ID: 1083594018

View in Genome Browser
Species Human (GRCh38)
Location 11:63910488-63910510
Sequence TTGGGGCGCTTGGCTGGTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 210}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083594007_1083594018 6 Left 1083594007 11:63910459-63910481 CCTCAGTGGCCAGTGTGGGCGTG 0: 1
1: 0
2: 1
3: 16
4: 255
Right 1083594018 11:63910488-63910510 TTGGGGCGCTTGGCTGGTGGTGG 0: 1
1: 0
2: 1
3: 16
4: 210
1083594006_1083594018 7 Left 1083594006 11:63910458-63910480 CCCTCAGTGGCCAGTGTGGGCGT 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1083594018 11:63910488-63910510 TTGGGGCGCTTGGCTGGTGGTGG 0: 1
1: 0
2: 1
3: 16
4: 210
1083594011_1083594018 -3 Left 1083594011 11:63910468-63910490 CCAGTGTGGGCGTGGGCGGTTTG 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1083594018 11:63910488-63910510 TTGGGGCGCTTGGCTGGTGGTGG 0: 1
1: 0
2: 1
3: 16
4: 210
1083594002_1083594018 19 Left 1083594002 11:63910446-63910468 CCCAGCTTGCTACCCTCAGTGGC 0: 1
1: 0
2: 0
3: 9
4: 216
Right 1083594018 11:63910488-63910510 TTGGGGCGCTTGGCTGGTGGTGG 0: 1
1: 0
2: 1
3: 16
4: 210
1083594003_1083594018 18 Left 1083594003 11:63910447-63910469 CCAGCTTGCTACCCTCAGTGGCC 0: 1
1: 0
2: 0
3: 16
4: 159
Right 1083594018 11:63910488-63910510 TTGGGGCGCTTGGCTGGTGGTGG 0: 1
1: 0
2: 1
3: 16
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083594018 Original CRISPR TTGGGGCGCTTGGCTGGTGG TGG Exonic
900371243 1:2333110-2333132 TTGGGGGGCGTGACTGGGGGTGG + Intronic
903494469 1:23756088-23756110 TTGGTGGGCTTGGCTGGTGTAGG + Intronic
904429305 1:30451736-30451758 CAAGGTCGCTTGGCTGGTGGGGG + Intergenic
904676003 1:32199678-32199700 TTGGGCCTCTTGGCTGATGTGGG - Intergenic
904995080 1:34625471-34625493 TTGGGGAGCTTTGCTGGCTGGGG + Intergenic
907055208 1:51359984-51360006 TTGGGGGGCTGAGGTGGTGGAGG - Intronic
913177824 1:116291273-116291295 TATGGGAGCTTGGCAGGTGGTGG + Intergenic
915123417 1:153647205-153647227 TTGGGGAGGTTGGCTGGGAGGGG - Intergenic
915509222 1:156377496-156377518 TTGGGGAGCTGGGTGGGTGGCGG - Intronic
915934530 1:160082921-160082943 TTGGGGCATATGGCAGGTGGGGG + Intronic
920655180 1:207869080-207869102 GCGGGGCGCTTGGCGGGCGGGGG - Intergenic
923589877 1:235309228-235309250 ATGGGGCGGTTGCCAGGTGGAGG - Intronic
1063391243 10:5651091-5651113 TGGGAGCCCTTGGCTGGTGAAGG - Intronic
1066645431 10:37602746-37602768 TTGGGTAGCTTGGCTGGTTTTGG + Exonic
1067090719 10:43264747-43264769 GAGGGGCGCTGGGCTGCTGGGGG - Intronic
