ID: 1083602495

View in Genome Browser
Species Human (GRCh38)
Location 11:63957739-63957761
Sequence TTCTGTGAATGGATGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083602495_1083602510 25 Left 1083602495 11:63957739-63957761 CCCTCTTCCATCCATTCACAGAA No data
Right 1083602510 11:63957787-63957809 CATGTCAGGGCTGCTGGGGCAGG No data
1083602495_1083602509 21 Left 1083602495 11:63957739-63957761 CCCTCTTCCATCCATTCACAGAA No data
Right 1083602509 11:63957783-63957805 AGCTCATGTCAGGGCTGCTGGGG No data
1083602495_1083602501 -4 Left 1083602495 11:63957739-63957761 CCCTCTTCCATCCATTCACAGAA No data
Right 1083602501 11:63957758-63957780 AGAAGACAAGGCTCCAAGGAAGG No data
1083602495_1083602503 -2 Left 1083602495 11:63957739-63957761 CCCTCTTCCATCCATTCACAGAA No data
Right 1083602503 11:63957760-63957782 AAGACAAGGCTCCAAGGAAGGGG No data
1083602495_1083602506 12 Left 1083602495 11:63957739-63957761 CCCTCTTCCATCCATTCACAGAA No data
Right 1083602506 11:63957774-63957796 AGGAAGGGGAGCTCATGTCAGGG No data
1083602495_1083602502 -3 Left 1083602495 11:63957739-63957761 CCCTCTTCCATCCATTCACAGAA No data
Right 1083602502 11:63957759-63957781 GAAGACAAGGCTCCAAGGAAGGG No data
1083602495_1083602507 19 Left 1083602495 11:63957739-63957761 CCCTCTTCCATCCATTCACAGAA No data
Right 1083602507 11:63957781-63957803 GGAGCTCATGTCAGGGCTGCTGG No data
1083602495_1083602508 20 Left 1083602495 11:63957739-63957761 CCCTCTTCCATCCATTCACAGAA No data
Right 1083602508 11:63957782-63957804 GAGCTCATGTCAGGGCTGCTGGG No data
1083602495_1083602500 -8 Left 1083602495 11:63957739-63957761 CCCTCTTCCATCCATTCACAGAA No data
Right 1083602500 11:63957754-63957776 TCACAGAAGACAAGGCTCCAAGG No data
1083602495_1083602505 11 Left 1083602495 11:63957739-63957761 CCCTCTTCCATCCATTCACAGAA No data
Right 1083602505 11:63957773-63957795 AAGGAAGGGGAGCTCATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083602495 Original CRISPR TTCTGTGAATGGATGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr