ID: 1083607391

View in Genome Browser
Species Human (GRCh38)
Location 11:63986894-63986916
Sequence CTCACGGCGCGGGCCGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083607391_1083607403 18 Left 1083607391 11:63986894-63986916 CCAGCGGCGGCCCGCGCCGTGAG 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1083607403 11:63986935-63986957 GCTACGGAGCACAAAGGTCCGGG 0: 1
1: 0
2: 0
3: 2
4: 53
1083607391_1083607400 2 Left 1083607391 11:63986894-63986916 CCAGCGGCGGCCCGCGCCGTGAG 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1083607400 11:63986919-63986941 CCTCGAGTTTCGCTGGGCTACGG 0: 1
1: 0
2: 0
3: 4
4: 105
1083607391_1083607406 30 Left 1083607391 11:63986894-63986916 CCAGCGGCGGCCCGCGCCGTGAG 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1083607406 11:63986947-63986969 AAAGGTCCGGGCGGGCCATTCGG 0: 1
1: 0
2: 0
3: 1
4: 20
1083607391_1083607405 22 Left 1083607391 11:63986894-63986916 CCAGCGGCGGCCCGCGCCGTGAG 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1083607405 11:63986939-63986961 CGGAGCACAAAGGTCCGGGCGGG 0: 1
1: 0
2: 0
3: 3
4: 81
1083607391_1083607398 -4 Left 1083607391 11:63986894-63986916 CCAGCGGCGGCCCGCGCCGTGAG 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1083607398 11:63986913-63986935 TGAGGGCCTCGAGTTTCGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 43
1083607391_1083607401 12 Left 1083607391 11:63986894-63986916 CCAGCGGCGGCCCGCGCCGTGAG 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1083607401 11:63986929-63986951 CGCTGGGCTACGGAGCACAAAGG 0: 1
1: 0
2: 0
3: 2
4: 46
1083607391_1083607404 21 Left 1083607391 11:63986894-63986916 CCAGCGGCGGCCCGCGCCGTGAG 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1083607404 11:63986938-63986960 ACGGAGCACAAAGGTCCGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 57
1083607391_1083607402 17 Left 1083607391 11:63986894-63986916 CCAGCGGCGGCCCGCGCCGTGAG 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1083607402 11:63986934-63986956 GGCTACGGAGCACAAAGGTCCGG 0: 1
1: 0
2: 0
3: 2
4: 70
1083607391_1083607397 -5 Left 1083607391 11:63986894-63986916 CCAGCGGCGGCCCGCGCCGTGAG 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1083607397 11:63986912-63986934 GTGAGGGCCTCGAGTTTCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083607391 Original CRISPR CTCACGGCGCGGGCCGCCGC TGG (reversed) Intronic
900523071 1:3115578-3115600 CTTACGGCGGAGGCCGGCGCCGG - Intronic
901489396 1:9588994-9589016 GTCACGGCGTGCGCCGCGGCCGG + Exonic
903232623 1:21931275-21931297 CTCACTTCGCGGGGAGCCGCCGG - Intronic
903603396 1:24557823-24557845 CTCACCGCACGCGCCGCGGCTGG - Intronic
922526698 1:226309400-226309422 CGCACGGCGAGGCCCGGCGCCGG + Exonic
1064645321 10:17454116-17454138 CGCGCGGCGCGGGGCGCGGCCGG + Intronic
1065115219 10:22477438-22477460 CCCAGGGCCTGGGCCGCCGCAGG - Intergenic
1075802187 10:125160473-125160495 CTCGCTCCTCGGGCCGCCGCCGG + Intronic
1077491509 11:2862939-2862961 CCCACCGCCCGGGCCGCCCCGGG - Intergenic
