ID: 1083608199

View in Genome Browser
Species Human (GRCh38)
Location 11:63991636-63991658
Sequence TGTGCCAGGGATTTGGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 379}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083608199_1083608205 2 Left 1083608199 11:63991636-63991658 CCCTGTGCCAAATCCCTGGCACA 0: 1
1: 0
2: 4
3: 40
4: 379
Right 1083608205 11:63991661-63991683 GAGTGTGCTCACAATGGCCATGG 0: 1
1: 0
2: 1
3: 15
4: 124
1083608199_1083608204 -4 Left 1083608199 11:63991636-63991658 CCCTGTGCCAAATCCCTGGCACA 0: 1
1: 0
2: 4
3: 40
4: 379
Right 1083608204 11:63991655-63991677 CACAGAGAGTGTGCTCACAATGG 0: 1
1: 0
2: 0
3: 13
4: 207
1083608199_1083608208 23 Left 1083608199 11:63991636-63991658 CCCTGTGCCAAATCCCTGGCACA 0: 1
1: 0
2: 4
3: 40
4: 379
Right 1083608208 11:63991682-63991704 GGTGGCTGCTACAGTAGCAGTGG 0: 1
1: 0
2: 2
3: 14
4: 202
1083608199_1083608206 5 Left 1083608199 11:63991636-63991658 CCCTGTGCCAAATCCCTGGCACA 0: 1
1: 0
2: 4
3: 40
4: 379
Right 1083608206 11:63991664-63991686 TGTGCTCACAATGGCCATGGTGG 0: 1
1: 0
2: 0
3: 17
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083608199 Original CRISPR TGTGCCAGGGATTTGGCACA GGG (reversed) Intronic
900474811 1:2871066-2871088 TGCCCCAGGAATTTGGCTCAGGG - Intergenic
900585993 1:3432576-3432598 GGTGCCAGGGTTTTGGCCCCAGG + Intronic
901122438 1:6906532-6906554 TGTGCCAGGGACTTTGGCCATGG + Intronic
901187443 1:7384150-7384172 TGTGCCAGGGATGTGGGAAAAGG + Intronic
903355945 1:22747506-22747528 TGTGCAAGGGCTTTGGCAGCTGG - Intronic
904285433 1:29450543-29450565 TGGGTCAGGAATTTGGCACCTGG - Intergenic
904863428 1:33557759-33557781 GCTGCCAGGGAGATGGCACATGG - Exonic
905343095 1:37292785-37292807 TGTGGCAGGAATTTGCTACAAGG - Intergenic
905965635 1:42093101-42093123 TGTGCCCAGGATGTGGAACATGG - Intergenic
906017134 1:42591885-42591907 TGTGCCCTGGATGTGGGACATGG + Intronic
906701358 1:47860504-47860526 TGTAACAGGGATTTGGCACCTGG - Intronic
908176967 1:61565616-61565638 TGTGCCCAGGATGTGGGACATGG - Intergenic
908616748 1:65930553-65930575 TGTGCCCTGGATGTGGGACATGG + Intronic
909130447 1:71729147-71729169 TACCCCAGGGATTTTGCACAGGG + Intronic
911644151 1:100320658-100320680 TGTGCCCTGGATGTGGGACATGG + Intergenic
913505029 1:119509076-119509098 TGTGCCAGGCACTTGGCCAAAGG + Intronic
913709410 1:121466755-121466777 TGTGCCAGTGATTTTGCTGATGG + Intergenic
914857472 1:151363084-151363106 TGCGCCCTGGATTTGGGACATGG + Intergenic
915787034 1:158624414-158624436 TGTGCCCTGGATGTGGGACATGG + Intronic
917235559 1:172888418-172888440 TGTGCCCAGGATGTGGGACATGG - Intergenic
917520339 1:175743104-175743126 TCTGCAAGGCATTTGGCACTAGG - Intronic
917752569 1:178067000-178067022 TGTCCCTGGGATTTTGCAAAGGG + Intergenic
918931202 1:190858951-190858973 TGTGCCTGGGATTTGGGACATGG + Intergenic
919254560 1:195104956-195104978 TGTGCCCTGGATGTGGAACATGG - Intergenic
920185249 1:204155367-204155389 TTTGCCTGGGATCTAGCACAGGG - Intronic
920589526 1:207203533-207203555 TGTTTCAGGGATCTGGCAAAGGG - Intergenic
921465020 1:215477255-215477277 TGTGCCCTGGATGTGGGACATGG - Intergenic
922422767 1:225470811-225470833 TGTGCCAGGGGCTGGGAACATGG - Intergenic
923191605 1:231626038-231626060 TGTGCCAAGCCTCTGGCACATGG + Intronic
924799287 1:247315794-247315816 TGAGTCAGGGTTTTGGAACAAGG + Intronic
1063060062 10:2541881-2541903 TGTGCCAGGGGTTTTACACTGGG + Intergenic
1063767694 10:9161005-9161027 TGTGCCTTGGATGTGGGACATGG + Intergenic
1064554600 10:16535790-16535812 TTTTCCAGTGATTTGGCTCACGG - Intergenic
1064652674 10:17525168-17525190 TGTGCCAGGTATTTTACATATGG - Intergenic
1065340055 10:24696210-24696232 AGTTTCAGGGCTTTGGCACAGGG + Intronic
1066132724 10:32409728-32409750 TGTGCCCAGGATGTGGGACATGG + Intergenic
1066150063 10:32606583-32606605 TATGCCCTGGATTTGGGACATGG + Intronic
1067529414 10:47059680-47059702 AGTGACAGGGAGTGGGCACAGGG - Intergenic
1068807249 10:61211486-61211508 TCTCCTAGGGATTTGGAACAGGG + Intergenic
