ID: 1083595730

View in Genome Browser
Species Human (GRCh38)
Location 11:63917542-63917564
Sequence TTCCATTTCCCTTCCTGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083595725_1083595730 0 Left 1083595725 11:63917519-63917541 CCCGGGTGGAGCCCAGCTTTTCC No data
Right 1083595730 11:63917542-63917564 TTCCATTTCCCTTCCTGCCAAGG No data
1083595715_1083595730 22 Left 1083595715 11:63917497-63917519 CCTGGGGCCGCCTGCCCGCCCGC No data
Right 1083595730 11:63917542-63917564 TTCCATTTCCCTTCCTGCCAAGG No data
1083595724_1083595730 3 Left 1083595724 11:63917516-63917538 CCGCCCGGGTGGAGCCCAGCTTT No data
Right 1083595730 11:63917542-63917564 TTCCATTTCCCTTCCTGCCAAGG No data
1083595723_1083595730 4 Left 1083595723 11:63917515-63917537 CCCGCCCGGGTGGAGCCCAGCTT No data
Right 1083595730 11:63917542-63917564 TTCCATTTCCCTTCCTGCCAAGG No data
1083595720_1083595730 12 Left 1083595720 11:63917507-63917529 CCTGCCCGCCCGCCCGGGTGGAG No data
Right 1083595730 11:63917542-63917564 TTCCATTTCCCTTCCTGCCAAGG No data
1083595718_1083595730 15 Left 1083595718 11:63917504-63917526 CCGCCTGCCCGCCCGCCCGGGTG No data
Right 1083595730 11:63917542-63917564 TTCCATTTCCCTTCCTGCCAAGG No data
1083595714_1083595730 23 Left 1083595714 11:63917496-63917518 CCCTGGGGCCGCCTGCCCGCCCG No data
Right 1083595730 11:63917542-63917564 TTCCATTTCCCTTCCTGCCAAGG No data
1083595713_1083595730 30 Left 1083595713 11:63917489-63917511 CCGGGGGCCCTGGGGCCGCCTGC No data
Right 1083595730 11:63917542-63917564 TTCCATTTCCCTTCCTGCCAAGG No data
1083595726_1083595730 -1 Left 1083595726 11:63917520-63917542 CCGGGTGGAGCCCAGCTTTTCCT No data
Right 1083595730 11:63917542-63917564 TTCCATTTCCCTTCCTGCCAAGG No data
1083595722_1083595730 7 Left 1083595722 11:63917512-63917534 CCGCCCGCCCGGGTGGAGCCCAG No data
Right 1083595730 11:63917542-63917564 TTCCATTTCCCTTCCTGCCAAGG No data
1083595721_1083595730 8 Left 1083595721 11:63917511-63917533 CCCGCCCGCCCGGGTGGAGCCCA No data
Right 1083595730 11:63917542-63917564 TTCCATTTCCCTTCCTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083595730 Original CRISPR TTCCATTTCCCTTCCTGCCA AGG Intergenic
No off target data available for this crispr