ID: 1083606600

View in Genome Browser
Species Human (GRCh38)
Location 11:63982647-63982669
Sequence CTGCCCAGACAGCGGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083606600_1083606606 9 Left 1083606600 11:63982647-63982669 CCCTACTCCCGCTGTCTGGGCAG 0: 1
1: 0
2: 1
3: 5
4: 137
Right 1083606606 11:63982679-63982701 TCCCAAGCCTGCACCGAGAATGG 0: 1
1: 0
2: 0
3: 46
4: 303
1083606600_1083606611 30 Left 1083606600 11:63982647-63982669 CCCTACTCCCGCTGTCTGGGCAG 0: 1
1: 0
2: 1
3: 5
4: 137
Right 1083606611 11:63982700-63982722 GGTCGCCTAATCCCCATGTGTGG 0: 1
1: 0
2: 0
3: 47
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083606600 Original CRISPR CTGCCCAGACAGCGGGAGTA GGG (reversed) Intronic
900140272 1:1136905-1136927 CAGCCCAGCCAGCGGGGGTGTGG - Intergenic
901787530 1:11634556-11634578 CTGCCCTCACAGAGGGAGTATGG - Intergenic
902107838 1:14052616-14052638 CCTCTCAGACAGCTGGAGTAGGG - Intergenic
903908258 1:26702085-26702107 CTGCCCAAACACCAGGAGTCTGG - Intronic
907049234 1:51318443-51318465 CCCCTCAGACAGTGGGAGTATGG + Intronic
911141094 1:94503381-94503403 CCTCCAAGACAGCGGAAGTAGGG - Intronic
915089890 1:153416914-153416936 CTGCCCCCACAGAGGGAGGAGGG + Intronic
916246845 1:162696797-162696819 CTGGGCAGACAGCGGGGGCAGGG - Intronic
917504657 1:175616651-175616673 ACGCCCAGACAGTGGGAGCATGG - Intronic
920301387 1:204991248-204991270 ATGGCCAGACAGAGGGAGAAAGG - Intronic
924235871 1:241999170-241999192 CTGCCCAGGGAGGGGGAGTGGGG - Intergenic
1064114438 10:12566220-12566242 CTTGCTAGACAGCGGGAATAGGG + Intronic
1069993613 10:72329451-72329473 CTGCCCAGAGCCCGGGAGTTGGG - Intergenic
1070404120 10:76079432-76079454 CAGCCCAGCCAGGGGGAGTGGGG + Intronic
1070677374 10:78421229-78421251 CTGCCGAGACAGCCGGGGGAGGG - Intergenic
1072629981 10:97139118-97139140 CGGCCAAGTCAGCGGGAGTGAGG + Intronic
1072728454 10:97829061-97829083 CTGCCCAGACAGAAAGAGCAAGG - Intergenic
1072796697 10:98361520-98361542 CTGCTCAGAGAGCTGGGGTAAGG + Intergenic
1073943119 10:108720128-108720150 CTGCCCTGACAGGGGGTGTTGGG - Intergenic
1075442579 10:122491715-122491737 CTCCCAAGACAGCAGGAGTCAGG - Intronic
1077441871 11:2572604-2572626 CGGCCCAGACAGTGGGCCTAGGG + Intronic
1080781751 11:35435965-35435987 CTGCCCAGGCGGCGGTAGAAGGG + Exonic
1083606600 11:63982647-63982669 CTGCCCAGACAGCGGGAGTAGGG - Intronic
1083844399 11:65322360-65322382 CTGCCCAGTCAGCTGGGGTCTGG + Exonic
1084181396 11:67448355-67448377 CTGCCCAGAAAAAGGGAGAAGGG + Intergenic
1084495430 11:69500637-69500659 CTGGCCAGACAGCAGGTGCAGGG + Intergenic
1084509198 11:69592572-69592594 CTCCCCAGACAGAGGGGCTAAGG + Intergenic
1085294752 11:75425018-75425040 CTGCCTAGACGGTGGGATTATGG + Intronic