1069106075 10:64384920-64384942 TGTGCCCTGGATGTGGGACATGG - Intergenic
1069505460 10:68993516-68993538 TGTGCAAGGTATCTGGCACATGG + Intronic
1069775741 10:70926110-70926132 TGTGCCAGGCATGGGGCATAGGG + Intergenic
1069999910 10:72368595-72368617 TGTGCCAGGTGTTTAGAACAAGG + Intronic
1070245926 10:74731075-74731097 TGTGCCCAGGATATGGGACATGG + Intergenic
1070320606 10:75352129-75352151 TGTGCCAGGGCTTGGGAAGATGG - Intergenic
1071304979 10:84291578-84291600 TGTGCCACAGAATTGGAACAGGG + Intergenic
1071990075 10:91093038-91093060 TGTGCCCTGGATGTGGGACATGG - Intergenic
1073957352 10:108888925-108888947 TGTGCAAGGGATTCTGCACGAGG - Intergenic
1074471077 10:113727425-113727447 TGTGTCAAGTATTTGGCACAAGG + Intronic
1075659222 10:124181819-124181841 TGTGACAGGGCTTCGGCCCAGGG + Intergenic
1075737936 10:124675515-124675537 TGTCGCATGGATCTGGCACACGG - Intronic
1076002370 10:126922564-126922586 TGTGGGAGGGATTTGGATCATGG - Intronic
1077453756 11:2665818-2665840 TGTGCCAGTGCTGAGGCACAGGG + Intronic
1077845222 11:6015641-6015663 TGTGCCCTGGATGTGGAACATGG + Intergenic
1078994705 11:16685539-16685561 TGTGCCAGGGATGTGGGACATGG - Intronic
1079393229 11:20040183-20040205 TCCGCAAGGGATATGGCACAGGG + Intronic
1079772050 11:24474767-24474789 TGTGCCCTGGATATGGGACATGG - Intergenic
1080136137 11:28857317-28857339 TGTGCCCTGGATGTGGGACAAGG - Intergenic
1081613601 11:44577911-44577933 TGGGCCAAGGACTGGGCACAGGG + Intronic
1083294024 11:61705694-61705716 TGTGCCAGGGATTGGGTGGATGG - Intronic
1083608199 11:63991636-63991658 TGTGCCAGGGATTTGGCACAGGG - Intronic
1083633092 11:64105744-64105766 TTTCCCAGGGGTTTGGCACAGGG - Intronic
1085145517 11:74192159-74192181 TGTGCCCTGGATGTGGGACATGG + Intronic
1085467663 11:76735166-76735188 CCTGCCAGGGATTTATCACAGGG + Intergenic
1085960050 11:81451018-81451040 TGTGCCAGGCACTTTGCAAAAGG + Intergenic
1087307095 11:96500694-96500716 TGTGCCTGGTTTTTGGCAAAAGG - Intronic
1088297824 11:108319670-108319692 TGTGCCAGGCACTAGGCACAAGG - Intronic
1088575097 11:111263924-111263946 TTTGCCAAGGGCTTGGCACATGG + Intronic
1088812144 11:113399200-113399222 TGTGCCCTGCTTTTGGCACATGG + Exonic
1088830170 11:113530168-113530190 TGTGCCAGGAATCAGGCACATGG - Intergenic
1089926956 11:122268766-122268788 TGTTCCAGGGAGATGGCCCAGGG + Intergenic
1089995170 11:122899919-122899941 TGGGGCAGGGATATGGGACATGG - Intronic
1090728799 11:129551833-129551855 TGTGCCCTGGATGTGGGACATGG + Intergenic
1091640922 12:2236667-2236689 TGTGCAAGGGATCAGACACAAGG + Intronic
1091669596 12:2443347-2443369 TGTGCCCTGGATGTGGGACACGG - Intronic
1091878528 12:3957703-3957725 TGTGCCAGGGATTGTGCTAAGGG - Intergenic
1093026669 12:14251789-14251811 TGTGCCAGGTAATTAGCACTAGG + Intergenic
1094182485 12:27606799-27606821 TGGGCCACAGATTAGGCACAAGG + Intronic
1095549138 12:43412638-43412660 TGTGACAGGGAGCTGGCTCACGG - Intronic
1098644337 12:72880095-72880117 TGTGCCCTGGATGTGGGACATGG - Intergenic
1098771526 12:74559336-74559358 TGTGCCATGGATGTGAGACATGG - Intergenic
1099470424 12:83041282-83041304 AGTGACATGGATTTGGAACAAGG + Intronic
1099858731 12:88203578-88203600 TGTGCCCTGGATATGGGACATGG - Intergenic
1101340517 12:103838933-103838955 TGCTCCAGGGATTGGGGACAAGG + Intronic
1101451333 12:104781706-104781728 AGTGACAGTGATTTGGTACAGGG + Intergenic
1101635820 12:106540750-106540772 TGTGCCTTGGATGTGGGACATGG - Intronic
1101827990 12:108235668-108235690 TGAGGCAGGGAATTGCCACAGGG - Intronic
1101887251 12:108676206-108676228 TGTGACTGGGATGGGGCACATGG + Intronic
1105257116 13:18751216-18751238 TGTGCCCTGGATGTGGGACAGGG - Intergenic
1105259788 13:18770580-18770602 TGTGCCCTGGATGTGGGACAGGG - Intergenic
1105262468 13:18789903-18789925 TGTGCCCTGGATGTGGGACAGGG - Intergenic
1105264401 13:18803360-18803382 TGTGCCATGGATGTGGGACAAGG - Intergenic
1106383648 13:29264225-29264247 TGTGCCCTGGATGTGGGACATGG - Intronic
1108245263 13:48507140-48507162 TGTGCCAGGTATATGTCACAAGG - Intronic
