ID: 1083607704

View in Genome Browser
Species Human (GRCh38)
Location 11:63988640-63988662
Sequence CACAGCAATCTGGAGGAGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 5, 3: 56, 4: 476}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083607704_1083607711 5 Left 1083607704 11:63988640-63988662 CCTGCCTCCTCCAGATTGCTGTG 0: 1
1: 0
2: 5
3: 56
4: 476
Right 1083607711 11:63988668-63988690 CCCTCTGGTGTCAGAGCGGCTGG 0: 1
1: 0
2: 0
3: 13
4: 133
1083607704_1083607713 14 Left 1083607704 11:63988640-63988662 CCTGCCTCCTCCAGATTGCTGTG 0: 1
1: 0
2: 5
3: 56
4: 476
Right 1083607713 11:63988677-63988699 GTCAGAGCGGCTGGAGCTCTCGG 0: 1
1: 0
2: 1
3: 24
4: 201
1083607704_1083607709 1 Left 1083607704 11:63988640-63988662 CCTGCCTCCTCCAGATTGCTGTG 0: 1
1: 0
2: 5
3: 56
4: 476
Right 1083607709 11:63988664-63988686 AGAACCCTCTGGTGTCAGAGCGG 0: 1
1: 0
2: 2
3: 14
4: 157
1083607704_1083607708 -10 Left 1083607704 11:63988640-63988662 CCTGCCTCCTCCAGATTGCTGTG 0: 1
1: 0
2: 5
3: 56
4: 476
Right 1083607708 11:63988653-63988675 GATTGCTGTGCAGAACCCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 132
1083607704_1083607714 26 Left 1083607704 11:63988640-63988662 CCTGCCTCCTCCAGATTGCTGTG 0: 1
1: 0
2: 5
3: 56
4: 476
Right 1083607714 11:63988689-63988711 GGAGCTCTCGGTCCTATACAAGG 0: 1
1: 0
2: 0
3: 3
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083607704 Original CRISPR CACAGCAATCTGGAGGAGGC AGG (reversed) Exonic
900768139 1:4519262-4519284 CACCGGAAGCTGGAAGAGGCCGG + Intergenic
900825139 1:4920338-4920360 CACTGCAATCTGGAAAAGGCAGG + Intergenic
901090030 1:6634890-6634912 CACTGCACTCTGGAGGTGGGTGG + Exonic
901312716 1:8282000-8282022 CAGAGCCACGTGGAGGAGGCGGG - Intergenic
901470365 1:9451835-9451857 CACAGCATTCTGGAGCAGTGTGG + Intergenic
902819843 1:18937154-18937176 CAGAGCAATCTCCAGGAGGGAGG + Intronic
902918853 1:19654960-19654982 CACAGCAAGGTGCAGGGGGCCGG - Intronic
902968106 1:20025938-20025960 CACAGCAACCTGGATGAGATTGG - Intergenic
903334419 1:22615433-22615455 CAAAGAAATATGGAGGCGGCTGG - Intergenic
904030944 1:27533109-27533131 CACACCTGTCTGGAAGAGGCAGG - Intergenic
904225249 1:29012003-29012025 CAAAGCAATCTGCAGTAGTCAGG - Intronic
905017117 1:34785486-34785508 CACCACAAGCTGGTGGAGGCTGG + Exonic
905227075 1:36486011-36486033 CACAGTATAATGGAGGAGGCAGG - Intergenic
905564041 1:38949154-38949176 CACAGCGACCTGGAGGAGACTGG + Intergenic
907558274 1:55364476-55364498 AACAGCACTCTAGAGCAGGCGGG + Intergenic
907942827 1:59105763-59105785 CTCAGAAATCTGAAGGTGGCTGG - Intergenic
908571806 1:65419330-65419352 CACAGCTCTTTGGAGGAGGTTGG - Intergenic
908644295 1:66260587-66260609 CACAGCACTAGGGAGAAGGCGGG + Intronic
908982261 1:69973130-69973152 CACAGCAACCTGGATGAGACTGG + Intronic
909212535 1:72842848-72842870 CACAGCAATCTGGATGGAGTTGG + Intergenic
910310969 1:85824245-85824267 CACTAGAAACTGGAGGAGGCAGG + Intronic
911707543 1:101031089-101031111 CACAGCTATCTGTAGGGGCCAGG - Intergenic
911850549 1:102813747-102813769 CACAGCAATCTGGATAGGGTTGG - Intergenic
911898125 1:103466068-103466090 CACAGCAACCTGGATGAGATTGG + Intergenic
912937539 1:114016747-114016769 CTCAGCACTTTGGGGGAGGCAGG + Intergenic
913464190 1:119122733-119122755 CACAGCAACCTGGATGAAGTTGG + Intronic
914378109 1:147091350-147091372 CACAGCAACCTGGAGGGGATTGG + Intergenic
914978566 1:152390854-152390876 CACAGCAATCTGGATGATATTGG - Intergenic
914979110 1:152397257-152397279 CACAGCAACATGGATGAGCCTGG + Intergenic
915225063 1:154405778-154405800 CACCGCAGTCTGTGGGAGGCTGG + Intronic
915829215 1:159110252-159110274 CACAGCAACCTGGACGAGATTGG + Intronic
915935441 1:160087818-160087840 CACAGGGGTCTGGAGGAAGCTGG - Exonic
916228580 1:162516100-162516122 CACAGCAAGATAGAGGAGGAGGG - Intronic
918276120 1:182955218-182955240 CAAAGCATCCTGGAGGAGACAGG - Intergenic
920739832 1:208570015-208570037 CACAGCAACCTGGATGTGACTGG - Intergenic
921001195 1:211045112-211045134 CACAGCAACCTGGATGAGATCGG + Intronic
923422893 1:233836858-233836880 CACAGCAACCTGGATGAGATTGG + Intergenic
923569293 1:235099841-235099863 GGCAGCAACCTGGGGGAGGCTGG - Intergenic
923989767 1:239423445-239423467 CACAGCACTATGGAGGAGGATGG + Intronic
924257253 1:242194723-242194745 CACAGCAAACTGGATGGGACTGG + Intronic
924896427 1:248341511-248341533 CACAGCAACATGGATGAGCCTGG - Intergenic
1063470543 10:6281099-6281121 CACGGCAACCTGGATGAGACTGG - Intergenic
1065259392 10:23909048-23909070 CACAGCAACCTGGCTGAGACTGG + Intronic
1066369626 10:34809490-34809512 GACAGCCATCTCCAGGAGGCTGG - Intronic
1066558910 10:36646994-36647016 CACAGCATTCTGGCAGAGGTGGG - Intergenic
1067347126 10:45444736-45444758 CCCAGCAGTCTGGAGCAGGTTGG - Intronic
1067348887 10:45457869-45457891 CACTGCAAGCTGGAGGCGGCTGG + Exonic
1067519686 10:46988657-46988679 CACAGCAATATGGACAAGTCTGG - Intronic
1067642562 10:48063182-48063204 CACAGCAATATGGACAAGTCTGG + Intergenic
1067759877 10:49036821-49036843 AACAGCGCTATGGAGGAGGCAGG + Intronic
