ID: 1083603178

View in Genome Browser
Species Human (GRCh38)
Location 11:63961478-63961500
Sequence CCATGGGCCTCTCTTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083603178_1083603189 21 Left 1083603178 11:63961478-63961500 CCAGAAACAAGAGAGGCCCATGG No data
Right 1083603189 11:63961522-63961544 GCTAGGGGCTCAGAAGGCAGAGG No data
1083603178_1083603190 22 Left 1083603178 11:63961478-63961500 CCAGAAACAAGAGAGGCCCATGG No data
Right 1083603190 11:63961523-63961545 CTAGGGGCTCAGAAGGCAGAGGG No data
1083603178_1083603191 23 Left 1083603178 11:63961478-63961500 CCAGAAACAAGAGAGGCCCATGG No data
Right 1083603191 11:63961524-63961546 TAGGGGCTCAGAAGGCAGAGGGG No data
1083603178_1083603185 4 Left 1083603178 11:63961478-63961500 CCAGAAACAAGAGAGGCCCATGG No data
Right 1083603185 11:63961505-63961527 TGGAGCTATGAGCGCAGGCTAGG No data
1083603178_1083603186 5 Left 1083603178 11:63961478-63961500 CCAGAAACAAGAGAGGCCCATGG No data
Right 1083603186 11:63961506-63961528 GGAGCTATGAGCGCAGGCTAGGG No data
1083603178_1083603187 6 Left 1083603178 11:63961478-63961500 CCAGAAACAAGAGAGGCCCATGG No data
Right 1083603187 11:63961507-63961529 GAGCTATGAGCGCAGGCTAGGGG No data
1083603178_1083603192 28 Left 1083603178 11:63961478-63961500 CCAGAAACAAGAGAGGCCCATGG No data
Right 1083603192 11:63961529-63961551 GCTCAGAAGGCAGAGGGGCCTGG No data
1083603178_1083603188 15 Left 1083603178 11:63961478-63961500 CCAGAAACAAGAGAGGCCCATGG No data
Right 1083603188 11:63961516-63961538 GCGCAGGCTAGGGGCTCAGAAGG No data
1083603178_1083603184 -1 Left 1083603178 11:63961478-63961500 CCAGAAACAAGAGAGGCCCATGG No data
Right 1083603184 11:63961500-63961522 GGTATTGGAGCTATGAGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083603178 Original CRISPR CCATGGGCCTCTCTTGTTTC TGG (reversed) Intergenic
No off target data available for this crispr