1108472975 13:50786056-50786078 GGTGGCAGAGATTTGGCAGAAGG + Intronic
1110873317 13:80478828-80478850 TGTGCCAGGCATTTTGCTCAAGG + Intergenic
1112183199 13:97105015-97105037 TGTGCCAGGAACTGGGGACAAGG + Intergenic
1114241712 14:20874239-20874261 TGTGGCAGGGGTAGGGCACATGG + Intergenic
1114303416 14:21398683-21398705 AGTGCCTGGGATTTGGCATTAGG + Intronic
1114611084 14:24041107-24041129 TGTGCTCCGGATTTGGCCCACGG - Intergenic
1115486666 14:33917162-33917184 TGTGCCAGGGTTTTTCCAAATGG - Intergenic
1115654047 14:35426083-35426105 AGTGCCAGGGCTTAGGGACAGGG - Intergenic
1115889713 14:38012796-38012818 TGTGCCCCGGATGTGGAACATGG + Intronic
1115936536 14:38559320-38559342 TGTGCCCTGGATTTGGGACCTGG - Intergenic
1117046677 14:51819498-51819520 TGTGCCAGGGATTAGGGTAATGG - Intergenic
1117197395 14:53354122-53354144 TGTCCCAGTCATTTGGGACAGGG + Intergenic
1117209492 14:53481106-53481128 TGTGCCTTGGATGTGGAACATGG - Intergenic
1117521556 14:56556710-56556732 TCTGCCAGGGATTTGAGACGAGG - Intronic
1118691462 14:68344300-68344322 TGTGCCCTGGATGTGGGACATGG + Intronic
1118926278 14:70192606-70192628 TGTGCCTGGGTTTTGAGACAGGG + Intergenic
1118929976 14:70232739-70232761 TGTACACGGGATTTGCCACAGGG - Intergenic
1119025842 14:71151518-71151540 TGTGCCCTGGATATGGGACATGG + Intergenic
1120460876 14:84793359-84793381 TTTGTCATGGATTAGGCACAAGG + Intergenic
1121540091 14:94719102-94719124 TGTGCCAGGTACTGGGTACAAGG - Intergenic
1122292609 14:100687737-100687759 GGAGCCAGGGATGTGGCACCTGG - Intergenic
1122406079 14:101501907-101501929 TGGGCCAGGCACTTGGCACAGGG + Intergenic
1202834046 14_GL000009v2_random:64709-64731 TCTGCCATGGATATGGGACAAGG + Intergenic
1202834514 14_GL000009v2_random:67836-67858 TGTGCCCTGGATGTGGGACAAGG + Intergenic
1123775489 15:23575140-23575162 TGTGCCCAGGATGTGGGACATGG + Intronic
1124011518 15:25843154-25843176 GGTGCCAGGGAGGAGGCACATGG - Intronic
1124031713 15:26018107-26018129 TGTGCCAGGCATTGGGCTAAGGG + Intergenic
1124071570 15:26398174-26398196 ATTGCCAGGGATTTGGGAGAAGG - Intergenic
1124144347 15:27109493-27109515 GTTGCCAGGGATTTGTCAGAAGG - Intronic
1129939392 15:79480440-79480462 GCTTCCAGGGATTTGGCACAAGG + Intergenic
1131438866 15:92443599-92443621 TGTGCCAGGGACTTGGTTCTGGG - Intronic
1133026661 16:2991605-2991627 TGTGGCATGGAGGTGGCACACGG - Intergenic
1133087752 16:3378365-3378387 GGGGACAGGGCTTTGGCACATGG - Intronic
1134811288 16:17169073-17169095 TGTCCCAGGCGTTTGTCACAGGG - Intronic
1135260705 16:20978131-20978153 TGTGCCAGGCATTTTGCTAAAGG + Intronic
1136345270 16:29671472-29671494 AGAGCCAGGGACTTGGCACCTGG - Intronic
1136720080 16:32313080-32313102 TGTGCCAGGCATTGGGCCCTGGG - Intergenic
1136725133 16:32351474-32351496 TGTGCCAGGCATTGGGCCCTGGG - Intergenic
1136838457 16:33519359-33519381 TGTGCCAGGCATTGGGCCCTGGG - Intergenic
1136843461 16:33557527-33557549 TGTGCCAGGCATTGGGCCCTGGG - Intergenic
1137932872 16:52605130-52605152 TGTGTTAGGTATTTGCCACATGG - Intergenic
1138297004 16:55895418-55895440 TGTGTTTTGGATTTGGCACACGG + Intronic
1138509659 16:57501002-57501024 TGTGCCAGGCACTGGGCACTGGG + Intergenic
1138649994 16:58454644-58454666 TGTGCCAGGGATAATGCAGAGGG - Intergenic
1139349493 16:66326344-66326366 TGTGCAAAGGAGCTGGCACACGG - Intergenic
1140274501 16:73496759-73496781 TCTGCCTGGGATTTGCCAAATGG + Intergenic
1142403340 16:89872676-89872698 TGTGCCTGGGGTTGGGGACATGG - Intergenic
1203001297 16_KI270728v1_random:166280-166302 TGTGCCAGGCATTGGGCCCTGGG + Intergenic
1203006351 16_KI270728v1_random:204689-204711 TGTGCCAGGCATTGGGCCCTGGG + Intergenic
1203132900 16_KI270728v1_random:1702684-1702706 TGTGCCAGGCATTGGGCCCTGGG + Intergenic
1203153626 16_KI270728v1_random:1857825-1857847 TGTGCCAGGCATTGGGCCCTGGG - Intergenic
1142498957 17:321684-321706 TGTGCCGGGGACAAGGCACATGG + Intronic
1143009465 17:3857938-3857960 TGTACCAGGCGCTTGGCACAAGG + Intergenic
1147037949 17:37695647-37695669 TGTGCCCAGGATGTGGGACATGG + Intronic
