ID: 1083603377

View in Genome Browser
Species Human (GRCh38)
Location 11:63962321-63962343
Sequence CAGCCCTCCTGGCCAGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083603373_1083603377 19 Left 1083603373 11:63962279-63962301 CCTCTGAAAGCACAGGGCTGGCT No data
Right 1083603377 11:63962321-63962343 CAGCCCTCCTGGCCAGCCCCAGG No data
1083603372_1083603377 20 Left 1083603372 11:63962278-63962300 CCCTCTGAAAGCACAGGGCTGGC No data
Right 1083603377 11:63962321-63962343 CAGCCCTCCTGGCCAGCCCCAGG No data
1083603367_1083603377 28 Left 1083603367 11:63962270-63962292 CCCAGCTGCCCTCTGAAAGCACA No data
Right 1083603377 11:63962321-63962343 CAGCCCTCCTGGCCAGCCCCAGG No data
1083603368_1083603377 27 Left 1083603368 11:63962271-63962293 CCAGCTGCCCTCTGAAAGCACAG No data
Right 1083603377 11:63962321-63962343 CAGCCCTCCTGGCCAGCCCCAGG No data
1083603366_1083603377 29 Left 1083603366 11:63962269-63962291 CCCCAGCTGCCCTCTGAAAGCAC No data
Right 1083603377 11:63962321-63962343 CAGCCCTCCTGGCCAGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083603377 Original CRISPR CAGCCCTCCTGGCCAGCCCC AGG Intergenic
No off target data available for this crispr