1068180647 10:53513782-53513804 CACAGCAATCTGTTGGAATCAGG + Intergenic
1068347876 10:55807522-55807544 CACAGCAACCTGGATGAGATTGG - Intergenic
1070942199 10:80357378-80357400 CACAGAAACCTGGAGGAGTAGGG + Intronic
1071696906 10:87886108-87886130 CAAAGCAACATGGAGAAGGCAGG - Intronic
1071717965 10:88115891-88115913 ACCAGCAATTTGGATGAGGCTGG - Intergenic
1071849939 10:89558467-89558489 CGCAGCAACCTGAAGGAGGCAGG + Intergenic
1072487305 10:95868106-95868128 CACAACAATCTGAAGAAGGTAGG + Exonic
1072537831 10:96376811-96376833 CACAGCCAGCTGGGGGTGGCAGG + Exonic
1072785730 10:98279795-98279817 CACAGCAACCTGGATGAGACTGG + Intergenic
1073888953 10:108074956-108074978 CACAGGAAGCTGGAAGAGACAGG - Intergenic
1074079806 10:110158452-110158474 CCCAGGATTCTGGAGGAGTCAGG - Intergenic
1074188367 10:111115698-111115720 CACAGCAATGAGGAGGTGCCGGG + Intergenic
1075267746 10:121019037-121019059 CACAGCATTCTGGAGTCTGCTGG - Intergenic
1075953837 10:126505446-126505468 GACAGAATTCTGGAGGTGGCTGG + Intronic
1076173612 10:128345507-128345529 CCCAGCAATGTGGATGAGCCTGG + Intergenic
1076504509 10:130963004-130963026 CACAGCAATGTGGATGATCCAGG - Intergenic
1077304464 11:1862906-1862928 CACAGGATTCTGGAGTAAGCAGG - Intronic
1077651599 11:3978123-3978145 CACAGGCATATGTAGGAGGCTGG - Intronic
1077700253 11:4434790-4434812 GAGAGCTATCTGGAGGAGGCTGG - Intergenic
1078245704 11:9572373-9572395 AACAGAAAACTGGAAGAGGCCGG + Intergenic
1078334958 11:10455950-10455972 CTCAGCTTTCAGGAGGAGGCTGG + Intronic
1078528574 11:12119184-12119206 CACAGCACTCTCCAGGCGGCAGG - Intronic
1078845195 11:15114104-15114126 CATAGCAAGATGGCGGAGGCGGG + Intronic
1079096978 11:17517329-17517351 CACTGCGGTCAGGAGGAGGCGGG + Intronic
1079179955 11:18183214-18183236 CACAGCAATCTGGATGGAGTTGG + Intronic
1079557036 11:21772108-21772130 CACAGCAACATGGATGAGCCTGG - Intergenic
1081984111 11:47289218-47289240 CATGGCAATGTGGAGGAGGTGGG - Intronic
1082005700 11:47417962-47417984 CACAGCCCACTGGAAGAGGCCGG + Intergenic
1082095685 11:48127379-48127401 CACAGAAGTCAGGACGAGGCAGG - Intronic
1082210262 11:49492067-49492089 TGCAGCAATCTGGATGAGACTGG - Intergenic
1082680238 11:56158959-56158981 CACAGCAACCTGGATGGAGCTGG + Intergenic
1083253045 11:61480943-61480965 CCCAGCCCTGTGGAGGAGGCCGG + Intronic
1083478517 11:62928867-62928889 ATTACCAATCTGGAGGAGGCAGG - Intergenic
1083607704 11:63988640-63988662 CACAGCAATCTGGAGGAGGCAGG - Exonic
1084374866 11:68769617-68769639 AAAAGCAATCAGGCGGAGGCAGG - Intronic
1084473043 11:69374387-69374409 CACCTCCATCTGGGGGAGGCGGG + Intergenic
1085062898 11:73464312-73464334 AACAGCAATCTGGGGGTGGGGGG + Intronic
1085493602 11:76946378-76946400 CACAGCAGTCTGTAGCAGGGTGG + Intronic
1086756083 11:90563948-90563970 CACAGCAACCTGGATATGGCTGG + Intergenic
1086926011 11:92641494-92641516 CACTGGAAGCTGGAGGAAGCAGG - Intronic
1087224193 11:95579585-95579607 CACAGCAACCTGGAAGAAACTGG - Intergenic
1087735628 11:101829603-101829625 CACAGAAATCTGGATGAAACTGG + Intronic
1088705824 11:112463871-112463893 CACAGCAATATGGACGAGACTGG - Intergenic
1088733885 11:112709174-112709196 CCCAGCACTCTGAAGGAGGATGG + Intergenic
1088994459 11:114984640-114984662 CACAGGAAGATGGAGGAGGAGGG - Intergenic
1089444973 11:118544720-118544742 GACAGCAATCTGAGGCAGGCAGG + Exonic
1090260975 11:125319884-125319906 AACAGCAAGCTAGATGAGGCTGG + Intronic
1090421027 11:126575041-126575063 TATGGCAATGTGGAGGAGGCCGG + Intronic
1090753193 11:129765282-129765304 CACAGCAACCTGGATGAGATTGG + Intergenic
1091323444 11:134667431-134667453 CACAGCAGCCTGGCGCAGGCTGG + Intergenic
1091390794 12:125047-125069 CAAATGAGTCTGGAGGAGGCAGG - Intronic
1091767751 12:3132945-3132967 CGAGACAATCTGGAGGAGGCAGG - Intronic
1092097751 12:5857868-5857890 CACAGCAATATGGATGAGCCTGG + Intronic
1092197688 12:6559648-6559670 CTCAGCCATCTTGAGGAGTCTGG - Intronic
1092387663 12:8048306-8048328 CACAGTGATCTAGAGGAGGGTGG + Intronic
1092516309 12:9217976-9217998 CACAGCAACCTGGATGGGACTGG + Intergenic
1092763777 12:11834054-11834076 CATAGATCTCTGGAGGAGGCAGG + Intronic
1093337263 12:17921209-17921231 CACAGCAACCTGGAGCGGGATGG - Intergenic
1094669131 12:32551979-32552001 CATAGCAATATGGAAGAGACTGG - Intronic
1095252759 12:39998226-39998248 CACAGCAACCTGCAGGAGACTGG + Intronic
1095601754 12:44021408-44021430 CACAGGAACATGGATGAGGCTGG - Intronic
1096032347 12:48430993-48431015 CACAGCAACCTGGGTGAGACTGG + Intergenic
1097493341 12:60297186-60297208 GAGGGCAACCTGGAGGAGGCTGG - Intergenic
1098101460 12:67021949-67021971 CACAGCAACATGGATGAGTCTGG - Intergenic
1099527115 12:83729369-83729391 CACAGCAACCTGGATGGGACTGG - Intergenic
1099687151 12:85904948-85904970 CACAGCCACCTGGATGAGACTGG - Intergenic
1100606122 12:96153390-96153412 CACAGAAATCTGTAAGAGGGAGG - Intergenic
1100706763 12:97209251-97209273 CACAGCAACCTGGATGAGATTGG + Intergenic
1100945889 12:99783574-99783596 CACAGCAACATGGATGAGCCTGG + Intronic