1147142037 17:38465563-38465585 TGGGCCTGGAATTTGGCACTGGG - Intronic
1147445617 17:40473661-40473683 TGTGCCAGGGCTTAGACCCAGGG - Intergenic
1147867372 17:43562103-43562125 TGTCCCAGGGATTTGAGAGAGGG + Intronic
1149953601 17:61020070-61020092 TGTCCGAGGTATTTTGCACATGG + Intronic
1150331163 17:64295462-64295484 TGTGCCAGGCATTTTGCTCAAGG - Intergenic
1150371389 17:64641790-64641812 TGGGTCAGGGATTTGGCAAGGGG - Intronic
1150579491 17:66459185-66459207 TGAGACAGGGATTTGCCAGATGG - Intronic
1150659930 17:67066335-67066357 TGTGCAGAGGATTTGGCAAAAGG - Intergenic
1151357348 17:73567677-73567699 TGTGCCCAGGATGTGGGACATGG + Intronic
1151375641 17:73686905-73686927 TGTGCCTTGGATATGGGACATGG + Intergenic
1151404515 17:73877948-73877970 TGTGCCAGGCATTTGGAAATGGG - Intergenic
1152218004 17:79045589-79045611 TGTGCCAGGGGGTTGGCGGAGGG + Intronic
1152604387 17:81281814-81281836 GGTGCCAGTGTTTTGACACAAGG - Intronic
1153078157 18:1189800-1189822 AGTGCCTGGGTTTTAGCACAGGG + Intergenic
1153598575 18:6755391-6755413 AGAGCCAGTGATTTGGCAAAAGG + Intronic
1154423994 18:14258201-14258223 TGTGCCATGGATGTGGGACAAGG + Intergenic
1154426235 18:14274221-14274243 TGTGCCCTGGATGTGGGACAGGG + Intergenic
1154428977 18:14293809-14293831 TGTGCCCTGGATGTGGGACAGGG + Intergenic
1154432136 18:14316435-14316457 TGTGCCCTGGATGTGGGACAAGG + Intergenic
1154433925 18:14329457-14329479 TGTGCCCTGGATGTGGGACAAGG + Intergenic
1156047905 18:32897848-32897870 TGTGCCCAGGATGTGGGACATGG + Intergenic
1156386135 18:36606907-36606929 TGTGCCCAGGATGTGGGACATGG - Intronic
1157034384 18:43953548-43953570 TGTGCCCTGGATGTGGGACATGG + Intergenic
1157350181 18:46877117-46877139 TGTGCTAGGCTTCTGGCACAGGG - Intronic
1158277238 18:55781426-55781448 CATGGGAGGGATTTGGCACAGGG - Intergenic
1159759606 18:72408283-72408305 TGTGCCCTGGATGTGGGACACGG + Intergenic
1159982652 18:74804376-74804398 TATGCCAGGCATTTGTCACATGG - Intronic
1160396320 18:78574817-78574839 TGTGCCCTGGATGTGGCATATGG + Intergenic
1160582969 18:79898234-79898256 TGAGCCAGGGATTTGGGGGATGG + Intronic
1160871903 19:1281553-1281575 AGTGACTGTGATTTGGCACATGG - Intergenic
1161373470 19:3926841-3926863 TGTGCCCGGGATTTGACATTTGG - Exonic
1161739027 19:6009076-6009098 TGTGCCAGGGCCTGGGCTCAGGG - Intronic
1164305800 19:24003280-24003302 AGGGGCAGGGATTTGGCACTGGG + Intergenic
1164436931 19:28238436-28238458 TCTGCCTGTGACTTGGCACAGGG + Intergenic
1164832376 19:31332554-31332576 TGTGCCATGAAGTTTGCACAGGG + Intronic
1165731149 19:38145815-38145837 GTTGCCAGGGGTTAGGCACAGGG - Intronic
1166142001 19:40810275-40810297 TGTACTCGGGATTTGGCATAAGG + Intronic
1166185524 19:41136518-41136540 TGTACTCGGGATTTGGCATAAGG - Intergenic
1167439570 19:49500505-49500527 TGGCCCAGGGTTGTGGCACATGG + Intergenic
1168516469 19:57013563-57013585 TGTGCCCTGGATGTGGAACACGG + Intergenic
1202638179 1_KI270706v1_random:59856-59878 TGTGCCCTGGATGTGGGACAAGG - Intergenic
1202638634 1_KI270706v1_random:62983-63005 TGTGCCATGGATATGGGACAAGG - Intergenic
925210214 2:2038945-2038967 TGTGCCAGGGCTGTGGCGAAAGG - Intronic
929798062 2:45075340-45075362 GATGAGAGGGATTTGGCACAAGG + Intergenic
930507871 2:52306189-52306211 TGTGGAAGGGATCTGGCAGAAGG + Intergenic
934321047 2:91972197-91972219 TGTGCCAGGCATTGGGCCCTGGG + Intergenic
934492181 2:94769041-94769063 TGTGCCGTGGATGTGGGACAAGG - Intergenic
934493606 2:94779303-94779325 TGTGCCCTGGATGTGGGACAAGG - Intergenic
934494081 2:94782501-94782523 TGTGCCATGGATTTGGGACAGGG - Intergenic
935279764 2:101507162-101507184 TGTGCCAGGCACTGTGCACAGGG + Intergenic
935560004 2:104549892-104549914 TGTGCCCAGGATTTGAGACAGGG - Intergenic
935931608 2:108132995-108133017 TGTGCCCTGGATGTGGGACATGG - Intergenic
938279732 2:130055506-130055528 TGTGCCCTGGATGTGGGACAAGG - Intergenic
938280046 2:130057428-130057450 TGTGCCATGGATGTGGGACAAGG - Intergenic
938330683 2:130446220-130446242 TGTGCCCTGGATGTGGGACAAGG - Intergenic