1069034183 10:63630402-63630424 TGGGGGGGCTGGGCTGGCGGGGG + Intergenic
1071463479 10:85919934-85919956 TTGGGGGTGTTGGCTGGTGTTGG - Intronic
1075402735 10:122172724-122172746 CTGGGGCGCAGGGCTGCTGGGGG + Intronic
1075404880 10:122188097-122188119 TTGGGTCTCTTGGCTGGAAGAGG - Intronic
1077363215 11:2150235-2150257 TTGGGGTGCGTGGGTGTTGGAGG - Intronic
1077418489 11:2436990-2437012 TGTGGGCTCATGGCTGGTGGCGG - Intergenic
1077505903 11:2929840-2929862 TTGGGGCGCCTGGAGGGTGAAGG - Intergenic
1078993201 11:16670058-16670080 TTGGGGGCCTTGCCTGGTGAAGG - Intronic
1079136068 11:17776647-17776669 TGGGGGCCCTGGGCTGGGGGAGG + Intronic
1080213818 11:29818098-29818120 TTGGGGTCCTTGCCTAGTGGCGG + Intergenic
1080544291 11:33300435-33300457 TTTGGCTGGTTGGCTGGTGGAGG - Intronic
1081106615 11:39078546-39078568 TTGGGGCCCTTCTCTGGTGCTGG + Intergenic
1081621194 11:44620033-44620055 TAGGGGAGCTGGGCTGGAGGGGG + Exonic
1081993919 11:47351840-47351862 TTCGGGCCCTTGGCAGGGGGCGG + Intronic
1082838520 11:57668755-57668777 ATGGAGCACTCGGCTGGTGGCGG - Intronic
1083594018 11:63910488-63910510 TTGGGGCGCTTGGCTGGTGGTGG + Exonic
1084087904 11:66862999-66863021 CTTGGGCTCTTGCCTGGTGGGGG + Intronic
1084441175 11:69174193-69174215 TTGGAGAGCTGGGCTGCTGGAGG + Intergenic
1084701486 11:70788969-70788991 TTGGGGTGTGGGGCTGGTGGCGG + Intronic
1086017207 11:82181956-82181978 ATGGGGCGGTTGCCAGGTGGAGG - Intergenic
1086756419 11:90569376-90569398 TTGGGGAGGTTGGGGGGTGGCGG - Intergenic
1088487771 11:110357402-110357424 TTGGGTCACTTGGCTAGTTGGGG + Intergenic
1089854733 11:121533228-121533250 TTGGTGCGTTAGGTTGGTGGGGG + Intronic
1089960907 11:122616653-122616675 GTGGGGCCCTGGGCTGATGGAGG - Intergenic
1090460514 11:126887609-126887631 TGGGGACCCTTGGTTGGTGGGGG - Intronic
1091637086 12:2205303-2205325 CTGTGGGGCTTGGCTGGTGGGGG + Intronic
1092257634 12:6936132-6936154 TGGGGGAAGTTGGCTGGTGGTGG - Exonic
1092473783 12:8801587-8801609 GTGGGGTGGTTGGCTGGGGGAGG + Intergenic
1092913782 12:13171569-13171591 ATGGGGCGGTAGGGTGGTGGTGG + Intergenic
1095571204 12:43685494-43685516 ATGGGGCGGCTGGCTGGGGGGGG - Intergenic
1096255087 12:50057855-50057877 CTGGGGCGCTGGACCGGTGGCGG - Exonic
1096522928 12:52194241-52194263 CTGGGGCTCTGGGCTGGGGGAGG + Intergenic
1096777565 12:53973610-53973632 GCGGGGCGCTGGGGTGGTGGTGG - Exonic
1096812916 12:54183130-54183152 TGGGGGTGCTTGGCAGGTGGGGG - Intronic
1097192750 12:57227183-57227205 TTGGGGCCCCTGGCTGGAGGAGG + Intergenic