1078659847 11:13277936-13277958 ATCGCGTCGCTGGCCGCCGCCGG - Intronic
1079296761 11:19241419-19241441 CTCACGGCGGGAGCCGGCGGGGG + Exonic
1082026955 11:47579317-47579339 CTCACGGCGCGTGTCGGCCCCGG - Exonic
1083572671 11:63768675-63768697 CGCTCCGCGCGGGCTGCCGCCGG - Exonic
1083607391 11:63986894-63986916 CTCACGGCGCGGGCCGCCGCTGG - Intronic
1083901773 11:65646799-65646821 CCCGGGGCGCGGGTCGCCGCCGG + Exonic
1091764113 12:3107166-3107188 CCCACGGAGGGGGCCGCCGGCGG - Intronic
1092843285 12:12562768-12562790 CTCCGGGCTCGGGCGGCCGCGGG - Intergenic
1097046296 12:56189640-56189662 CTCCAGGCGCGGGCCGACCCTGG + Intergenic
1102197189 12:111034060-111034082 CTCAGGGCCCGGGCGGCCGGCGG + Exonic
1103400689 12:120641045-120641067 CTCGCGGCGCCGGCCGGCACAGG - Exonic
1103433057 12:120904213-120904235 CTCACTGCGCGCGGGGCCGCGGG + Exonic
1105441120 13:20416012-20416034 CACAGGGCCCGGGCCGCGGCTGG + Intronic
1111333557 13:86792362-86792384 CTCACTGCGCGGGCACCGGCCGG - Intergenic
1113541792 13:111115190-111115212 CGCAGGGCGCGGGGCGGCGCGGG + Intronic
1114517011 14:23306877-23306899 CTCACGGGTCAGGCCGCTGCCGG - Exonic
1118621680 14:67619860-67619882 GTCACGGGGCGGGCGGACGCTGG + Exonic
1131515404 15:93073331-93073353 CTCACGGCGAGCGCTGCGGCCGG - Intronic
1132569209 16:636859-636881 CTCCGGGCGTGCGCCGCCGCTGG + Intronic
1133156547 16:3880403-3880425 CTCACGGCGGCGGCGGCGGCGGG - Exonic
1133784377 16:8963433-8963455 CGCCCGCCGCGGGCCGCCCCGGG - Exonic
1136498875 16:30659814-30659836 CTGCCGGCTCGGGCAGCCGCGGG + Exonic
1139511664 16:67431420-67431442 CTCGCCGTGCTGGCCGCCGCCGG + Exonic
1143376989 17:6472741-6472763 CTCACGGCTCGAGCCACTGCTGG - Exonic
1143544705 17:7589230-7589252 CCCCCAGAGCGGGCCGCCGCTGG + Exonic
1143697538 17:8631116-8631138 CGCAGCGCGCCGGCCGCCGCGGG - Intergenic
1145077454 17:19867638-19867660 CTCATGGCCCGGCCTGCCGCCGG + Exonic
1154332453 18:13441018-13441040 CTCACGGCGCGGGTTGCCTCTGG + Intronic
1158453347 18:57586359-57586381 CTCAGGGCTCGGGAGGCCGCGGG - Intronic
1160453323 18:78979715-78979737 CTCCCGGAGCGAGCGGCCGCGGG - Intergenic
1160823088 19:1067328-1067350 CTCCCGGCGCTGGCCGCTTCGGG - Intronic
1166567610 19:43774682-43774704 CTCAGGGCGCAGGCAGGCGCGGG - Intronic
1167797487 19:51719372-51719394 CCCACCGCGCCCGCCGCCGCGGG + Exonic
1168146730 19:54423737-54423759 CTCACTGCCCGGCCCGCCACCGG - Intronic
932779047 2:74548862-74548884 CTCTCTGCCCGGGCCGCCCCGGG - Intronic
943669801 2:190648868-190648890 ATCCCGGCGTGGGCCGCCGCCGG - Intronic
944114351 2:196171328-196171350 CTAACCGCTCCGGCCGCCGCAGG + Exonic
944114378 2:196171391-196171413 CCCACGCCGGGGGCCGCCACAGG + Exonic
944615115 2:201451808-201451830 CTCCCGGCGCGGGGCGCGGGAGG - Exonic
946395523 2:219442093-219442115 CTCCCGGCGCCGCCCGCCCCCGG - Intronic
947418485 2:229921709-229921731 CTCCCGGCGCCGGCGGCGGCGGG - Intronic
1169141295 20:3228707-3228729 CTCGCGGCTCGGGCCACCGCAGG - Exonic
1178487758 21:33029730-33029752 CTCAAGGCGGGGGTGGCCGCTGG - Intergenic
1180110136 21:45643626-45643648 CTAGCGCCGCGCGCCGCCGCCGG - Intergenic
