ID: 1083602048

View in Genome Browser
Species Human (GRCh38)
Location 11:63954765-63954787
Sequence GGTGCGAGAACCTCCACTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083602048_1083602050 -1 Left 1083602048 11:63954765-63954787 CCTGCAGTGGAGGTTCTCGCACC 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1083602050 11:63954787-63954809 CTCTGCAGCCCCTAGATTCCTGG 0: 1
1: 0
2: 1
3: 21
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083602048 Original CRISPR GGTGCGAGAACCTCCACTGC AGG (reversed) Exonic
900115613 1:1026636-1026658 GGTGCCAGAACCAGGACTGCAGG - Intronic
907304269 1:53505118-53505140 GGTGCAAGAACCTCGTCAGCAGG + Intergenic
912233989 1:107828655-107828677 GGAGAGAGATGCTCCACTGCAGG - Intronic
923197685 1:231684024-231684046 GCTGTGAGCAACTCCACTGCAGG - Intronic
1067281128 10:44873950-44873972 GGTGCGAGAATCTGCGCTGGAGG + Intergenic
1076863585 10:133155681-133155703 GGAAAGAGAACCTCCACTGTGGG + Intergenic
1076863591 10:133155718-133155740 GGAAAGAGAACCTCCACTGTGGG + Intergenic
1076863597 10:133155755-133155777 GGAAAGAGAACCTCCACTGTGGG + Intergenic
1076863603 10:133155792-133155814 GGAAAGAGAACCTCCACTGTGGG + Intergenic
1076863609 10:133155829-133155851 GGAAAGAGAACCTCCACTGTGGG + Intergenic
1076863615 10:133155866-133155888 GGAAAGAGAACCTCCACTGTGGG + Intergenic
1076863621 10:133155903-133155925 GGAAAGAGAACCTCCACTGTGGG + Intergenic
1076863627 10:133155940-133155962 GGAAAGAGAACCTCCACTGTGGG + Intergenic
1076863633 10:133155977-133155999 GGAAAGAGAACCTCCACTGTGGG + Intergenic
1076863639 10:133156014-133156036 GGAAAGAGAACCTCCACTGTGGG + Intergenic
1076863645 10:133156051-133156073 GGAAAGAGAACCTCCACTGTGGG + Intergenic
1076863678 10:133156310-133156332 GGAAAGAGAACCTCCACTGTGGG + Intergenic
1076863689 10:133156384-133156406 GGAAAGAGAACCTCCACTGTGGG + Intergenic
1076863695 10:133156421-133156443 GGAAAGAGAACCTCCACTGTGGG + Intergenic
1076863710 10:133156532-133156554 GGAAAGAGAACCTCCACTGTGGG + Intergenic
1083602048 11:63954765-63954787 GGTGCGAGAACCTCCACTGCAGG - Exonic
1084313843 11:68332355-68332377 GGGCCGAGCACCTCCAATGCTGG - Intronic
1088168614 11:106968613-106968635 GGAGGGAGAACCTCCAGTGTTGG - Intronic
1089397342 11:118145090-118145112 GCTTCGAGGACCTCCACTTCCGG - Exonic
1097312121 12:58130932-58130954 TGTGCAAAAACCCCCACTGCAGG - Intergenic
1107077162 13:36335106-36335128 GGTGCACTAACCTCCCCTGCAGG + Exonic
1111516456 13:89337974-89337996 GATGTGAGATTCTCCACTGCTGG - Intergenic
1112443157 13:99439747-99439769 GGTGCGAGATTCTCCACTCTGGG + Intergenic
1115852989 14:37602135-37602157 GGTGCGCAAACCTGCCCTGCGGG - Intronic
1123946050 15:25239409-25239431 CTTGAGAGCACCTCCACTGCCGG - Intergenic
1127356377 15:58204856-58204878 AGCGCGGTAACCTCCACTGCTGG + Intronic
1132547356 16:539518-539540 GGGGCGAGAGCCACCCCTGCTGG - Intronic
1137483828 16:48875104-48875126 GGTGGGAGAGACTCCAATGCAGG - Intergenic