1100959949 12:99951543-99951565 CACAGGTATCTGGGGTAGGCTGG + Intronic
1102123340 12:110460583-110460605 CCCAGCACTTTGGATGAGGCAGG + Intronic
1102194290 12:111013467-111013489 CACAGGAATCTGGAAGAGCCAGG + Intergenic
1102436582 12:112929020-112929042 TACAGAAATCTAGATGAGGCAGG - Intronic
1102748014 12:115267228-115267250 AGCAGCAACCTGGAGGAGGTGGG + Intergenic
1102767994 12:115450200-115450222 GACAGCAGGCTGGAGGAGGGAGG - Intergenic
1102879328 12:116472231-116472253 CAGAGCAAGCTGGAAGGGGCTGG - Intergenic
1103015002 12:117487459-117487481 GACAGCAACCTGGGGGATGCAGG - Intronic
1103954566 12:124568916-124568938 CCCAGCATCCTGGCGGAGGCGGG - Intergenic
1104115564 12:125746162-125746184 CACTGCACTGTGGAGGAGGTGGG + Intergenic
1104326028 12:127799572-127799594 CACAGGGAGCTGGAGGAGACGGG + Intergenic
1104674039 12:130700621-130700643 CACTGGAAACTGGAAGAGGCAGG + Intronic
1105014354 12:132777123-132777145 CACAGCACACTGGAGGAGCGTGG - Intronic
1106086011 13:26542098-26542120 CTCAGCAATCTGCAGGTGCCTGG - Intergenic
1106465422 13:30009805-30009827 CATGGCCATCTGGAGGAAGCGGG + Intergenic
1107376192 13:39807282-39807304 CACAGCAACCTGGATGGGACTGG + Intergenic
1107412292 13:40169020-40169042 CACAGCAGTGTGGAGGAGGGTGG + Intergenic
1108613234 13:52104848-52104870 TTGAGCAATTTGGAGGAGGCAGG + Intronic
1108751821 13:53455557-53455579 CACACCATTCTGGAGGAGTAGGG + Intergenic
1109167401 13:59053129-59053151 AACAGAAGTCTGGATGAGGCCGG + Intergenic
1109567576 13:64137653-64137675 CACAGCAATCTGGATGGGACTGG + Intergenic
1110512501 13:76367591-76367613 CAAAGCAATCTTGAGGAAGAAGG + Intergenic
1110602218 13:77388034-77388056 GAAAGCAATCTGGGGGAAGCAGG + Intergenic
1110809568 13:79796713-79796735 CACAGTATTCTGAAGGAAGCAGG - Intergenic
1111098581 13:83547921-83547943 CACAGCAATCTGGATGAGATTGG - Intergenic
1111893152 13:94108234-94108256 CACAGCAACCTGGATGAGATTGG + Intronic
1113088966 13:106597398-106597420 CACTGGAAGCTGGAAGAGGCAGG + Intergenic
1113208145 13:107941582-107941604 CACAGCAATCTGGGTGTGGGAGG + Intergenic
1113600116 13:111562631-111562653 CACCAGAATCTGGAAGAGGCAGG + Intergenic
1113844955 13:113381878-113381900 CACAGCAACCTGGATGAGATTGG - Intergenic
1114108566 14:19451662-19451684 CACAGCAACCTGGATGAGATCGG + Intergenic
1114263963 14:21060312-21060334 CAGGGCAATGTGGAGGGGGCTGG - Intronic
1114396588 14:22368695-22368717 CACAGCAACCTGGATGAAGCTGG + Intergenic
1115299816 14:31871674-31871696 CACAGCAACCTGGATGAGATTGG + Intergenic
1115564468 14:34613171-34613193 CACTGAAAGCTGGAGGAGGCAGG + Intronic
1117061951 14:51972492-51972514 CACAGCACACTGAAGGAGACAGG - Intronic
1118775003 14:68968304-68968326 CACAGCAACTTGTAGGTGGCAGG - Intronic
1119582215 14:75795720-75795742 CGCAGCAACCTGGAGGGAGCTGG - Intronic
1120143592 14:80955521-80955543 CTCACCACTGTGGAGGAGGCTGG - Exonic
1120887632 14:89464141-89464163 CTGAGAAATCTGGAGGAGACTGG - Intronic
1121393932 14:93601397-93601419 CACAGCAATCTGGATGGAGTTGG - Intronic
1121544652 14:94754569-94754591 CACAGGTACCTGGAAGAGGCAGG - Intergenic
1122432919 14:101667331-101667353 CACCGGAAGCTGGAAGAGGCAGG - Intergenic
1122611190 14:102984611-102984633 CAGAGCAAGCGGGAGGAGCCTGG + Intronic
1122651814 14:103230570-103230592 CACAGCCATCAGGAAGGGGCAGG + Intergenic
1123103729 14:105825606-105825628 CACAGCGACCTGGATGAGGCTGG - Intergenic
1124347939 15:28934815-28934837 CACAGCAAGGTGTAGGTGGCAGG - Intronic
1124477401 15:30046609-30046631 CACAGCAACATGGATGAGCCTGG + Intergenic
1124887606 15:33701631-33701653 CAGAGCAACCTGGAGGGGGAGGG + Intronic
1124937479 15:34186555-34186577 CCCACCAATTTGGAAGAGGCAGG - Intronic
1125425893 15:39549145-39549167 CACTGCATCCTGGAGGATGCGGG - Intergenic
1125482463 15:40090031-40090053 CACAGCACCCTGGAGGAGAAGGG - Exonic
1126374650 15:47984865-47984887 CACAGCAATCTGGATGGAACTGG - Intergenic
1127342467 15:58062293-58062315 CACAACGATCTGGGGGAGGGAGG + Intronic
1127738665 15:61874024-61874046 CACAGCAACTTGGATGAGCCTGG + Intronic
1128705908 15:69837442-69837464 CACAGCTACCTGGAGGACACAGG - Intergenic
1129288648 15:74546197-74546219 CAAAGCAATCAGTGGGAGGCGGG - Intronic
1129334798 15:74845429-74845451 GACAGCAAATGGGAGGAGGCAGG - Intronic
1129688185 15:77698122-77698144 TACAGCAATATAGAGGAGGGCGG + Intronic
1130780032 15:87026832-87026854 CGCAGCAACCTGGAGGAGACTGG + Intronic
1130801900 15:87273268-87273290 CACTACAAGCTGGAAGAGGCAGG + Intergenic
1133062953 16:3187159-3187181 CACAGAAAAGTGAAGGAGGCTGG - Intergenic
1133532839 16:6671759-6671781 CACAGCAACCTGGATGGGACTGG - Intronic
1133853202 16:9525306-9525328 CACAGCAACCTGAGGGAGGAAGG - Intergenic
1134288893 16:12887384-12887406 CACAGCAATCTGGATGGAACTGG - Intergenic
1134908410 16:18002075-18002097 CACAGCAACCTGGATGGGACTGG + Intergenic
1136102139 16:28004088-28004110 CACAGCAGGGTGGAGGGGGCAGG + Intronic
1136685013 16:31988886-31988908 CACTTCACTCTGGAGGAGCCAGG + Intergenic
1136785625 16:32932421-32932443 CACTTCACTCTGGAGGAGCCAGG + Intergenic