1180156582 21:45981268-45981290 CTCACGGCGAGGTCCTCTGCAGG + Intergenic
1181235795 22:21446983-21447005 CTCCCCGCGGGGGCCACCGCAGG + Exonic
1183586514 22:38755952-38755974 CGCGCAGCGCGGGCCTCCGCCGG - Exonic
952116121 3:30183761-30183783 CTCACGGCGAGGGCAGGGGCAGG - Intergenic
953485119 3:43287054-43287076 CCCAGGGCGCGGGGCCCCGCGGG - Intronic
955182162 3:56682833-56682855 CTCACGCCCAGCGCCGCCGCTGG + Exonic
961446241 3:126983046-126983068 CGCGCGGCGCGGGGCTCCGCGGG + Intergenic
961539690 3:127591075-127591097 CTCCCGGCCTGGGCCGCGGCCGG + Intronic
967851838 3:194088270-194088292 CTCACGCCGCTGGCCTCCCCTGG - Intergenic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
969858559 4:10018856-10018878 CTCGCGGCGCGGGACACCGCGGG - Intronic
971635142 4:29047800-29047822 CCCACGGCGGGGGCGGCGGCTGG - Intergenic
979530539 4:121765137-121765159 CGCTCGGCGCGGGCTGCAGCTGG + Exonic
982745746 4:159103200-159103222 CTCCCGGCGCGGGCGTCCGAGGG - Intergenic
984888646 4:184473248-184473270 CCCGGGGCGCGGGCCGCGGCGGG - Intronic
985578572 5:684987-685009 CACACGGCCGGGGCCGCCCCAGG + Intronic
985896193 5:2751232-2751254 TTCACGGCGCAGGCGGCCACCGG - Exonic
990545349 5:56816036-56816058 CACCCGGCGGGGGCCGCTGCAGG - Exonic
998328539 5:141303807-141303829 CTCACAGCGGGGGCCGCAGGGGG - Exonic
1002636164 5:180609847-180609869 CTCAGGGCTGGGGCCGCCTCAGG - Intronic
1002638389 5:180619197-180619219 CCCCGGGCGCGGGGCGCCGCGGG - Intronic
1006317499 6:33299017-33299039 CTCTCGGAGCGGGCGGACGCGGG - Exonic
1008760422 6:54846774-54846796 CGCACAGCGCCGGCCGCCGAAGG - Exonic
1013836645 6:114342573-114342595 GGCACGGCACGGGCGGCCGCAGG + Exonic
1018757545 6:166862943-166862965 CTCGGGGCGGGGGCAGCCGCGGG - Intronic
1019172656 6:170142730-170142752 CCCACGGCACGTGCCGCCACCGG - Intergenic
1019737594 7:2658413-2658435 CTGACGGTGTGGGCCGCGGCCGG - Exonic
1020275614 7:6622847-6622869 TGCACGGCGCGGGCCGCTCCAGG + Exonic
1021971390 7:25968770-25968792 CACACGGGTCTGGCCGCCGCTGG - Intergenic
1022106384 7:27200298-27200320 GGGACGGCGCGGGCCGCGGCGGG - Intergenic
1025739089 7:64182167-64182189 CCAGCGGCGCGGGCCGCAGCCGG + Intronic
1028796341 7:94907911-94907933 CTCCCGGGGCCGCCCGCCGCGGG + Intronic
1031887076 7:127253748-127253770 CACACAGCGCGGTCCGCTGCGGG + Intergenic
1032086852 7:128888921-128888943 CTCACAGGGCCGGCGGCCGCAGG + Exonic
1034451198 7:151138203-151138225 CTCAGGGCGCGGGCCAGCCCAGG - Exonic
1041233212 8:55773472-55773494 TTCCCGGCGCGAGCGGCCGCGGG + Exonic
1042246431 8:66712875-66712897 CTCCCGCCCCGGGCCGCCGTCGG - Intronic
1060106496 9:120876474-120876496 CTCCCGGAGCGGGCCCCCGCGGG + Intronic
1060305350 9:122406286-122406308 CCCACGGCGCGGGGCGGCTCAGG + Intergenic
1061089738 9:128420241-128420263 CTTAAGGAGCGGACCGCCGCGGG + Intronic
1061208486 9:129177537-129177559 CGCACGGCGCGCCCCACCGCGGG - Exonic
1061725541 9:132580343-132580365 CTGCCGGCCCGGACCGCCGCGGG + Intergenic
1062420970 9:136482715-136482737 GACGCGGCGCGGGCCGCCGTGGG - Intronic
1062452609 9:136621872-136621894 TTCCCAGCGCCGGCCGCCGCAGG + Intergenic