1101822885 12:108197471-108197493 CTGGGCCACATGGCTGGTGGGGG - Intronic
1102943167 12:116961854-116961876 TTGAAGGGCTTGGCTTGTGGGGG + Intronic
1103559960 12:121788462-121788484 TTGGGGCGTGGGGGTGGTGGGGG + Intronic
1103563297 12:121803754-121803776 GTGGGGGTCTTGGCTGGCGGGGG - Intergenic
1103596123 12:122025134-122025156 TGGGGGCCCTGTGCTGGTGGAGG + Intronic
1104047561 12:125173863-125173885 TGGGGGGGGTGGGCTGGTGGGGG + Intergenic
1104948316 12:132427336-132427358 CTGGGGCGGGTGGCCGGTGGGGG + Intergenic
1105454162 13:20525550-20525572 TGGAGGGGCTTGGCAGGTGGAGG - Intronic
1112976601 13:105327175-105327197 TTGGGTCTGTTGGCAGGTGGGGG + Intergenic
1113381230 13:109808073-109808095 TTGGGAGGCTTGGGTGGGGGGGG - Intergenic
1113588762 13:111483509-111483531 TTGGGGCGCTGGCCTGGGGAAGG + Intergenic
1114490163 14:23095461-23095483 CTGGGGCGCTTGGGTGTTTGGGG + Exonic
1115147451 14:30241605-30241627 TTGGGGCGCATGGTGGGTTGGGG + Intergenic
1117436773 14:55722774-55722796 TTGGGGAGACTGGCTGGAGGCGG - Intergenic
1118099384 14:62579070-62579092 TTGGGGGGCTTGGAGGGAGGTGG + Intergenic
1121377990 14:93431170-93431192 TTGGGGCGGGTGGGGGGTGGCGG + Intronic
1122259259 14:100502774-100502796 TTGGGAGGCTTGGCTGGCAGAGG + Intronic
1123033980 14:105464308-105464330 TGGGGGTGCCTGGCGGGTGGGGG + Intronic
1123044319 14:105503987-105504009 AGGGGGCGCCGGGCTGGTGGGGG + Intergenic
1123044358 14:105504089-105504111 TGGGGGCGCTGGGCCGGTTGGGG + Intergenic
1124055961 15:26241252-26241274 TTGGTGTTCTTGGCTGGTAGAGG - Intergenic
1127638601 15:60894118-60894140 GCGGGCCGCGTGGCTGGTGGAGG - Intronic
1127691745 15:61403536-61403558 TTGGGGAGCTTCAGTGGTGGAGG + Intergenic
1129220970 15:74131382-74131404 ATGGGGTGCGGGGCTGGTGGGGG + Intronic
1131513689 15:93063849-93063871 TTGGGGTGCTGGGGTTGTGGAGG + Intronic
1132113789 15:99121040-99121062 TTTGGGCCTTTGGGTGGTGGGGG + Intronic
1132802872 16:1762867-1762889 TAGGGGCGCTTGGCCGGAGGGGG - Exonic
1132885531 16:2180507-2180529 CTGGAGCGCTTGGGTGGGGGCGG + Exonic
1133590558 16:7238795-7238817 TGGGGTCTCTTGGCAGGTGGAGG - Intronic
1134036278 16:11033531-11033553 TGGTGGGGCTTTGCTGGTGGAGG + Intronic
1136170481 16:28486438-28486460 TGGGGGAGCTGGGCTGCTGGGGG - Exonic
1136475474 16:30510506-30510528 TAGGGGCCCTGAGCTGGTGGAGG + Intronic
1137602385 16:49765039-49765061 TGGAGGCACTTGGCTGGGGGTGG - Intronic
1138552040 16:57753534-57753556 TGGGGACGCTGGGCTGGGGGCGG - Intronic
1141186615 16:81792082-81792104 TGTGGGAGCTTGGCTGCTGGTGG - Intronic