1136884144 16:33921383-33921405 CACTTCACTCTGGAGGAGCCAGG - Intergenic
1137061292 16:35793553-35793575 CACAGCTATCTGGGAAAGGCAGG + Intergenic
1137874740 16:51985294-51985316 CTCAGCAATATGGATGAGGCTGG + Intergenic
1137973413 16:53008694-53008716 CACAGCAACCTGGATGAGATTGG + Intergenic
1138331674 16:56220440-56220462 CACAGCATTCTGGAGAAGTTTGG + Intronic
1138372159 16:56535805-56535827 CACAGTAATCTGGATGAGACTGG - Intergenic
1138971754 16:62152738-62152760 CAAAGCAATCTGGAGAATGAAGG - Intergenic
1139321367 16:66117156-66117178 CCCAGCAATAAGGAGGAGGTAGG + Intergenic
1139725464 16:68894036-68894058 CAGTCCAATGTGGAGGAGGCTGG + Intronic
1140845392 16:78882356-78882378 CACAGCAATCTGACAGAGCCAGG + Intronic
1140948947 16:79797523-79797545 CACCAGAAGCTGGAGGAGGCCGG + Intergenic
1141129127 16:81423044-81423066 CACAGCAACCTGGATGAGACTGG + Intergenic
1141886351 16:86895043-86895065 CACTGGAAGCTGGAAGAGGCAGG + Intergenic
1141981332 16:87552121-87552143 CACAGGAGAGTGGAGGAGGCAGG + Intergenic
1143096643 17:4481800-4481822 CTCAGGAATCTGCAGGACGCAGG - Intronic
1143266839 17:5644335-5644357 GACAGCAATGTGTAGGAGTCGGG + Intergenic
1144768029 17:17743542-17743564 TACACCAGTCTGAAGGAGGCTGG - Intronic
1145207090 17:20990338-20990360 CACCAGAAGCTGGAGGAGGCAGG - Intergenic
1146006371 17:29163149-29163171 CCCAGGAGTCTGGAGGAGGCGGG + Intronic
1148546382 17:48522319-48522341 CAGAGCCAACAGGAGGAGGCTGG + Intergenic
1149267661 17:54945064-54945086 CATTGGAATCTGGAAGAGGCAGG - Intronic
1149469114 17:56901747-56901769 CACAGTAATCTGGAGCTGGAGGG + Intronic
1150368630 17:64615201-64615223 AACTCCAATCTGGAGGAGGAAGG - Intronic
1150875648 17:68967319-68967341 CACAGCAACCTGGATGGGACTGG - Intergenic
1151704514 17:75759579-75759601 GGCAGGACTCTGGAGGAGGCAGG + Intronic
1152154952 17:78626909-78626931 CACCGGAAGCTGGAAGAGGCAGG + Intergenic
1153085242 18:1278567-1278589 CAAAGCCATCTGGAGGAGCATGG - Intergenic
1153643084 18:7172358-7172380 CACAGCAACAAGGAGAAGGCCGG - Intergenic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1154355373 18:13620290-13620312 TGCAGGAATCTGGGGGAGGCAGG - Intronic
1154468285 18:14670956-14670978 CACAGGAATATGGAGGAAGTAGG - Intergenic
1155012321 18:21792180-21792202 CACAGCAAGGTGGAGGAGGAAGG - Intronic
1156928814 18:42616393-42616415 CACAGCAATGTGGAGAAGGAAGG + Intergenic
1157219489 18:45816961-45816983 CACAGCAACCTGGATGAGACTGG + Intergenic
1157508023 18:48245169-48245191 CACAGCAACCTGGATGGAGCTGG + Intronic
1157622836 18:49026112-49026134 GACAGCTTCCTGGAGGAGGCGGG + Intergenic
1158830307 18:61270190-61270212 TGCAGCAATCTGGATGAGACTGG + Intergenic
1159075841 18:63680991-63681013 CACAGCAACATGGATGAGCCTGG + Intronic
1159815194 18:73065240-73065262 TGCAGCAATGTGGAGGAGGTGGG + Intergenic
1160150066 18:76391885-76391907 CAGAGCCAGCAGGAGGAGGCCGG + Intronic
1160409457 18:78665752-78665774 AACATCATACTGGAGGAGGCAGG - Intergenic
1160950763 19:1666112-1666134 CACAGCAAACTGGAGAGGGGCGG + Intergenic
1162497410 19:11030979-11031001 CAAGACAATGTGGAGGAGGCTGG - Intronic
1163146945 19:15386529-15386551 CACACTAAGCTGGGGGAGGCAGG - Intronic
1163688256 19:18724592-18724614 CACTGAAAGCTGGAAGAGGCAGG - Intronic
1163711256 19:18848457-18848479 CACAGCAACCTGGAGGGGAAGGG - Intronic
1164906616 19:31973465-31973487 CAGAGCCATCTGGAGGATGCTGG + Intergenic
1164983378 19:32630623-32630645 CACAGCACGCTGGGGGAGGTGGG + Intronic
1165935011 19:39383833-39383855 GTCAGCGGTCTGGAGGAGGCAGG - Exonic
1166540982 19:43605730-43605752 CACTTCAGGCTGGAGGAGGCAGG - Intronic
1166678973 19:44756228-44756250 CACAGCAATATGGAGAGGCCTGG - Exonic
925217410 2:2109328-2109350 CACAGGAATCTGGAGGGGGCTGG - Intronic
925288690 2:2732015-2732037 CACAGCAATGTGAAGGTGACCGG + Intergenic
925288704 2:2732131-2732153 CACAGCAATGTGAAGGTGACCGG + Intergenic
925822909 2:7818071-7818093 CACAGCAACCTGGATGAGATTGG + Intergenic
925916947 2:8613799-8613821 CACAGCCAAGTGGTGGAGGCAGG - Intergenic
926396517 2:12448121-12448143 CACGGCAACCTGGATGAGACTGG + Intergenic
927641388 2:24847848-24847870 CTGAGGAGTCTGGAGGAGGCAGG + Intronic
929725683 2:44424615-44424637 CACAGCAACCTGGATGAGATTGG + Intronic
932465806 2:71923387-71923409 CACAGCAAGTTGGAGGAGCTTGG - Intergenic
933216733 2:79638651-79638673 CACAGGAAACTGCATGAGGCAGG + Intronic
933564228 2:83930355-83930377 CACAGCAACCTGGATGGAGCTGG - Intergenic
934904581 2:98187494-98187516 GAGACCATTCTGGAGGAGGCAGG - Intronic
935111533 2:100098902-100098924 CTCATCAGCCTGGAGGAGGCAGG - Intronic
935175099 2:100642443-100642465 CACAGCCCTCTGGGGGAGGCAGG - Intergenic
935230411 2:101090959-101090981 CACAGTACCCTGGAGCAGGCAGG - Intronic
935414854 2:102804451-102804473 CACAGCAACCTGGATGAGGTTGG - Intronic
935609925 2:105011700-105011722 CACAGCAACCTGGATGAGATTGG - Intergenic
936123435 2:109766262-109766284 CTCATCAGCCTGGAGGAGGCAGG + Intergenic
936221250 2:110605202-110605224 CTCATCAGCCTGGAGGAGGCAGG - Intergenic
936517240 2:113189204-113189226 CACAGCAACCTGGATGAGATTGG - Intronic
