAGTGGCCAGTGTGGGCGT 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1083594017 11:63910485-63910507 GGTTTGGGGCGCTTGGCTGGTGG 0: 1
1: 0
2: 0
3: 14
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083594017 Original CRISPR GGTTTGGGGCGCTTGGCTGG TGG Exonic