1142172230 16:88628815-88628837 TTGGGCCGCTTGGCTGGAGGAGG - Exonic
1142175866 16:88645024-88645046 TGGGGCCACATGGCTGGTGGTGG + Intronic
1142858731 17:2748820-2748842 TGGGGCCGCTTGGCCAGTGGTGG + Intergenic
1142907120 17:3051259-3051281 GTGGGTTGCTTGCCTGGTGGTGG + Intergenic
1142927448 17:3252997-3253019 GTGGGTTGCTTGCCTGGTGGTGG - Intergenic
1143055063 17:4156414-4156436 CTGGGGCACTTGGCTGGGGGTGG - Intronic
1143445201 17:7005219-7005241 TTGGAGGGCGTGACTGGTGGAGG - Intronic
1144814524 17:18024804-18024826 TTGTGGGGCTGGGATGGTGGTGG - Intronic
1144825114 17:18101424-18101446 TTGGGGCCCTCCGCTGATGGGGG + Intronic
1146059020 17:29594741-29594763 TTGGGGCCATGGGCTGGGGGTGG + Intronic
1146126275 17:30234013-30234035 TGGGGATGCTTGGCTGGAGGGGG - Intronic
1146175957 17:30666968-30666990 TTGGGGGTCCAGGCTGGTGGTGG + Intergenic
1146461871 17:33052533-33052555 TTGAGGAGCTTGGCAGGTGGAGG + Intronic
1147239415 17:39080731-39080753 TGGGGGAGCATGGCTGGTGCAGG - Intronic
1147604299 17:41765324-41765346 TTGGGGTGCTTGGCTGGGTGTGG - Intronic
1148581931 17:48750148-48750170 TTGGGGCGATTGGCTGAGCGCGG - Intergenic
1149712605 17:58756468-58756490 TAGCTGGGCTTGGCTGGTGGTGG + Intronic
1150364545 17:64569826-64569848 CTAGGGCGCTTGCCTGGTTGTGG - Intronic
1151637658 17:75362821-75362843 TGGGTGAGCTTGGCTGGAGGTGG - Intronic
1152077618 17:78168932-78168954 TCGGGGCGCGAGGCTGGGGGTGG - Intronic
1152542099 17:80981646-80981668 TGGGGGCGCTGGGCTGCAGGGGG - Intergenic
1152931083 17:83110185-83110207 TGGGGGCGCTGGCCTGGGGGAGG + Intergenic
1153354318 18:4118652-4118674 CTGGGGAGCTGGGGTGGTGGTGG + Intronic
1153519688 18:5940010-5940032 TCGGGGCCCTTGGCTGGCAGGGG + Intergenic
1153800363 18:8663107-8663129 TTGGGGAGCATGGGTGGAGGGGG - Intergenic
1154210894 18:12377507-12377529 GTGGGGGGCGTGGCTGGAGGTGG + Intergenic
1154210920 18:12377587-12377609 GTGGGGGGCGTGGCTGGAGGCGG + Intergenic
1157820683 18:50766274-50766296 GTGGGGCGATTGGATTGTGGGGG - Intergenic
1160058342 18:75507350-75507372 ATGAGGGGCTTGGCTGGTAGTGG + Intergenic
1160900886 19:1427759-1427781 TTGGGGCATTGGGCAGGTGGGGG + Intronic
1161256660 19:3313673-3313695 TTGGGGGGTTTGGGTGGTAGGGG - Intergenic
1161351957 19:3798356-3798378 GTGGGGTGGTTGGCGGGTGGGGG + Intronic
1161391614 19:4024131-4024153 GTGGGGTGCTGGGCTGGGGGAGG - Intronic
1161710210 19:5843514-5843536 CTGGGGACCTTGGCTGCTGGAGG - Exonic
1161988498 19:7670532-7670554 GTGGGGCGCGTAGCTGCTGGAGG + Intergenic
1162158175 19:8694058-8694080 TAGGGGCGGATGGCAGGTGGAGG + Intergenic
