ID: 1083603368

View in Genome Browser
Species Human (GRCh38)
Location 11:63962271-63962293
Sequence CTGTGCTTTCAGAGGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083603368_1083603377 27 Left 1083603368 11:63962271-63962293 CCAGCTGCCCTCTGAAAGCACAG No data
Right 1083603377 11:63962321-63962343 CAGCCCTCCTGGCCAGCCCCAGG No data
1083603368_1083603374 16 Left 1083603368 11:63962271-63962293 CCAGCTGCCCTCTGAAAGCACAG No data
Right 1083603374 11:63962310-63962332 TCCTCACCATGCAGCCCTCCTGG No data
1083603368_1083603378 28 Left 1083603368 11:63962271-63962293 CCAGCTGCCCTCTGAAAGCACAG No data
Right 1083603378 11:63962322-63962344 AGCCCTCCTGGCCAGCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083603368 Original CRISPR CTGTGCTTTCAGAGGGCAGC TGG (reversed) Intergenic
No off target data available for this crispr