936710080 2:115121692-115121714 TACAGCAACCTGGAGGGGGCTGG + Intronic
937497187 2:122433029-122433051 GGCAGCAATCTGGGGGAAGCAGG + Intergenic
938093537 2:128447942-128447964 CACAGCATTATGGTGGGGGCAGG + Intergenic
938093577 2:128448054-128448076 CACAGCATTATGGTGGGGGCAGG + Intergenic
938093604 2:128448128-128448150 CACAGCATTATGGTGGGGGCAGG + Intergenic
940966896 2:159848250-159848272 CACAGCAACCTGGATGAGATTGG + Intronic
941631139 2:167885420-167885442 CACAGCAACCTGGATGAGATTGG - Intergenic
941884486 2:170514169-170514191 CTCAGATATCTGGAGAAGGCAGG - Intronic
944465376 2:199995057-199995079 CACACCCAACTGGAAGAGGCTGG - Intronic
944551830 2:200851191-200851213 CACAGCAACCTGGATGGAGCTGG - Intergenic
944587468 2:201185344-201185366 CAAAGCAATCTGGGGGAGGCAGG - Intronic
944682090 2:202086282-202086304 CACAGCATCTTGGAAGAGGCTGG + Intronic
944856746 2:203775490-203775512 CAGAGCAAGCTGGAGGATGGGGG - Intergenic
945337579 2:208610988-208611010 CACAGCAACCTGGATGAAGCTGG - Intronic
945828678 2:214756674-214756696 CACAGCAACCTGGATGGGACTGG + Intronic
946715575 2:222552007-222552029 CACAGCAACCTGGATGAGATTGG - Intronic
947090396 2:226503862-226503884 CACAGCAATTTGGTTGAGCCTGG + Intergenic
947377606 2:229512412-229512434 CACAGCAACCTGGATGGGACAGG + Intronic
947569826 2:231224334-231224356 CCCAGCTATCTGGGGGAGACAGG + Intronic
948055547 2:235007283-235007305 CACTGCAACCTGGAGGAAGCAGG - Intronic
948237189 2:236400087-236400109 TACAGCAACGTGGAGGAGGGAGG - Intronic
948336202 2:237209217-237209239 CAGAACACTCTGGAGGAGGCAGG - Intergenic
948531616 2:238611574-238611596 CACAGCAACCTGGATGAGATTGG + Intergenic
948549956 2:238764709-238764731 CACAGCAATCCCGAGAAGTCAGG - Intergenic
948855981 2:240730853-240730875 CCCAGCCAACTGGAGGAGGCTGG + Intronic
1168906624 20:1409125-1409147 CAGAGCAATATCAAGGAGGCAGG - Intergenic
1169190432 20:3655563-3655585 CACTGGAAGCTGGAGGAGGTAGG - Intergenic
1169665848 20:8034582-8034604 CAAAGCAATATGGATAAGGCTGG + Intergenic
1169855482 20:10097440-10097462 CACAGCAACCTGGATGAAGTTGG - Intergenic
1170046505 20:12091054-12091076 CACAGCAGCTTGGAGGAGACAGG - Intergenic
1170125610 20:12960168-12960190 CACAGCAAACTGGATGAGATTGG + Intergenic
1170126841 20:12972912-12972934 CACAGCAACCTGGATGAAACTGG - Intergenic
1171192826 20:23171487-23171509 CACAGCCACCTGGATGAGACTGG - Intergenic
1171457095 20:25278286-25278308 CAGAGCAAGCTGGAGGGTGCAGG - Intronic
1172127033 20:32630593-32630615 CACAGCACGGAGGAGGAGGCAGG + Intergenic
1172705629 20:36880344-36880366 CCCAGCACTTTGGGGGAGGCTGG - Intronic
1172823901 20:37763598-37763620 CAAACCAAGCTTGAGGAGGCAGG - Intronic
1173834029 20:46113454-46113476 TACAGCAATCTTGGGGAGGAAGG + Intergenic
1174983335 20:55421719-55421741 GACGGCATTCTGGGGGAGGCTGG - Intergenic
1175415383 20:58797395-58797417 CACAGCTCTCTGCAGGAGGTGGG + Intergenic
1175553626 20:59832553-59832575 GACAGAAATCTGGAAGAGTCCGG + Intronic
1175848039 20:62069255-62069277 CACCGGAAGCTGGAGGAAGCAGG - Intergenic
1175937023 20:62518590-62518612 CATAGGACTTTGGAGGAGGCAGG + Intergenic
1176806232 21:13486693-13486715 CACAGGAATATGGAGGAAGTAGG + Intergenic
1177206163 21:18014323-18014345 CACAGCAACATGGATGAAGCTGG + Intronic
1177356185 21:20011018-20011040 CCCAGCAATTTGGCTGAGGCAGG - Intergenic
1177730765 21:25024785-25024807 CCCTGCAAGCGGGAGGAGGCTGG + Intergenic
1178018110 21:28375789-28375811 CACAGTACTCTAGAGGAGGGAGG - Intergenic
1178103148 21:29291635-29291657 CAGAGAAGTGTGGAGGAGGCTGG + Intronic
1178135129 21:29618708-29618730 CACAGCAACCTGGATGAGACTGG + Intronic
1178349203 21:31859779-31859801 CACAGCAACCTGGATGAGATTGG - Intergenic
1179967192 21:44814058-44814080 CACATCAACCTGAAGGTGGCCGG - Exonic
1180206703 21:46265369-46265391 CACAGACAGCTGGAAGAGGCTGG + Exonic
1180413650 22:12639299-12639321 CACAGCAACCTGGATGAAACTGG - Intergenic
1180831930 22:18910972-18910994 CAGAGCACACTGGAGAAGGCGGG + Exonic
1180904143 22:19396722-19396744 CACAGAAGTCAGGAAGAGGCTGG + Intronic
1180948687 22:19710603-19710625 CACAGCACTTTGCAGGAGTCAGG + Intergenic
1181067915 22:20315370-20315392 CAGAGCACACTGGAGAAGGCGGG - Exonic
1182309624 22:29395395-29395417 CTCAGCAAGCAGGTGGAGGCTGG - Intronic
1182718004 22:32375610-32375632 CCCAGGGATCTGGAGGAGGAAGG - Intronic
1183153979 22:36060182-36060204 CACAGCAACCTGGATGAGATTGG + Intergenic
1184152530 22:42647098-42647120 CCCCACAGTCTGGAGGAGGCTGG - Intronic
1184379418 22:44135771-44135793 CACCAGAAGCTGGAGGAGGCAGG - Intronic
1184608572 22:45588228-45588250 CACAGAGATCTGGAGGAAGAGGG + Intronic
1203282008 22_KI270734v1_random:136243-136265 CAGAGCACACTGGAGAAGGCGGG + Intergenic
950649449 3:14398036-14398058 CACAACAATCTGCAGGAGAGGGG + Intergenic
951144135 3:19206107-19206129 CACAGCAACCTGGATGGGACTGG - Intronic
951184321 3:19694615-19694637 CACAGCAACCTGGATGAGATTGG + Intergenic
951763762 3:26173761-26173783 TACAGCAATCTGGATGAGATTGG - Intergenic