1162326435 19:10002421-10002443 TTGGGGTCTTTGGCTGGTGGGGG - Intronic
1162730403 19:12715220-12715242 GTGGGCCGCTGGGCTGGGGGTGG - Intronic
1163282847 19:16327570-16327592 TTGGGGCACTTGGGAGGAGGGGG + Exonic
1163758720 19:19121497-19121519 GTGGGTCGCTTGGTGGGTGGGGG - Intronic
1166056535 19:40293014-40293036 TTGGGGCTTTTGGGAGGTGGTGG - Intergenic
1167100502 19:47401725-47401747 AGGGGGCGCTTGGATGGCGGAGG + Intergenic
1167581008 19:50342842-50342864 TTGGGGCTCTTCGCAGGGGGAGG - Intronic
928666912 2:33558789-33558811 CTGGGTGGCCTGGCTGGTGGTGG - Exonic
929814373 2:45219597-45219619 GTGGGGCCTTTGGCTTGTGGGGG + Intergenic
930046337 2:47176169-47176191 CTCGGGGGCTTGGCTGGAGGAGG - Intronic
932231071 2:70085145-70085167 TTGGGGTGCTGGGGTGGGGGAGG + Intergenic
932341181 2:70963448-70963470 GTGGGGGGCATGGATGGTGGAGG - Intronic
932407946 2:71526388-71526410 TGGAGGCGCAGGGCTGGTGGGGG + Intronic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
934921571 2:98348250-98348272 TTGGGGTGACTGGCTGGTGGAGG + Intronic
936293044 2:111241944-111241966 TTGTGCCACTTGGCTGGGGGCGG - Intergenic
937119632 2:119432421-119432443 TTGGGGTGCTGGGCTGGGGGTGG + Intronic
946167512 2:217873998-217874020 TTGGGGGGCGGGGGTGGTGGTGG - Intronic
947625157 2:231614323-231614345 TCGGGGCGCCTGGGTGGGGGCGG - Intergenic
948265614 2:236633304-236633326 TTGGGGTGCATGGACGGTGGGGG + Intergenic
948895616 2:240925555-240925577 GTGGGGCCCATGGCAGGTGGGGG + Intronic
1176254726 20:64145977-64145999 TTGGGTCTCCTGGCTGGTGGGGG + Intergenic
1178397007 21:32251505-32251527 ATGGGGTGCTTGGGTGGTGGGGG - Intergenic
1179962735 21:44779357-44779379 TTGGGGAGCTGGGGTGGGGGGGG + Intronic
1180046823 21:45310384-45310406 TGGGGGAGCTGGGCAGGTGGGGG + Intergenic
1180180300 21:46115952-46115974 CTGGGGCGCTGGGCTGCAGGCGG - Intronic
1181584680 22:23846658-23846680 CTGGGGTGCTTGGCCGGAGGTGG - Intergenic
1182295932 22:29311284-29311306 TTGGGGCCCTGGGCCGCTGGAGG + Intronic
1182583412 22:31328715-31328737 TGGGGGCGCTGGGCTGGGCGTGG - Intronic
1183543180 22:38441522-38441544 TTGGGGCTGCCGGCTGGTGGGGG + Intronic
1183913105 22:41093032-41093054 TTAGGCCGCTTGGCTGAAGGCGG - Exonic
1184263364 22:43332544-43332566 TGGGACCCCTTGGCTGGTGGGGG + Intronic
1184515606 22:44960182-44960204 TTGGGTCCCGTGGCTTGTGGAGG - Intronic
1184841150 22:47053094-47053116 GTGAGGCCCTGGGCTGGTGGTGG - Intronic
1184841160 22:47053127-47053149 GTGAGGCCCTGGGCTGGTGGTGG - Intronic
1184841170 22:47053160-47053182 GTGAGGCCCTGGGCTGGTGGTGG - Intronic