938331003 2:130448143-130448165 TGTGCCATGGATGTGGGACGAGG - Intergenic
938358945 2:130673360-130673382 TGTGCCATGGATGTGGGACGAGG + Intergenic
938359261 2:130675283-130675305 TGTGCCCTGGATGTGGGACAAGG + Intergenic
938435337 2:131280011-131280033 TGTGCCATGGATGTGGGACGAGG + Intronic
938435663 2:131281932-131281954 TGTGCCCTGGATGTGGGACAAGG + Intronic
938972571 2:136445952-136445974 TGTGCCAGGCATTGGGGAGAAGG + Intergenic
940263381 2:151809227-151809249 TGTGCCAAGTATTTGTCAGAAGG - Intronic
940691591 2:156926103-156926125 AGTGCCCTGGATTTGGGACATGG - Intergenic
940994131 2:160128771-160128793 TGTGCCAGGCATTGGTGACACGG - Intronic
941041816 2:160631476-160631498 TGACACAGGAATTTGGCACAGGG - Intergenic
941261870 2:163307346-163307368 TGTGCCCTGGATTTGGGACATGG + Intergenic
942323524 2:174756252-174756274 TGTTCAAGGGATTTAGCAGAGGG + Intronic
942548405 2:177089320-177089342 TGTGCCAAGGATTAGGCTCCTGG + Intergenic
942592254 2:177558550-177558572 TGTGCCCAGGAGATGGCACATGG + Intergenic
943491083 2:188557492-188557514 TGTGCCCTGGATATGGGACATGG - Intronic
943876231 2:193071321-193071343 TGTGCCTGGGATGTGGGACATGG + Intergenic
944315164 2:198276844-198276866 TGTCCTAGGGCCTTGGCACATGG + Intronic
944822029 2:203440974-203440996 TGTGGAAGGGATGGGGCACACGG + Exonic
946055775 2:216900830-216900852 TGTGCCCTGGATGTGGGACATGG - Intergenic
946055969 2:216902098-216902120 TGTGCCCTGGATGTGGGACATGG + Intergenic
947359264 2:229331333-229331355 TGTTGAATGGATTTGGCACAAGG + Intergenic
947550416 2:231041565-231041587 TATGCCAGGCAGTGGGCACATGG + Intronic
947725926 2:232400605-232400627 ATTGCCAGGGATTAGGGACAGGG + Intergenic
948772110 2:240256870-240256892 CGAGCCATGGATTTGCCACAGGG - Intergenic
1169962168 20:11173024-11173046 TGGGCCTGGGATTTGGACCAAGG - Intergenic
1171030119 20:21669486-21669508 TCAGCCAGGGACTTGGCAGAAGG - Intergenic
1171122178 20:22577376-22577398 TGCGACAGGGAACTGGCACATGG - Intergenic
1171161157 20:22924980-22925002 TGTGTCATGTACTTGGCACATGG - Intergenic
1171884756 20:30643919-30643941 TGTGCCCTGGATGTGGGACAAGG - Intergenic
1171885222 20:30647103-30647125 TGTGCCATGGATATGGGACAAGG - Intergenic
1174325460 20:49775280-49775302 TGTCCCAGGGAGTGGGCTCAAGG - Intergenic
1174567385 20:51475380-51475402 GGTGGCAGGGATTTGGGAGAGGG - Intronic
1175624390 20:60478352-60478374 GGTGCCTGAGTTTTGGCACAAGG + Intergenic
1176843107 21:13856266-13856288 TGTGCCCTGGATGTGGGACAAGG - Intergenic
1176844906 21:13869319-13869341 TGTGCCCTGGATGTGGGACAAGG - Intergenic
1176845793 21:13875614-13875636 TGTGCCCTGGATGTGGGACAGGG - Intergenic
1176848528 21:13895168-13895190 TGTGCCCTGGATGTGGGACAGGG - Intergenic
1176849475 21:13901802-13901824 TGTGCCATGGATGTGGGACAAGG - Intergenic
1177206653 21:18017934-18017956 TGTGCCCTGGATGTGGGACATGG + Intronic
1177288367 21:19079192-19079214 TGTGCCTGGGATGTGGGACATGG + Intergenic
1177529381 21:22340444-22340466 TGTGCCCTGGATTTGAGACATGG - Intergenic
1177835673 21:26184207-26184229 TGTGCCCTGGATGTGGGACATGG - Intergenic
1178029205 21:28505393-28505415 TGTGCCCTGGATGTGGGACATGG - Intergenic
1178326092 21:31646657-31646679 TGTGGCAGGGATTTGGGGGAAGG + Intergenic
1179827296 21:43973358-43973380 TGTGGCCAGGATCTGGCACAGGG - Intronic
1180309291 22:11156168-11156190 TGTGCCAGGCATTGGGCCCTGGG + Intergenic
1180363333 22:11918905-11918927 TGTGCCATGGATATGGGACAAGG + Intergenic
1180363789 22:11922023-11922045 TGTGCCCTGGATGTGGGACAAGG + Intergenic
1180547768 22:16517979-16518001 TGTGCCAGGCATTGGGCCCTGGG + Intergenic
1181629963 22:24145636-24145658 TGTGCCAGGCATGTGGCCCTGGG + Intronic
1182026106 22:27120450-27120472 TGTGCCAGGCACTAGGCACTGGG + Intergenic
1183251426 22:36733019-36733041 TGAGCCTGGGGCTTGGCACAGGG + Intergenic
1183488966 22:38106719-38106741 TGAGCCAGGGCTTGGGCGCAGGG - Intronic
1184999792 22:48238387-48238409 GGTGCCAGGGATGGGACACAAGG - Intergenic
1185335391 22:50268970-50268992 GGTGACAGGGAATTGGCACCTGG + Intronic