1087306879 11:96499431-96499453 CTGCCCAGAAAGGGGAAGGAAGG - Intronic
1089073747 11:115720653-115720675 CTGCCCAGAGATCAGGAGTCAGG - Intergenic
1091346423 11:134857212-134857234 CTGGCCAGAAAGCAGGAGGAGGG + Intergenic
1097680281 12:62642542-62642564 GTGCCCAGACATTGGGAGTGAGG - Intergenic
1098298881 12:69033441-69033463 CTGCCCAGCAAATGGGAGTAGGG - Intergenic
1102131361 12:110531649-110531671 CTGCCAAGACAGCCTGAGTTTGG + Exonic
1103156539 12:118689905-118689927 CTGCCCAGCCATGGGGAGTGTGG + Intergenic
1103401238 12:120644420-120644442 CTGGCCACAAAGAGGGAGTACGG - Intronic
1103418525 12:120761083-120761105 CTGCACAGACCGCAGGAGTAGGG + Intergenic
1103523733 12:121553266-121553288 CTGGCCAGAGAGCGAGAGTGGGG - Intronic
1104427993 12:128693806-128693828 CTGCAAAGACAGAGGGAGAAAGG - Intronic
1110142902 13:72152912-72152934 CTGCCCAGACATCAGCAATAGGG + Intergenic
1110383521 13:74881177-74881199 CTGCCTAGACAGCAGAAGCAGGG - Intergenic
1113579284 13:111417477-111417499 CTGTCCAGACAGCTGGACTCCGG - Intergenic
1119430681 14:74566547-74566569 CTGGCCAGACAGGAGGAGAAAGG - Intronic
1122082376 14:99274570-99274592 CTGCCCCGACGGCGGGAAGAGGG + Intergenic
1126044875 15:44630032-44630054 TTGCCCAGGCTGCTGGAGTACGG - Intronic
1130393752 15:83483193-83483215 CAGCCCAGACAGGGTGAGAAGGG + Intronic
1130660478 15:85827888-85827910 CCACGCAGACAGCTGGAGTAGGG + Intergenic
1130831423 15:87604989-87605011 CTGCCCTGACAGCAGAACTAGGG + Intergenic
1132153766 15:99480781-99480803 CTGCCCAGCAAGCTGGTGTAAGG + Intergenic
1132223811 15:100125422-100125444 CTGCTAAGACGGCGGGAGGACGG - Intronic
1132665918 16:1081270-1081292 CTGGGCAGACGGCGGGAGCACGG - Intergenic
1138210731 16:55161204-55161226 CTTCCCAAAAAGTGGGAGTATGG - Intergenic
1141197410 16:81870577-81870599 TTTCCCAGACAGGGGGATTAGGG + Intronic
1141616668 16:85213800-85213822 CTGCCCAGCCTGTGGGAGTGGGG + Intergenic
1142343256 16:89537755-89537777 CTGCCCAGACACTGGGAGCCTGG - Intronic
1143166006 17:4897614-4897636 CTGCCCAGTCAGCAGCAGTGGGG - Exonic
1144951071 17:18993751-18993773 ATGCCCAGACAGTGGCAGTGTGG + Intronic
1146619605 17:34387230-34387252 ATGCCCAGTCAGTGGGAGCAGGG + Intergenic
1152086781 17:78224775-78224797 CTGCCCAGACAGCCGCAGTGAGG + Exonic
1153008668 18:518471-518493 CTGCCCAGAGATTGGAAGTAGGG - Intergenic
1159925742 18:74267888-74267910 GTGCCCAGAGAGAGGGAGAAAGG + Intronic
1160215663 18:76927467-76927489 CTGCTCAGACAGCGGGCCTATGG - Exonic
1160498360 18:79388263-79388285 CTGCCCTGTCAGCGGGGGCAAGG - Intergenic
1160657812 19:282299-282321 CTGCACATACAGCTGGAGTGGGG + Exonic
1161688599 19:5717529-5717551 CTGCTCAGGCACCGGGAGCAAGG + Intronic
1163725826 19:18922523-18922545 CAGCCCAGACAGCGTGGGGAGGG + Intronic
1163798279 19:19349571-19349593 CTGCCCAGGCTGTGGGAGTCAGG - Intronic