952689384 3:36186715-36186737 CGCAGCAACCTGGATGAGACTGG - Intergenic
953553501 3:43923764-43923786 CACAGGACTCTGGATGAGGCAGG - Intergenic
954815997 3:53280988-53281010 CACTGGAATCTGGAAGAGGGTGG + Intergenic
954926869 3:54243681-54243703 TACAGCGTCCTGGAGGAGGCTGG + Intronic
955093113 3:55771785-55771807 CACAGCAGGCCTGAGGAGGCAGG + Intronic
955138168 3:56241122-56241144 CACAGCAATATGGATGGAGCTGG - Intronic
956725470 3:72153082-72153104 CACTGAACTCTGGAGGAGGCTGG - Intergenic
956774064 3:72550365-72550387 CACCGGAAGCTGGGGGAGGCAGG - Intergenic
957732402 3:84156687-84156709 CACTGGAATATGGATGAGGCAGG - Intergenic
959090021 3:101892350-101892372 CTCTGCAGTCTGCAGGAGGCAGG - Intergenic
960724206 3:120653899-120653921 CACTGGAACCTGGTGGAGGCAGG - Intronic
961001252 3:123375526-123375548 CAGAGCAATCTGGAGAATGAGGG + Intronic
961116085 3:124331301-124331323 CACAGCAATCTGGATGGAGTTGG + Intronic
961521260 3:127468588-127468610 CACAGGAATATGGAGGAGGCAGG + Intergenic
961523937 3:127484596-127484618 CACAGCAGACTGGAGAAGACAGG - Intergenic
961736636 3:129005790-129005812 CACTGCATGCTGCAGGAGGCTGG - Intronic
962203844 3:133419282-133419304 CACAGGAATTTGGGGGAGGAAGG + Intronic
962810268 3:138953427-138953449 CACAGCAACCTGGATGGAGCTGG - Exonic
962826992 3:139107579-139107601 CAGAGCAAGGTGGAGGAGGTGGG + Intronic
963634880 3:147781904-147781926 CACAGTAACCTGGATGAAGCTGG - Intergenic
964746308 3:160015988-160016010 CACTGTAATCTGCAGTAGGCAGG - Intergenic
966221850 3:177559084-177559106 CACAGCAACCTGGATGGAGCTGG - Intergenic
966971940 3:185052196-185052218 GACAGCAATGTGGAGAAGACTGG - Exonic
966991902 3:185241102-185241124 CGCAGCAATCTGGATGAGATTGG - Intronic
967065113 3:185908249-185908271 CACGGCAATTTGCAGGAGGAAGG - Intergenic
967454745 3:189671733-189671755 CACAGCAACATGGATGAGCCTGG + Intronic
969528724 4:7717843-7717865 AACAGCAATCAGGTGGAGTCAGG + Intronic
970268825 4:14320899-14320921 CACAGCAATCTGGATGAAACTGG + Intergenic
971005697 4:22372135-22372157 CACAGCAATATGGATGAGCCTGG + Intronic
971383730 4:26124348-26124370 CACAGCGACCTGGATGAGACTGG - Intergenic
971969495 4:33603715-33603737 CACAGGTAGCTGGAGGAGGATGG + Intergenic
972428946 4:38961926-38961948 CACAGCAACATGGATGAGCCTGG - Intergenic
973179118 4:47246210-47246232 CACAGCAACCTGGATGAGATTGG - Intronic
974919858 4:68225510-68225532 GACAGGAATTTGGAGGAGGATGG - Intergenic
976449436 4:85170491-85170513 CAGAACAATCTGGAGCAGTCTGG + Intergenic
977135284 4:93296140-93296162 CACAATAAACTGGAAGAGGCAGG - Intronic
977280568 4:95034574-95034596 CACAGTAATCTGGATGGAGCTGG - Intronic
977371107 4:96137399-96137421 CATAGCAATGTGTAGGAGACAGG + Intergenic
977731855 4:100363263-100363285 CAGAGGAAGCTGGAAGAGGCAGG - Intergenic
978806229 4:112803515-112803537 CACCGGAAGCTGGAAGAGGCAGG + Intergenic
979813869 4:125074093-125074115 CACAGCAACCTGGATGAGATCGG + Intergenic
981266390 4:142788763-142788785 CACAGCAACCTGGATGAGATTGG - Intronic
982048308 4:151471913-151471935 CGCAGCAGTCTGGATGAGACTGG - Intronic
982950128 4:161684042-161684064 CACAGCAACCTGGATGAGATTGG - Intronic
983187217 4:164713825-164713847 CACAGCAATGTTGGGGAGGGTGG - Intergenic
984190470 4:176599873-176599895 CACAGCAATCTGGATGGAACTGG - Intergenic
984500222 4:180549319-180549341 CACAGCAACATGGATGAGCCTGG - Intergenic
985062397 4:186092394-186092416 CAGAGCAGTCTTGCGGAGGCTGG + Intergenic
986026899 5:3859460-3859482 CACAGGAATCTGGAGGAGCCAGG + Intergenic
987328184 5:16831567-16831589 CACAGCAACCTGGATGAGACTGG + Intronic
987869099 5:23589669-23589691 CACAGCAACCTGGATGGAGCTGG + Intergenic
988596058 5:32592242-32592264 GAAAGCAACTTGGAGGAGGCAGG + Intronic
989556939 5:42808338-42808360 CCCAGCAATGTGGAGAAGCCTGG - Exonic
990380744 5:55220487-55220509 CACAGTGAGCTGGAGGAGGGCGG - Exonic
991103084 5:62815100-62815122 CCCAGGAGTCTGGATGAGGCTGG + Intergenic
991587802 5:68216686-68216708 CCCAGCAATATGGAGCCGGCTGG + Intronic
992027584 5:72685851-72685873 AACATGAATCTGGAGGAGGGAGG - Intergenic
992258664 5:74948199-74948221 CACTGCAAACAGGAGGAAGCAGG + Intergenic
992339595 5:75808926-75808948 CACAGCGACCTGGATGAGACTGG - Intergenic
994053377 5:95387888-95387910 TGCAGCAATGTGGATGAGGCTGG + Intergenic
995095422 5:108230416-108230438 CACAGCAACCTGGATGGGACTGG + Intronic
995799531 5:115979063-115979085 TAGAGCCACCTGGAGGAGGCTGG - Intronic
996284918 5:121778393-121778415 CACAGCAACCTGGATGAGACTGG - Intergenic
997629632 5:135357038-135357060 CACAGCTCTCAGGAGGAGACTGG - Intronic
997867523 5:137477954-137477976 CACAGCATGCTGGAGAATGCAGG + Intronic
997882921 5:137606301-137606323 CACTGCAGTCAGGAGGAGGATGG + Intergenic
999812163 5:155138010-155138032 CACAGCAAGGGAGAGGAGGCTGG + Intergenic
1000013137 5:157252622-157252644 CGCAGCAGTCTGGAGAAGGCTGG - Exonic
1000032554 5:157416984-157417006 CACAGCAACCTGGATGAGATTGG - Intronic
1000590924 5:163156552-163156574 CACAGCAACCTGGATGAGATTGG - Intergenic
1000861671 5:166463135-166463157 CACAGCCATCTGGATGAAGTTGG - Intergenic