949295445 3:2516821-2516843 TATGCCAGGCATTTGGCACAGGG + Intronic
949642757 3:6057567-6057589 TGTGGATGGGATTTGGAACATGG + Intergenic
953390810 3:42532643-42532665 CATGCCAGGGACTGGGCACATGG - Intronic
954426916 3:50448134-50448156 TGTGCCAGGGAGGAGCCACATGG - Intronic
955083186 3:55676794-55676816 TGTGCCAGGGCTGGCGCACAGGG - Intronic
955301536 3:57784362-57784384 TGTGCCCAGGATTTTGGACATGG + Intronic
955842184 3:63124380-63124402 AGTGCCTGGGATCTGGCCCAGGG - Intergenic
956416091 3:69031222-69031244 ATTGCCAGAGATTTGGGACAAGG + Intronic
957226433 3:77454392-77454414 TGAGTCAGGGATTTAGCATAAGG - Intronic
957576544 3:82015177-82015199 TGTGCCCTGGATGTGGGACATGG + Intergenic
958923267 3:100130041-100130063 TGTGACATGGAGTTGGCAAAGGG - Intronic
959804356 3:110533203-110533225 TGTGCCCTGGATGTGGGACATGG + Intergenic
959935355 3:112023036-112023058 TGTGCCCTGGATGTGGGACATGG + Intergenic
960234178 3:115262428-115262450 TGAGCCAGGAGTTTAGCACAGGG + Intergenic
963304004 3:143629842-143629864 TGAGCCAGGCATTAGGCACTGGG + Intronic
963416332 3:145000310-145000332 TGTGCCTAGGATGTGGGACATGG - Intergenic
963511796 3:146256531-146256553 TGTGCCCTGGATGTGGGACATGG - Intergenic
964092335 3:152892092-152892114 TGTGCCCAGGATATGGGACATGG - Intergenic
965232620 3:166072643-166072665 TGTGCCCTGGGTTTGGAACATGG + Intergenic
965865365 3:173199055-173199077 TGTGCCCTGGATGTGGGACATGG - Intergenic
965891480 3:173519521-173519543 TGTGCCCTGGATGTGGGACATGG + Intronic
966976423 3:185087641-185087663 TTTGCCAGGGACTGGGCATACGG + Intronic
968113228 3:196067257-196067279 TATGCCAGGAATCTTGCACAAGG + Intronic
968350707 3:198049710-198049732 TGTGCCCTGGATGTGGGACAAGG - Intergenic
968601036 4:1509444-1509466 GGTGCCACGGATGTGGCCCAGGG - Intergenic
969063032 4:4454273-4454295 TGTGCAAAGTAATTGGCACAGGG + Intronic
969251142 4:5969649-5969671 TGTGCCAGGCATTTGACATGGGG + Intronic
969298324 4:6282323-6282345 TGTGCCAGAGACAGGGCACAGGG - Intronic
970665641 4:18333463-18333485 TGTGCCCTGGATGTGGGACATGG - Intergenic
970842706 4:20494122-20494144 TGTGCCAGTGATTTGACAAAAGG + Intronic
971308070 4:25501134-25501156 TGTGCCAGGGAGTGGGCTCGTGG + Intergenic
972172548 4:36364390-36364412 TTTGCCAGGTATGTGACACATGG - Intergenic
972343551 4:38173887-38173909 TGTGCCAGGCATTTATTACAGGG + Intergenic
972359615 4:38314881-38314903 TGCTCCAGGGATTCGGCACCTGG - Intergenic
973368876 4:49229371-49229393 TGTGCCATGGATATGGGACAAGG - Intergenic
973392170 4:49566044-49566066 TGTGCCATGGATATGGGACAAGG + Intergenic
974540386 4:63225923-63225945 TGTGCCCTGGATGTGGGACACGG + Intergenic
975599053 4:76080403-76080425 TGTGCCAGGCATGGGGCAGAGGG + Intronic
976940242 4:90691763-90691785 TGTCACAGGGGTTTGGCATACGG + Intronic
977327202 4:95590792-95590814 TGTGCCAGGTATTCAGCACTGGG + Intergenic
977929459 4:102735224-102735246 GGTGCAAGGGATTTGGCTGAAGG + Intronic
978408585 4:108405400-108405422 TGTGCCCAGGATGTGGGACATGG - Intergenic
979096115 4:116553400-116553422 TGTGCCAGCAAAGTGGCACAAGG + Intergenic
980830735 4:138127238-138127260 TGTGCCCTGGATGTGGGACATGG + Intergenic
984839664 4:184056725-184056747 TATGCGAGGGATTTGCCATATGG - Intergenic
1202765509 4_GL000008v2_random:145714-145736 TGTGCCCTGGATGTGGGACAAGG - Intergenic
1202765972 4_GL000008v2_random:148842-148864 TGTGCTATGGATATGGGACAAGG - Intergenic
987326389 5:16815234-16815256 TGTCCCAGGCATTTCACACAAGG - Intronic
988310259 5:29548219-29548241 TGTGCCCTGGATGTGGGACATGG - Intergenic
988805820 5:34739734-34739756 TATCCCAGGCATCTGGCACAAGG - Intronic
989967448 5:50481806-50481828 TGTGCCAGTGATTTTGCTGATGG - Intergenic
995683517 5:114745962-114745984 TGTGCCCTGGATGTGGGACATGG + Intergenic
996317822 5:122180734-122180756 TGTGTCAGAGATGTGACACAAGG + Intergenic
1000423741 5:161066522-161066544 GTTGCCAGGGGTTTGGGACAAGG - Intergenic
1000546632 5:162610801-162610823 TGTGTCCGGGATGTGGGACATGG + Intergenic