1164527245 19:29021415-29021437 CTCCCCAGACAGAGAGAGGACGG - Intergenic
1164535962 19:29086821-29086843 CTGCCAAGGCAGCAGGGGTATGG - Intergenic
1165097392 19:33417100-33417122 CTGCCCAGACAGCGGTAGAAGGG + Intronic
1165438810 19:35812273-35812295 CTGCCCAGCCAGCAGGTGTCAGG + Intronic
1166142830 19:40814254-40814276 CTCCACTGACAGCGGGAGTGTGG + Intronic
1166184729 19:41132548-41132570 CTCCACTGACAGCGGGAGTGTGG - Intergenic
1166673467 19:44725248-44725270 CTCCCCTGGCACCGGGAGTAGGG + Intergenic
1167045774 19:47048026-47048048 CTGTGCAGAGAGCGGGAGTGTGG - Intronic
925056710 2:862235-862257 CAGCCGAGACAGCGGGTGCACGG + Intergenic
929357019 2:41037852-41037874 CTACCCAGACAGTGGGTGAATGG - Intergenic
932962447 2:76429886-76429908 CTCCTCAGCCAGGGGGAGTAAGG + Intergenic
934527723 2:95062000-95062022 CTGCCCAGACAGTGGGTGCCAGG + Intergenic
935093927 2:99925685-99925707 CTGCCCAGACAGCCTCAGTGAGG - Intronic
938293709 2:130163807-130163829 CTGCCCAGAGAGAGAGAGCAGGG + Intronic
938408782 2:131047068-131047090 CAGCCCAGGCAGCGGGTGTGTGG + Exonic
942361025 2:175171547-175171569 CAGCCCAGAGAGAGGGAGAATGG + Intergenic
946496904 2:220204126-220204148 CTGCCCAGGAAGCTGGAGGAGGG + Intergenic
948308159 2:236965339-236965361 CTGCACAGGCAGTGGGTGTACGG + Intergenic
1171011876 20:21513434-21513456 CTGGCCAGCCAGCGCGTGTACGG + Exonic
1174340778 20:49893620-49893642 CTCCCCAGGCAGGGGGAGTGTGG - Intergenic
1175906572 20:62382809-62382831 CTGTACAGACAGCGGGTGGAGGG + Intergenic
1175950400 20:62580571-62580593 GTGCCCACACAGCGTGAGTGAGG - Intergenic
1176021043 20:62962601-62962623 CTGCAAAGACAGGGGGAGTGTGG - Intronic
1178366856 21:31995572-31995594 CTGCCCAGGCAGAGGGAGATGGG + Intronic
1185039167 22:48495646-48495668 CAGCCCAGACAGAGAGAGGACGG - Intronic
1185181836 22:49368195-49368217 CTTCCCACACACCGGGTGTACGG + Intergenic
950139208 3:10603691-10603713 CTGCCCAGATCACGGGGGTAGGG + Intronic
950358958 3:12437001-12437023 CTCCACACACAGCGGGAGGAAGG - Intergenic
952625191 3:35394438-35394460 CTGCCCACAAAGCAGGAGCAAGG + Intergenic
954389640 3:50261833-50261855 CTGACCAGGCAGCTGGAGTCAGG - Intergenic
954751802 3:52818125-52818147 CTGCCCAGGCAGTGGCAGGATGG + Exonic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
958832787 3:99109961-99109983 CTGCCATGACAGGGGGAGTGAGG - Intergenic
961491209 3:127257863-127257885 CTGCCCTGACAGCTGGAGGCTGG - Intergenic
968485939 4:861787-861809 CTGCCCATACAGAGGAAGTTCGG + Intronic
976454427 4:85229247-85229269 CTGCCCAGACAGAGAGAGACAGG - Intergenic
979723122 4:123926410-123926432 CTGCCCAGTCACTAGGAGTATGG - Intergenic
979913703 4:126404294-126404316 CTGCCAAGCCAGCTGGAGGAGGG - Intergenic
983010310 4:162538156-162538178 CTGCCCAGAAAGGGGAAGGAAGG + Intergenic
