ID: 1083595721

View in Genome Browser
Species Human (GRCh38)
Location 11:63917511-63917533
Sequence TGGGCTCCACCCGGGCGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083595721_1083595730 8 Left 1083595721 11:63917511-63917533 CCCGCCCGCCCGGGTGGAGCCCA No data
Right 1083595730 11:63917542-63917564 TTCCATTTCCCTTCCTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083595721 Original CRISPR TGGGCTCCACCCGGGCGGGC GGG (reversed) Intergenic
No off target data available for this crispr