1140947597 16:79784491-79784513 GGTGACAAAACCTCCACTGTTGG - Intergenic
1143389817 17:6553689-6553711 GGTGCCACAGCCTCCACTCCTGG + Intronic
1145248706 17:21285699-21285721 GGGGTGAGAACCCCCAGTGCAGG - Intronic
1155415969 18:25600369-25600391 GGGGCGAGTAGCTCAACTGCTGG - Intergenic
1157727926 18:49979092-49979114 GGTGGAGGAACCTCCAGTGCAGG - Intronic
1163121797 19:15222867-15222889 TGTCCGAGACCCTCCCCTGCTGG + Intergenic
1164846000 19:31433026-31433048 CTTGCCAGAACATCCACTGCAGG - Intergenic
1165903234 19:39178462-39178484 GGTGCGAGACCCTGCCCAGCGGG + Exonic
925426582 2:3753724-3753746 AGTGCTTGAACCTCCACTGAGGG + Intronic
927717074 2:25359884-25359906 GGTGCAAGAACCTGGGCTGCGGG + Intergenic
927786763 2:25980263-25980285 TGAGGGAGAACCTCCACTTCAGG + Intronic
932731642 2:74226058-74226080 GGGTTGAGAACCCCCACTGCAGG - Intronic
938078455 2:128354820-128354842 GGTGGGACACCCTCCCCTGCTGG - Intergenic
940846884 2:158651465-158651487 GGTGGGAAAACCTGAACTGCAGG - Intronic
1169032072 20:2417395-2417417 GGTGCTAGAGCCTCCCATGCTGG + Exonic
1173259023 20:41416660-41416682 GGTTCGAGAACCAGCACTGCTGG + Exonic
1175939282 20:62530515-62530537 GGGGCGAGAACCCCCCCTGGAGG - Intergenic
1176172334 20:63701622-63701644 GGTGGGAGAACCTCCAGGGCTGG + Intronic
1180558019 22:16592943-16592965 GGTGCATGTACCTCCATTGCTGG - Intergenic
1181559652 22:23692715-23692737 GGAGCCAGCACCACCACTGCTGG + Exonic
1184566616 22:45295773-45295795 GGTGTGACAACCACCGCTGCAGG - Exonic
951689647 3:25382402-25382424 GGTGGGAGAATTTCCCCTGCAGG + Intronic
957236906 3:77605101-77605123 GGTGCGATCACATCCACTGCAGG - Intronic
964069465 3:152614091-152614113 GCTTCCAGAACCTCCACTTCCGG - Intergenic
968824562 4:2885293-2885315 GGTGGGAGGACTTCCACAGCAGG - Intronic
969429727 4:7147107-7147129 GCTCCGAGAAATTCCACTGCGGG - Intergenic
974402960 4:61427656-61427678 GGAGGAAGAACCTCCACTGCAGG - Intronic
990588779 5:57240693-57240715 GGTGTGAGAGCCACCACTCCCGG - Intronic
1000132234 5:158310687-158310709 GTTGGCAAAACCTCCACTGCTGG + Intergenic
1001476476 5:172054477-172054499 GGGGCCAGAAACTCCACAGCAGG - Intronic
1009681370 6:66897286-66897308 GGAGGAAGAACCTCCATTGCGGG + Intergenic
1014437476 6:121437012-121437034 GGTGCAAATACTTCCACTGCAGG - Intronic
1016034844 6:139374696-139374718 GGAGCGAGAGCCTCCAGGGCGGG + Intergenic
1017683518 6:156887871-156887893 GGAGCGAGACCATTCACTGCAGG - Intronic
1019553565 7:1617222-1617244 GATGCCAGGACCTCCACTGGGGG + Intergenic
1021173248 7:17420175-17420197 GGTGTGGGAACCTACACTGGGGG - Intergenic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1032829328 7:135607332-135607354 GGTGCGAGAATCTCCTCAGCTGG + Exonic
1034619297 7:152445062-152445084 GGTGCATGTACCTCCATTGCTGG + Intergenic
1047224148 8:122942602-122942624 GGCTTGAGATCCTCCACTGCAGG + Intronic
1060551753 9:124488915-124488937 GGTGGGAGAGGCTCCAGTGCTGG - Intronic
1190064902 X:47233184-47233206 TGGGCGAGAACGTCCACTGCGGG + Exonic