1001132819 5:169078991-169079013 CACAGAATTCTGGAGGAGATTGG + Intronic
1001291211 5:170462815-170462837 CACAGCAACCTGGATGAGATTGG + Intronic
1003323681 6:5075556-5075578 AACAGCAATCTGGAAAAGGAAGG + Intergenic
1003372306 6:5540112-5540134 CACAGCAGTCCTGAAGAGGCCGG - Intronic
1003480378 6:6525758-6525780 CTCAGCAATTTGGAGAATGCAGG + Intergenic
1004426829 6:15512401-15512423 GGCAGCAAGCGGGAGGAGGCCGG - Intronic
1005196004 6:23284793-23284815 CACAGATACCTGGAGGAGGCTGG + Intergenic
1005365625 6:25073829-25073851 CACAGCAACCTGGATGAAACTGG - Intergenic
1005394881 6:25371061-25371083 CACAGCAATTTGGATGGAGCTGG - Intronic
1005439273 6:25848041-25848063 CACAGCAATCTGGATGGGATTGG - Intronic
1006447601 6:34088588-34088610 CAATGCAAGCTGGAGGAGACAGG + Intronic
1007642536 6:43353983-43354005 CCCAGCACTCTGGGAGAGGCTGG + Intronic
1008416216 6:51243919-51243941 CACAGCAACCTGGATGAGATTGG + Intergenic
1008940904 6:57044795-57044817 CACAGCAATCTGGATGGAACTGG + Intergenic
1010465003 6:76157427-76157449 CACAGCAACCTGGATGGAGCTGG - Intergenic
1010631874 6:78207973-78207995 CAAAGCATTCAAGAGGAGGCAGG - Intergenic
1010993664 6:82508344-82508366 CACAGCAATATGGATGCAGCTGG + Intergenic
1011401641 6:86969220-86969242 AACAGCAATATGCAGGAAGCAGG + Intronic
1012486452 6:99726773-99726795 CACAGCAGTAAGGAGGAGACTGG + Intergenic
1012724761 6:102796625-102796647 CACAGCAACCTGGATGAGATTGG + Intergenic
1013253511 6:108359482-108359504 CAAAGCAATCTGGACAGGGCAGG - Intronic
1013583561 6:111559330-111559352 GACAGCATTCTGGCTGAGGCTGG - Exonic
1014432541 6:121388003-121388025 CCCAGCACTTTGGATGAGGCAGG - Intergenic
1014690044 6:124552348-124552370 CACTGAAATCTGAATGAGGCAGG + Intronic
1016026432 6:139292128-139292150 GGCAGCAGTCTGGAGGAGGTGGG + Exonic
1016289494 6:142512816-142512838 CACAGCAACCTGGATGAGATTGG - Intergenic
1017586911 6:155936644-155936666 CACAGCACTCTGACGGAAGCAGG + Intergenic
1018288887 6:162270210-162270232 CACAGCAATCTGGATGGGATTGG + Intronic
1018329218 6:162709788-162709810 CATAGCTATCTGGAGAAGGAAGG + Intronic
1018348028 6:162922712-162922734 CACAGCAACATGGATGAGCCTGG - Intronic
1018692960 6:166363795-166363817 CACAGCACTGTGGAGCAGGCTGG - Intergenic
1018877309 6:167834391-167834413 CACAGCAACCTGGATGGGACTGG - Intronic
1019229227 6:170544113-170544135 CATAGCAATAGGGAGTAGGCTGG - Intronic
1019521952 7:1464845-1464867 CACAGCAATCAGAGGCAGGCTGG - Intergenic
1019922644 7:4172735-4172757 CACCGGAAGCTGGAAGAGGCAGG - Intronic
1021626513 7:22598830-22598852 GCCAGCAACCTGGGGGAGGCAGG - Intronic
1021811915 7:24410702-24410724 CACAGCAACCTGGATGAGATTGG + Intergenic
1021823539 7:24522310-24522332 TCCAGAAATCTGCAGGAGGCTGG + Intergenic
1021888573 7:25164922-25164944 CACAGCAACCTGGAGGGAGTTGG - Intronic
1022378105 7:29834075-29834097 CCCAGCCATCTGGATGAGGATGG - Intronic
1023669856 7:42564201-42564223 CACAGCAATCTGGATGGAGTTGG + Intergenic
1023850889 7:44149719-44149741 CTCAGCAGTCTGGAAGGGGCAGG + Intronic
1023875520 7:44284338-44284360 CACAGCCATCTGCCCGAGGCCGG - Intronic
1024304947 7:47921735-47921757 CACAGCAACCTGGATGAGATTGG + Intronic
1024377530 7:48656321-48656343 CAAAGCCACCTGGAGGATGCTGG - Intergenic
1024534308 7:50417385-50417407 CACAGCCACCTGAATGAGGCAGG + Intergenic
1025110764 7:56214254-56214276 CACAGCAACCTGGATGAGATTGG - Intergenic
1025809991 7:64869616-64869638 CACTGCTATCTGGAAAAGGCAGG - Intergenic
1025872148 7:65444903-65444925 CACACCCATGTGGAGGAGGCTGG - Intergenic
1026218068 7:68367141-68367163 CACAGCAACCTGGATGAAGTTGG - Intergenic
1026307157 7:69152170-69152192 CACAGCAACCTGGATGAGATTGG + Intergenic
1026486161 7:70823450-70823472 CACAGCAATCTGGATGAGATTGG + Intergenic
1026743812 7:72995821-72995843 CCCAGCTACCTGGAGGAGACAGG + Intergenic
1027099923 7:75369256-75369278 CCCAGCTACCTGGAGGAGACAGG - Intergenic
1028329394 7:89570279-89570301 CATAGCAACATGGAGGAAGCTGG + Intergenic
1028787407 7:94811346-94811368 CAAAGCAATCCTGGGGAGGCAGG + Intergenic
1029600535 7:101560763-101560785 CACAGCAATCATGTGGAGGAAGG + Intergenic
1030811563 7:113978775-113978797 CCCAGCACTCTGGGAGAGGCAGG + Intronic
1032445206 7:131976420-131976442 CAAAGCCAACTGGGGGAGGCTGG + Intergenic
1033816249 7:145076930-145076952 CACAGCAACCTGGATGGAGCTGG - Intergenic
1034216258 7:149408513-149408535 CACAGCAACCTGGATAAGACTGG - Intergenic
1034708028 7:153164062-153164084 CACAGCAACATGGATGAAGCTGG - Intergenic
1035458964 7:159027635-159027657 CACAGCCATCTGGTGGAGCGTGG + Intergenic
1036603326 8:10283734-10283756 CACAGCAACCTGGATGAGACTGG - Intronic
1037579984 8:20239377-20239399 CAAAGCAAGCTGGGGGTGGCGGG - Intergenic
1037899208 8:22677756-22677778 CACAACATTCTGGAGCTGGCAGG - Intergenic
1038897227 8:31797876-31797898 CACAGCAATATGGATGAGTCTGG + Intronic
1039810036 8:41038640-41038662 CACAGCAACCTGGATGAGACTGG - Intergenic
1039955568 8:42204771-42204793 CCCAGCACTTTGGAGGAGGAGGG + Intronic
1040687636 8:49894438-49894460 CATAGCAATCTGGATGAGATTGG - Intergenic