949951773 3:9235082-9235104 TTGTGGCGCCTGGCTTGTGTTGG - Intronic
950468282 3:13168666-13168688 TTGGGGAGCTTGGCTGTGTGAGG - Intergenic
952945479 3:38475823-38475845 GTAGGGCTCTTGGCTGCTGGTGG + Intronic
953899842 3:46833837-46833859 TTGGGGCGCCAGGCTGGGGCAGG - Intronic
961403823 3:126665321-126665343 TGGTGGCCCTTGGCAGGTGGAGG + Intergenic
965302396 3:167019020-167019042 ATGGGGCGGCTGGCTGGCGGGGG - Intergenic
966762044 3:183427701-183427723 CTGGGGCGCGCCGCTGGTGGGGG - Intronic
967857712 3:194130882-194130904 CTGGGGCGCGTGCCAGGTGGGGG - Intergenic
968593945 4:1472983-1473005 GTGGGGTGCGTGGCAGGTGGGGG - Intergenic
969040223 4:4290092-4290114 CTGCGGCGCTGGGCTGGCGGCGG - Exonic
969573107 4:8021678-8021700 AGGGGGCTCTTGCCTGGTGGTGG + Intronic
970472680 4:16393403-16393425 TCGGGGCGGCTGGCCGGTGGCGG + Intergenic
972143118 4:35986011-35986033 TTGGGGAGCTAGTGTGGTGGGGG + Intronic
973118847 4:46492682-46492704 TAGGGACACTTGACTGGTGGGGG - Intergenic
974271583 4:59656890-59656912 TTGGGGGGCTTTGTTGGTGGTGG - Intergenic
974587854 4:63902882-63902904 GTGGGGTGGGTGGCTGGTGGAGG - Intergenic
980285777 4:130776944-130776966 TTGCCTCGCTTGGCTGGGGGAGG - Intergenic
985719107 5:1480141-1480163 TTGGGGCACTGGGCTGTCGGAGG - Intronic
994343545 5:98660551-98660573 TTGTGGGGCTTGGTTGGTAGGGG - Intergenic
998601822 5:143592583-143592605 GTGGGGAGCCTGACTGGTGGGGG - Intergenic
1001101859 5:168820940-168820962 TTGGGGGGGACGGCTGGTGGTGG - Intronic
1001634870 5:173202678-173202700 TTGGGAAGCTGGGCTGGGGGAGG + Intergenic
1001757440 5:174181323-174181345 TTGGGGAGCTTGCTGGGTGGAGG - Intronic
1001902731 5:175444780-175444802 TTGGGGCGCTCGGGAGGTGCGGG - Intergenic
1003087166 6:3069065-3069087 TCGGGGCGCTGGACTGGTAGCGG + Intronic
1003996941 6:11551142-11551164 ATGTGGCTCTTGGCAGGTGGTGG + Intronic
1004706243 6:18126379-18126401 TAGGGGCGGTGGGGTGGTGGAGG + Intergenic
1007450117 6:41936015-41936037 TTTGGGCGCTGGGCTGGAGCTGG + Exonic
1010833796 6:80562473-80562495 TTGGGGCATTTCACTGGTGGAGG - Intergenic
1013153368 6:107468679-107468701 TTGAGGCCCTAGGCTGGTCGTGG + Intergenic
1014992803 6:128103158-128103180 TTGAGGAGCTTGGCTGGGGAAGG + Intronic
1020101759 7:5397754-5397776 TTGGGTCGTGTGGCTGTTGGAGG - Intronic
1020138388 7:5599034-5599056 CAGGGCCTCTTGGCTGGTGGAGG + Intronic
1020895473 7:13933594-13933616 GTGGGGTGCCTGGCTGGAGGGGG + Intronic
1020937314 7:14483814-14483836 TTGTGGCTCTTGGCTTCTGGTGG - Intronic
1024943136 7:54782749-54782771 ATGGGGCTCCTGGGTGGTGGAGG + Intergenic