1001749831 5:174120465-174120487 TATGACAGTGCTTTGGCACAGGG - Intronic
1002777904 6:344133-344155 TGCCTCAGGGACTTGGCACAAGG + Intronic
1002910515 6:1487668-1487690 TATGCCAAGTATTTGGCAAAGGG - Intergenic
1004165808 6:13255720-13255742 TGTGGCTGGGATGTGGGACATGG - Intronic
1004430486 6:15538233-15538255 CGTGACAGGGATTTGACACAGGG + Intronic
1004755710 6:18608288-18608310 TGTGCCCTGGATATGGGACATGG - Intergenic
1005113627 6:22313354-22313376 TGTGCCCTGGATGTGGTACAAGG - Intergenic
1005516337 6:26558131-26558153 TGAGCCAGGGATTTGAGACCAGG - Intergenic
1005922851 6:30416725-30416747 GGTGACAGGGCTTTGGAACAGGG + Intergenic
1006361304 6:33588821-33588843 TGTGGCAGGGAGGTGGCTCAGGG + Intergenic
1007075283 6:39062268-39062290 ACAGCCAGGGATTTGGCTCAAGG - Intronic
1007196662 6:40067138-40067160 TGTGCCTTGGATGTGGGACAAGG + Intergenic
1007786393 6:44282339-44282361 TGAGCCAGGGACTGGGCACCGGG + Exonic
1008208749 6:48694595-48694617 TGCTCCAGGGATGTGGCAAATGG + Intergenic
1010498553 6:76566715-76566737 TGTGCCCTGGATGTGGGACATGG - Intergenic
1010821759 6:80422638-80422660 TGTGCCATGGATGTGAGACATGG + Intergenic
1011099750 6:83708592-83708614 TGCGGCAGGGATTTGGAACCGGG - Intronic
1013594530 6:111648722-111648744 TGTGCCAGGTATATGGTACGTGG - Intergenic
1015196191 6:130526913-130526935 TGCTCCTAGGATTTGGCACAAGG - Intergenic
1015252644 6:131142880-131142902 TGTGCCCTGGATGTGGGACATGG + Intronic
1015622328 6:135144246-135144268 TGAGCCTAGCATTTGGCACATGG - Intergenic
1015632959 6:135249202-135249224 TGTGCCAGGCGTTTGACTCATGG - Intergenic
1018510591 6:164520315-164520337 TGTGCCCTGGATATGGGACATGG + Intergenic
1018662534 6:166101704-166101726 TGTGCCCTGGATGTGGGACATGG - Intergenic
1019575068 7:1733728-1733750 TGTGCTAGAGATTTGGGGCATGG - Intronic
1026272759 7:68850830-68850852 TGTGCAAGGGATTTGATGCAAGG - Intergenic
1026657404 7:72268889-72268911 TGTGCCTGGCTTATGGCACATGG - Intronic
1027182238 7:75948990-75949012 TGTTTCAGGGACTTTGCACATGG - Intronic
1027484776 7:78747782-78747804 TGTCCCTGGGAGTTAGCACAGGG + Intronic
1027528561 7:79301375-79301397 TGTGCCCTGGATGTGGGACATGG + Intronic
1030834442 7:114265384-114265406 TGTGCCCTGGATGTGGGACATGG - Intronic
1031957379 7:127956148-127956170 TGTGCTAAGGATTGGGCATATGG - Intronic
1032669122 7:134067294-134067316 TGTGCCATGGAGTAGGCCCACGG + Intergenic
1034994575 7:155569989-155570011 TGTGGCAGGGACTGGGCACCTGG - Intergenic
1036979569 8:13455000-13455022 TGTATCAGGCACTTGGCACATGG - Intronic
1037229962 8:16646078-16646100 TGTGGCAGGGATTTTGCAAGAGG + Intergenic
1037475500 8:19252922-19252944 TGTGTCAGGGAAGTGGTACAGGG - Intergenic
1037571480 8:20161771-20161793 TGTGCCCAGGATTTTGGACATGG - Intronic
1038026879 8:23598871-23598893 TGTGCCTGTGATCTGGCTCATGG + Intergenic
1038427835 8:27476193-27476215 TGTGCCAGGCACTAGGAACAGGG + Intronic
1038869728 8:31481120-31481142 TGTGCTAGGGCTGAGGCACAAGG + Intergenic
1040012499 8:42674156-42674178 TGTGCCAGGTATTTGGGAACAGG - Intergenic
1041200197 8:55446295-55446317 TCTGCCAGGGTTTTGGCGCTGGG + Intronic
1042253172 8:66776225-66776247 TGTGGATGGGATTTGGAACAAGG - Intronic
1043479038 8:80634084-80634106 TGGCCAAGGGCTTTGGCACAAGG + Exonic
1043483475 8:80676090-80676112 TGTTCCTTGGATTTGGCATATGG + Intronic
1043499422 8:80838105-80838127 TGTGCCTGGGATTTGAGCCAGGG - Intronic
1044267526 8:90200915-90200937 TCAGCCTGGGATCTGGCACAAGG - Intergenic
1045079020 8:98604289-98604311 TGTGCCCTGGATGTGGGACATGG - Intronic
1045438854 8:102190465-102190487 TGTGCCCTGGATCTGGGACATGG - Intergenic
1046224317 8:111258540-111258562 TGTCCAAGGGCTTTGGCTCAAGG - Intergenic
1046556522 8:115779827-115779849 AGTGCCAGAGCTTTGGCAAAAGG + Intronic
1047006445 8:120624969-120624991 TGTGCCTAGGATTTGAGACATGG - Intronic
1047593313 8:126350356-126350378 TCTGCCAGCAACTTGGCACAGGG - Intergenic
1047880662 8:129189409-129189431 TGTGCCAGGCATTTTGCAAAGGG + Intergenic
1049332299 8:142061152-142061174 TGTGTCAGGGCCTTGACACAAGG + Intergenic