1041123811 8:54614148-54614170 CATAGCAAAGTGGAAGAGGCAGG + Intergenic
1041388685 8:57330248-57330270 CTCAGGAATCTGGCTGAGGCTGG - Intergenic
1041864637 8:62557204-62557226 CACAGCAACCTGGATGAGACTGG - Intronic
1042769909 8:72368308-72368330 CACAGCAACCTGGATGAGATTGG + Intergenic
1042843623 8:73148806-73148828 CACAGCAACATGGATGAAGCTGG + Intergenic
1042963990 8:74331224-74331246 CACAGGAAGCAGGAGTAGGCGGG - Intronic
1043049178 8:75362993-75363015 CACAGCTACCTGGATGAGACTGG + Intergenic
1043422541 8:80113624-80113646 CACAGCAATATGGATGAGCCTGG + Intronic
1043832529 8:85007000-85007022 CACAGCAACCTGGATGAGACTGG + Intergenic
1044500170 8:92945342-92945364 CACTGGAATCTGGAGGTGGCAGG - Intronic
1045095468 8:98793022-98793044 CACAGCAACCTAGAGGAGATTGG + Intronic
1046593250 8:116230417-116230439 CACAGCAAATGGGAGGATGCTGG + Intergenic
1047036388 8:120943634-120943656 CACAGCAACATGGATGAGCCTGG - Intergenic
1047417505 8:124677164-124677186 TACACAAATCAGGAGGAGGCAGG + Intronic
1047571418 8:126102657-126102679 CACAGCACTCTGGAGCTGGATGG - Intergenic
1048538135 8:135316680-135316702 CCCAGCCATCTGCAGGAGGCCGG - Intergenic
1048615139 8:136065995-136066017 CACAGCAACGTGGATGGGGCTGG + Intergenic
1048976246 8:139674571-139674593 CACAGCAAAAGGGAGGAGCCGGG + Intronic
1049166930 8:141132054-141132076 CACATCTCTCAGGAGGAGGCTGG + Intronic
1049877838 8:145037645-145037667 CACAGCAACCTGGATGGGACTGG + Intergenic
1049960901 9:736960-736982 CTCGGCAATTTGGAGGATGCAGG - Intronic
1051178752 9:14388255-14388277 CCCAGCTACATGGAGGAGGCTGG + Intronic
1051800964 9:20933493-20933515 CACAGCAATCTGGATGAGACTGG - Intronic
1052894758 9:33736570-33736592 CACAGCAACCTGGATGAGATCGG + Intergenic
1053066740 9:35074408-35074430 CACTGCACTCTGGTGGAGGCTGG - Exonic
1053299770 9:36940658-36940680 AACAGCAAGCAGGAGAAGGCAGG + Intronic
1055335024 9:75224608-75224630 CACAGCAACCTGGATGAGATTGG - Intergenic
1056027125 9:82510615-82510637 CACGGCAATCTGGATGAAGTTGG + Intergenic
1056812811 9:89777405-89777427 CTCTGCATTCTGGAGGAGCCAGG - Intergenic
1057144713 9:92749941-92749963 CACAGCAGTCTGGGCCAGGCTGG + Intronic
1057790682 9:98122776-98122798 CACATCATCCTGCAGGAGGCAGG + Exonic
1058540189 9:106003608-106003630 CACAGCAACCTGGATGAGATTGG - Intergenic
1059951599 9:119469109-119469131 CACAGCAACATGGAGGAGCTTGG - Intergenic
1060667226 9:125439155-125439177 CACAGCAACCTGGCAGCGGCTGG + Intronic
1061284208 9:129613102-129613124 CACAGAAACCTGGAGCAGGTGGG - Exonic
1061548354 9:131317831-131317853 CACAGCCCCCTCGAGGAGGCAGG - Intergenic
1062137547 9:134937733-134937755 CAGAGCTGACTGGAGGAGGCAGG - Intergenic
1062262956 9:135671921-135671943 CACGGGAGTCTGAAGGAGGCTGG + Intergenic
1202801897 9_KI270720v1_random:7894-7916 CACAGCAACCTGGATGAAACTGG + Intergenic
1203446452 Un_GL000219v1:61646-61668 CACAGCAACCTGGATGAAACTGG + Intergenic
1185944753 X:4362722-4362744 CACAGCCAGCTGCATGAGGCAGG - Intergenic
1186001236 X:5013520-5013542 CACAGCAACATGGATGAGCCTGG + Intergenic
1186818814 X:13265311-13265333 CACAAGAATGTGGAGGAGGAGGG - Intergenic
1186949082 X:14602724-14602746 CACAGCAACCTGGATGGGACTGG - Intronic
1187949210 X:24455356-24455378 CACAGCAATTTGGAGGCTGGTGG + Intergenic
1188176641 X:26998999-26999021 CACAGCAACCTGGATGGAGCTGG + Intergenic
1188446635 X:30259608-30259630 CACAGCAATCTCTGGGAGGCGGG - Intergenic
1189768083 X:44392490-44392512 CAAACCCATGTGGAGGAGGCAGG + Intergenic
1189774947 X:44462249-44462271 CACAGGAATATGGAGGAGTGGGG - Intergenic
1190028778 X:46951761-46951783 AACAGCAGAATGGAGGAGGCAGG - Intronic
1191905784 X:66088065-66088087 TACAGCAACCTGGATGAGACTGG - Intergenic
1193550872 X:82891273-82891295 CACAGCAACCTGGATGAGATTGG + Intergenic
1193814588 X:86089818-86089840 CACAGCAACCTGGATGGGGTTGG + Intergenic
1194499580 X:94663876-94663898 CACAGCAACCTGGATGAGATTGG - Intergenic
1194587888 X:95759125-95759147 CACAGCAACCTGGATGGAGCTGG + Intergenic
1194637767 X:96366439-96366461 CACAGCAACCTGGATGAGATTGG - Intergenic
1194656809 X:96583180-96583202 CACAGCAACCTGGATGAGATTGG - Intergenic
1194881436 X:99256386-99256408 CACAGCAACCTGGATGAAACTGG - Intergenic
1194906453 X:99582481-99582503 CACAGCAACCTGGATGAAACTGG - Intergenic
1194907241 X:99593410-99593432 CACAGCAACCTGGATGAAACTGG + Intergenic
1196204920 X:112928745-112928767 CACAGCAACCTGGATGAGCGTGG + Intergenic
1196753005 X:119134272-119134294 CACAGCAATGTGAATGAGCCTGG - Intronic
1198447895 X:136736915-136736937 CACAGCAATCTGCAGGGTGAGGG + Intronic
1198930735 X:141856749-141856771 CACAGCAACATGGATGAGCCTGG + Intronic
1199220396 X:145309997-145310019 CAAAGCATTCTAGAGGAAGCAGG - Intergenic
1199613304 X:149635428-149635450 CACAGCACACTGGAGGAGTGTGG - Intergenic
1199685655 X:150263053-150263075 CACGGCAACCAGGTGGAGGCAGG - Intergenic
1199928212 X:152491762-152491784 CACAGCAACCTGGATGAGATTGG - Intergenic
1201752759 Y:17451327-17451349 CACAGCAATCTGGATGGGATTGG + Intergenic