1025572957 7:62599758-62599780 TGGGGCGGCTGGGCTGGTGGGGG + Intergenic
1027132251 7:75599338-75599360 TGGGGGAGGTTGGCTGGAGGAGG - Intronic
1027340355 7:77201249-77201271 TTGGAGCACTTGGCTGGGCGTGG + Intronic
1028475284 7:91246909-91246931 GTGGGGAGCTTGGCTGGTGCTGG + Intergenic
1029595014 7:101533181-101533203 CTGGGGACCTTGGGTGGTGGAGG + Intronic
1029702785 7:102258637-102258659 GTGCGGCACTGGGCTGGTGGTGG + Intronic
1031366533 7:120906696-120906718 TTGGGGTGGGTGGCTGGAGGAGG + Intergenic
1031913708 7:127543233-127543255 TTGGATGGCTTGGATGGTGGAGG - Intergenic
1036061073 8:5321547-5321569 TGGGGGCGCTAGGCTGGTAAGGG - Intergenic
1036142984 8:6225471-6225493 GTGGAGCGCTGGGCTTGTGGAGG - Intergenic
1036669455 8:10771663-10771685 TTGGGGCCAGTGGGTGGTGGTGG - Intronic
1043072822 8:75660971-75660993 TTGGGGAGGTTGGCTGGGCGTGG + Intergenic
1046672686 8:117074022-117074044 TTGGGGCGGGTGGGTGGGGGTGG + Intronic
1046787385 8:118282574-118282596 TAGGGGGGCTGGGGTGGTGGTGG + Intronic
1053199118 9:36140816-36140838 CTGGGGTGTTTGGATGGTGGGGG - Intronic
1054910108 9:70446848-70446870 TTGGGGAGATTGGAAGGTGGAGG + Intergenic
1056382101 9:86064801-86064823 TTGAGCCGCCTGCCTGGTGGGGG + Intronic
1057119528 9:92558975-92558997 TTGGGGCTGTTGGGTGGCGGGGG - Intronic
1057604956 9:96492451-96492473 TAGGGGTGCTTGGCTGGGTGCGG + Intronic
1058815652 9:108680671-108680693 TTGGGGGGCTGGGATGGTGGCGG - Intergenic
1060397732 9:123327741-123327763 TCAGGGAGCTTGGCTGCTGGTGG + Intergenic
1061926884 9:133810298-133810320 TTGGGTCTGTTGGCTGGTTGTGG - Intronic
1062517439 9:136943680-136943702 TTGGGTCACTTGGGGGGTGGGGG - Intronic
1190641916 X:52488255-52488277 TTGGGTCCCTAGGCTGGAGGAGG + Intergenic
1190645756 X:52524611-52524633 TTGGGTCCCTAGGCTGGAGGAGG - Intergenic
1192497637 X:71626764-71626786 CTGGGGCTCTTGGCTGCTGCTGG + Intergenic
1192736080 X:73850748-73850770 TTGGGGGGGTTGGGGGGTGGGGG + Intergenic
1193083486 X:77427738-77427760 ATGGAGCACTTGGCTGGAGGTGG - Intergenic
1193345269 X:80397172-80397194 ATGGGGCGGTTGCCAGGTGGAGG + Intronic
1195042590 X:101028033-101028055 TTAGTACCCTTGGCTGGTGGGGG - Intronic
1196056544 X:111362449-111362471 TTGTGGAGCTAGGATGGTGGGGG - Intronic
1196430548 X:115620450-115620472 TTGGGGGGCAGGGATGGTGGTGG - Intronic
1198119631 X:133579305-133579327 TTGGGGGTCTTGGGGGGTGGTGG - Intronic
1199851505 X:151727412-151727434 TTGGGGCTCTAGGAGGGTGGAGG + Intergenic
1200080984 X:153576239-153576261 ATGGAGGGCTTTGCTGGTGGGGG + Intronic