1049537798 8:143190025-143190047 AGTGCCAGGGATCTGGCACCAGG - Intergenic
1049846741 8:144806145-144806167 TGTGCCAGGGACTGAGCTCAGGG + Intronic
1052151006 9:25115692-25115714 TGTCACAGGGGTTTAGCACATGG - Intergenic
1052816733 9:33107558-33107580 TAGGCCAGTGATTTGGCACCTGG + Intronic
1052877842 9:33580667-33580689 TGTGCCATGGATGTGGGACAAGG + Intergenic
1052878282 9:33583761-33583783 TGTGCCCTGGATGTGGGACAAGG + Intergenic
1053497700 9:38560446-38560468 TGTGCCCTGGATGTGGGACAAGG - Intronic
1053498140 9:38563538-38563560 TGTGCCGTGGATGTGGGACAAGG - Intronic
1053662986 9:40297503-40297525 TGTGCCATGGATGTGGGACAGGG + Intronic
1053663478 9:40300727-40300749 TGTGCCCTGGATGTGGGACAAGG + Intronic
1053664425 9:40307569-40307591 TGTACCATGGATGTGGGACAGGG + Intronic
1053913492 9:42928033-42928055 TGTGCCATGGATGTGGGACAGGG + Intergenic
1053913986 9:42931268-42931290 TGTGCCCTGGATGTGGGACAAGG + Intergenic
1053914523 9:42935881-42935903 TGTGCCCTGGATGTGGGACAAGG + Intergenic
1054375111 9:64443727-64443749 TGTGCCATGGATGTGGGACAGGG + Intergenic
1054375601 9:64446961-64446983 TGTGCCCTGGATGTGGGACAAGG + Intergenic
1054376107 9:64450859-64450881 TGTGCCCTGGATATGGGACAAGG + Intergenic
1054520189 9:66068716-66068738 TGTACCATGGATGTGGGACAGGG - Intergenic
1054521136 9:66075558-66075580 TGTGCCCTGGATGTGGGACAAGG - Intergenic
1054521629 9:66078781-66078803 TGTGCCATGGATGTGGGACAGGG - Intergenic
1055286727 9:74736510-74736532 TGTGCCAGGCACTTGGCTAAAGG - Intronic
1055782268 9:79832668-79832690 TGTGCCCAGGATATGGGACATGG - Intergenic
1056132823 9:83602500-83602522 TTAGCCCGGAATTTGGCACAGGG - Intergenic
1056527210 9:87454704-87454726 TGTGCCCTGGATGTGGGACATGG - Intergenic
1056586046 9:87927911-87927933 TGTGCCCTGGATGTGGGACAAGG - Intergenic
1056610836 9:88125032-88125054 TGTGCCCTGGATGTGGGACAAGG + Intergenic
1057161322 9:92890416-92890438 TGTGCCATGGATGTGGGACAAGG - Intergenic
1057211508 9:93203248-93203270 TGGGCCAGGGGTTTGGCCCAGGG + Intronic
1057675868 9:97135618-97135640 TGTGCCCTGGATGTGGGACAAGG - Intergenic
1057677167 9:97144929-97144951 TGTGCCCTGGATGTGGGACAAGG - Intergenic
1057677610 9:97148034-97148056 TGTGCCGTGGATGTGGGACAAGG - Intergenic
1059022966 9:110596677-110596699 TGTGCCATGGATGTGAGACATGG - Intergenic
1061845429 9:133385483-133385505 TGGGCCAGGGAGTGGGCTCAGGG - Intronic
1062082159 9:134629887-134629909 TGGGCCAGGGACTTGGCCCTCGG - Intergenic
1062549581 9:137079791-137079813 GGTGCCTGGCACTTGGCACAGGG + Intronic
1203546254 Un_KI270743v1:130604-130626 TGTGCCCTGGATGTGGGACAAGG - Intergenic
1203546724 Un_KI270743v1:133731-133753 TGTGCCATGGATATGGGACAAGG - Intergenic
1187505090 X:19872962-19872984 AGTCCAAGGGAATTGGCACATGG - Intronic
1188833022 X:34924149-34924171 TGTGCCAGGCATATGGGAAATGG - Intergenic
1189848364 X:45156748-45156770 TGTGCCAGGCATTTGGCTGAAGG - Intronic
1191735451 X:64384175-64384197 TGTGCCCTGGATGTGGGACATGG - Intronic
1192484957 X:71517081-71517103 CGTGACAGGAATTTGACACAAGG + Intronic
1193199034 X:78666123-78666145 TGTGCCCTGGATTTGAAACATGG + Intergenic
1193558351 X:82984840-82984862 TGTGCCCTGGATTTGGGACATGG - Intergenic
1193772573 X:85605412-85605434 TGTGCCCTGGATGTGGGACATGG - Intergenic
1193998792 X:88400681-88400703 TGTGCCCTGGATATGGGACATGG + Intergenic
1195814154 X:108867352-108867374 TGTGCCCTGGATGTGGGACATGG - Intergenic
1195866495 X:109438599-109438621 TGTGTCTGGGAATTGGAACATGG - Intronic
1196026071 X:111042570-111042592 TGTGCCAGGAACTTGGAACACGG - Intronic
1197177611 X:123501998-123502020 TCTGCCAGGGATTTAGAATATGG + Intergenic
1198651716 X:138870533-138870555 GGTTCCAGGGATTTAGGACATGG - Intronic
1198873995 X:141203696-141203718 TGTGCCCTGGATGTGGGACATGG - Intergenic
1199423698 X:147676579-147676601 TGTGCCCTGGATGTGGGACATGG + Intergenic
1199671039 X:150148606-150148628 TGTGCCAGGGCTAGGACACAAGG - Intergenic
1201188535 Y:11427319-11427341 TGTGCCAGGCATTGGGCCCTGGG + Intergenic