984206224 4:176791846-176791868 CTGCCCAGTCAGCGGGGCTCTGG - Intronic
984923082 4:184783015-184783037 CTGCCCCGAGAGCAGGAGAAGGG + Intronic
985778874 5:1859270-1859292 CTGCCCAGTGAGCGGGAGCCTGG + Intergenic
986185605 5:5433619-5433641 CTGCCCAGAAATCTGGATTAGGG + Intronic
991960909 5:72043187-72043209 CTGGCCAGAAAGCTGGAGTCAGG + Intergenic
997282058 5:132655737-132655759 ATGCCCAGTCAGGAGGAGTAAGG - Intergenic
998057580 5:139092062-139092084 CTGACCATCCAACGGGAGTATGG + Intronic
998157527 5:139795376-139795398 CTGAACAGACCGCGGGAGGAGGG + Intergenic
1001128545 5:169043752-169043774 TTGCCCAGACAACTGGAGTGGGG - Intronic
1006047125 6:31307822-31307844 CTGCTCAGACACCTGGAGCATGG - Intronic
1013330414 6:109094909-109094931 CAGCCCAGAGGGCGGGAGCAGGG + Intergenic
1015601643 6:134916362-134916384 CTGTCCAGGCACCGGGAGCAAGG + Intergenic
1018909777 6:168095335-168095357 CCTCCCAGGCAGCGGGAGCATGG + Intergenic
1022557083 7:31308840-31308862 CTGCTCACACAGCGGCAGTCTGG + Intergenic
1022840009 7:34155176-34155198 CTGCCCTGACAGGAGGGGTAGGG + Exonic
1025604469 7:63029390-63029412 CTCCCCAGAGAGCTGGAGTGTGG - Intergenic
1027123288 7:75537582-75537604 CTGCCCAAAGAGGGGGAGAATGG + Exonic
1034270840 7:149802842-149802864 CTGCCCAGGCCGGGGGAGGAGGG + Intergenic
1036695938 8:10975227-10975249 CTGCCCCGGCAGGGGGAGTGTGG + Intronic
1037725866 8:21482306-21482328 CTGCCCAGCCATCAGGAGCAGGG + Intergenic
1038048248 8:23785368-23785390 CTGCCTAAAAAGCAGGAGTATGG - Intergenic
1042791722 8:72615105-72615127 CTGTCCAGAAAGCAGGAGCATGG + Intronic
1042952051 8:74210579-74210601 ATGCCAAGGCAGCGGGAGCAAGG + Intergenic
1045514442 8:102845062-102845084 CTGCCCAGACAGCTGGTCAATGG - Intronic
1047731709 8:127734157-127734179 CTGCCCAGAGAGGGGGCGGAGGG + Intergenic
1048467989 8:134683528-134683550 GTGGCCAGACAGCTGGAGGAAGG + Intronic
1049973790 9:842813-842835 CTGCCCTGAGAGCGGGATCAGGG - Intronic
1050113418 9:2240109-2240131 TTTCCCAGACAGAGGGAATATGG - Intergenic
1058714959 9:107715222-107715244 CTGCCCACACTGCGGCAGTCAGG - Intergenic
1061222843 9:129262276-129262298 CTGCCCAGAGAGCGGGTGGTGGG - Intergenic
1061458086 9:130713311-130713333 CGGCCCAGACAGCGGAAGGCGGG - Intergenic
1061781588 9:132999458-132999480 TGGCCCAGAGAGCGGGAGAAAGG + Intergenic
1062467568 9:136687808-136687830 CTGCCCCGGCAGCGGGGGGAGGG - Intergenic
1188576950 X:31663156-31663178 CTGCCAAGACAGAGAGAGAAGGG - Intronic
1190450823 X:50578882-50578904 CTGCAAAGACATGGGGAGTAAGG + Intergenic
1190990206 X:55540784-55540806 CTGCCCAGAAAGCGGTAGTGGGG + Intergenic
1194391194 X:93319881-93319903 CTGCCCAGAGAGGAGGAGTCTGG - Intergenic
1200221823 X:154394357-154394379 CTGCGCATTTAGCGGGAGTATGG - Intronic